Latest Articles

Display Method:         

REPLACING FISH MEAL WITH HERMETIA ILLUCENS LARVAE MEAL ON GROWTH PERFORMANCE, DIGESTIVE CAPACITY, PLASMA BIOCHEMICAL INDEXES AND RELATED GENES EXPRESSION IN HEFANG CRUCIAN CARP
XIAO Yang-Bo, CAO Shen-Ping, AO Qing, HUANG Kang, MO Yu-Jian, ZHANG Xin-Ran, ZHENG Xin-Yi, TONG Xiao-Nian, MAO Zhuang-Wen, FAN Jun-De, LIU Zhen, TANG Jian-Zhou
 Available online  , doi: 10.7541/2023.2022.0476 doi: 10.7541/2023.2022.0476
[Abstract](15) [FullText HTML] (10) [PDF 993KB](0)
Abstract:
To investigate the effects of dietary replacement fishmeal protein with Hermetia illucens larvae meal (HM) on growth performance, digestive capacity, plasma biochemical indexes and related genes expression in Hefang crucian carp (Carassis auratus), five isonitrogenous (30%), isolipidic (6%) and isoenergetic (18.50 MJ/kg) diets were formulated to contain graded levels of fishmeal protein replacement by HM (0, 20%, 40%, 60% and 80% respectively) for a 74-day feeding trial. Each treatment was randomly assigned to triplicate groups of 25 fish [initial body weight of (31.50±0.50) g] per aquarium. Fish were fed twice daily to apparent satiation. Results showed that the weight gain rate (WGR) and specific growth rate (SGR) first increased and then decreased with the increased proportion of HM in diets, with a maximum in the 20% substitution group. Feed conversion ratio (FCR) showed an initial decrease followed by an increase, and the 20% substitution group was significantly less than 60% and 80% substitution groups (P<0.05). With the increased proportion of HM in diets, condition factor (CF) and viscerosomatic index (VSI) first increased and then decreased, with a maximum in the 40% substitution group. The hepatopancreas somatic index (HSI) of 80% substitution group was significantly higher than those in the 0, 20% and 60% substitution groups (P<0.05), but there was no significant difference between 40% and 80% substitution group. The moisture and ash of fish body expressed no significant difference. However, crude protein of body in 20% and 60% substitution group was significantly lower than that in 0 group (P<0.05). Crude lipid of body showed an initial increase followed by a decrease, and the highest value was seen in 20% substitution group. There was no significant difference in plasma glucose concentration, total cholesterol concentration, alanine aminotransferase and aspartate aminotransferase activity, but blood ammonia content showed an upward trend, the blood ammonia of 80% substitution group was significantly higher than that of 0substitution group. Total plasma amino acid in the 20% substitution group was significantly higher than those in the other treatments (P<0.05). Plasma malondialdehyde was significantly lower in 60% and 80% substitution groups than that in 20% substitution group (P<0.05). The expression of lat2, pept1 and cdx2 genes in the intestine reached to the highest level in 20% substitution group, while asct2 gene showed the highest expression in 40% substitution group. The expression of tor and igf1 genes in liver was the highest in 40% substitution group, while the highest expression of gh and ghr genes were seen in 60% substitution group. These results suggested that 0-40% of fish meal in the diet of HCC could be substituted by HM, and 20% was the optimal optimum proportion.
THE LOSS OF ACETYL COENZYME A SYNTHETASE ALL0769 REDUCES THE FREQUENCY OF HETEROCYSTS IN ANABAENA SP. PCC 7120
CHEN Bai-Nan, YU Sheng-Chao, YUAN Li, YANG Ming-Kun, GE Feng
 Available online  , doi: 10.7541/2023.2022.0419 doi: 10.7541/2023.2022.0419
[Abstract](22) [FullText HTML] (16) [PDF 4097KB](0)
Abstract:
In this study, we identified All0769 as acetyl coenzyme A (acetyl-CoA) synthetase in Anabaena sp. PCC 7120, and investigated the molecular mechanism of acetyl coenzyme A syntheses (encoded by all0769) in the regulation of heterocyst differentiation in Anabaena sp. PCC 7120 by disrupting all0769 with a CRISPR/Cpf1system. Our results demonstrated that All0769 could catalyze the formation of acetyl-CoA in vitro and loss of the all0769 was found to affect the growth of Anabaena sp. PCC 7120 cells under combined nitrogen. The content of acetyl-CoA and α-ketoglutaric acid were significantly decreased in Δall0769 strain compared to that of WT under combined nitrogen and nitrogen deficiency conditions. We detected (26.17±1.55) nmol/mg protein acetyl-CoA in Δall0769 strain, whereas (43.04±1.09) nmol/mg protein acetyl-CoA was obtained in wild-type strain under combined nitrogen. For the content of α-ketoglutaric acid, Δall0769 strain exhibited a decrease α-ketoglutaric acid [(1.41±0.24) nmol/mg protein] relative to that of WT [(2.13±0.05) nmol/mg protein] under combined nitrogen. Upon deprivation of combined nitrogen, we measured (10.00±2.81) nmol/mg protein acetyl-CoA in Δall0769 strain, while (29.82±4.04) nmol/mg protein acetyl-CoA was received in wild-type strain. Additionally, the content of α-ketoglutaric acid decreased in the Δall0769 strain[ (1.48±0.35) nmol/mg protein], compared with the wild-type strain [(2.74±0.33) nmol/mg protein] after the removal of combined nitrogen. Furthermore, the heterocyst formation was measured and Δall0769 strain shows a significant difference in heterocyst frequency (7.12%) compared with the wild-type (9.22%) at 24h. In conclusion, we identified All0769 as acetyl coenzyme A (acetyl-CoA) synthetase in Anabaena sp. PCC 7120. And All0769 deletion led to impaired growth, content of acetyl-CoA, α-ketoglutaric acid and heterocyst frequency in Anabaena sp. PCC 7120.
FERMENTED SOYBEAN MEAL AND SOYBEAN MEAL REPLACE PARTIAL FISH MEAL ON THE GROWTH PERFORMANCE, HEMATOLOGY, LIVER ANTIOXIDANT ACTIVITIES AND IMMUNE RELATED GENE MRNA EXPRESSION OF JUVENILE COHO SALMO (ONCORHYNCHUS KISUTCH)
XU Li-Xiao, HE Chu-Jing, LIU Yong-Qiang, XU Jian, TONG Tong, YANG Qiu-Yue, WANG Jia-Jing, ZHANG Qin
 Available online  , doi: 10.7541/2023.2022.0493 doi: 10.7541/2023.2022.0493
[Abstract](40) [FullText HTML] (27) [PDF 1024KB](0)
Abstract:
In order to explore the effect of fermented soybean meal and/or soybean meal replacing part of fish meal on the growth performance, hematology, liver antioxidant activities and immune related gene mRNA expression of juvenile coho salmo (Oncorhynchus kisutch), four kinds of iso-nitrogen and iso-lipid and iso-energy feeds were set up in this experiment (crude protein is about 42% and crude lipid is about 15%). The control group was fed with 41% fish meal (FM) (fish meal protein accounts for 27%); the experimental groups were replacement of partial fish meal by soybean meal in the FM diets (SM) (soybean meal protein accounts for 10% and fish meal protein accounts for 17%), replacement of partial fish meal by soybean meal and fermented soybean meal in the FM diets (SM) (soybean meal protein accounts for 5%, fermented soybean meal protein accounts for 5% and fish meal protein accounts for 17%) and replacement of partial fish meal by fermented soybean meal in the FM diets (FSM) (fermented soybean meal protein accounts for 10% and fish meal protein accounts for 17%). Those feeds used to feed juvenile coho salmo with an initial weight of (102.25±0.24) g for 10-weeks and the results indicated that there were no significant differences in the weight gain rate (WGR), specific growth rate (SGR), daily growth rate (DGR) and condition factor (CF) between the FSM10 and FM diets (P>0.05), the WGR, SGR and DGR of the FSM5 diets were significantly lower than the FM control groups but significantly higher than the SM diets (P<0.05) and there were no significant differences in hepatosomatic index (HSI), viscerosomatic index (VSI) and survival rate among groups (P>0.05). There was no significant difference in moisture, crude ash, crude protein among groups (P>0.05), but the crude fat of the SM diets was significantly lower than that of the FM control groups (P<0.05). There were no significant differences in the glucose (GLU), total cholesterol (T-CHO), albumin (ALB) and total protein (TP) between the FSM10 and FM diets (P>0.05) and there were no significant differences in alkaline phosphatase (AKP), aspartate aminotransferase (GOT) and alanine aminotransferase (GPT) among groups (P>0.05), but the GLU, ALB, TP of the FSM5 diets were significantly lower than the FM control diets but higher than the SM diets. The activities of superoxide dismutase (SOD) and catalasehe (CAT) of the FSM10 diets were significantly higher than that of the FM control groups (P<0.05) and there was no significant difference in glutathione (G-SH) between the FSM10 and FM diets (P>0.05). The malondialdehyde (MAD) of the FSM10 diets were significantly lower than that of the FM control groups (P<0.05). The CAT and G-SH of FSM5 of diets wew higher than the SM diets but the MAD wew lower than it. The SOD of FSM5 were lower than FSM10 but have not significant differences with the FM control diets. The relative mRNA expression of gene sod-3, lyz, tlr-3 and c3α of the FSM10 diets were significantly higher than that of the FM control groups (P<0.05), and there were no significant differences in the relative mRNA expression of gene tlr-7 between the FSM10 and FM diets (P>0.05). There were no significant differences in the relative mRNA expression of gene il-6 and hsp-70 among groups (P>0.05). The relative mRNA expression of gene lyz and tlr-3 of FSM5 diets were higher than SM diets. Overall, under the experimental conditions, using fermented soybean meal replace 10% fish meal protein had no significant differences on growth performance and hematology of juvenile coho salmo, but had positive effect on liver antioxidant capacity and immune related gene mRNA expression. Therefore, fermented soybean meal could be used instead of 10% fish meal protein in juvenile coho salmo diets.
SCREENING AND IDENTIFICATION OF A HIGHLY EFFICIENT ALGACIDAL BACTERIUM AND ANALYSIS OF BIOLOGICAL CHARACTERISTICS
JIANG Xian-Long, QIAO Bing-Qing, PAN Zhi-Shun, LIU Xue-Zhu
 Available online  , doi: 10.7541/2023.2022.0399 doi: 10.7541/2023.2022.0399
[Abstract](42) [FullText HTML] (30) [PDF 1495KB](0)
Abstract:
Nowadays, the marine environment is deteriorating and red tides occur frequently. Algacidal bacteria is one of the efficient ways to inhibit red tides. However, there is still limited research on the algacidal bacteria. In order to alleviate the harmful effects of red tide microalgae on the marine ecological environment, we screened algacidal bacteria from mud samples of intertidal zone, and carried out biological characterization. Skeletonema costatum and Prorocentrum donghaiense were chosen to evaluate the algacidal efficiency. extracted by the acetone method and the chlorophyll content was measured. A total of 43strains were obtained from primary screening, and the strain which showed best algacidal effect was identified as Bacillus by morphological observation, physiological and biochemical characteristics and 16S rDNA sequence analysis, and was named as Bacillus sp. 2-1-2. The supernatant of bacteria solution showed strong algacidal effect while the resuspension of bacteria showed no or less algacidal effect, indicating an indirect algacidal mechanism. After coculture of the supernatant of bacteria solution with algae for 30 min, both ROS and MDA levels of the algae changed very significantly (P<0.01). It is speculated that the mechanism of algae lysis may be the secretion of algae lysis active substances indirectly contacting the algal cells, affecting the normal physiological state of the algal cells, stressing the imbalance of the dynamic oxidation balance of the algal cells, the lipid peroxidation of the algal cells destroying the structural integrity and causing the contents to leak out and gradually break down, inhibiting the growth of algal cells. Different conditions, including pH, fermentation time and adding ratio, were studied to ensure their influence on the algacidal effect of the bacteria solution. The results showed that this strain was not tolerated to acidic nor basic condition. The optimum fermentation time was 2-4 days and the optimum addition rate of bacteria solution was 20%. The properties of algacidal substance were preliminary investigated using the supernatant of the bacteria solution. It is notable that the algacidal substance was resistant to heat, basic condition and weak acidic condition. This work provides theoretical basis for the deeper research at the molecular level and further utilization of algicidal bacteria.
PRIMARY ANALYSIS OF OF PHD2 FROM THREE DIFFERENT CETACEANS IN HYPOXIA SIGNAL PATHWAY
LI Ying, WANG Ding, XIAO Wu-Han,
 Available online  , doi: 10.7541/2023.2019.261 doi: 10.7541/2023.2019.261
[Abstract](43) [FullText HTML] (26) [PDF 1356KB](5)
Abstract:
Hypoxia was a major challenge faced by cetaceans during the process of prolonged diving in the secondary aquatic adaption. Although physiological and anatomical traits of hypoxia tolerance of cetaceans have been well characterized, the molecular basic behind their adaption remain unknown. Proline hydroxylase domain enzyme 2 (PHD2), one of the pivotal regulators of the molecular response in hypoxic stress, can utilize oxygen to hydroxylate and mediate the stability and transcriptional activity of the alpha submit of HIF. In this study, the PHD2 gene was cloned from three species with different duration, the sperm whale (Physeter macrocephalus), the beluga whale (Delphinapterus leucas), and the Yangtze finless porpoise (Neophocaena phocaenoids asiaeorientalis). Sequence analyses revealed that the sequences of PHD2 from these three species were highly evolutionarily conserved, with few deletions and substitutions. In addition, we analyzed PHD2 in these three species in the hypoxia signaling pathway. Under normoxia, PHD2 of three species can degrade HIF-α protein of three species. Under hypoxia (O2 concentration less than 2%), the HIF-α (HIF-1α and HIF-2α) proteins can accumulate. Furthermore, the degradation of HIF-α by PHD2 in cetaceans is relying on the recognition of the amino acid motif LTLLAP and LEMLAP on HIF-1α, the LAQLAP and LETLAP amino acid motif of HIF-2α, as well as the proline hydroxylase efficiency of PHD2. It is speculated that PHD2 use oxygen as a substrate to hydroxylate designated proline residues within the conserved motif LXXLAP of HIF-1α and HIF-2α, allowing von Hippel-Lindau protein (pVHL), the substrate recognition component of an E3 ubiquitin ligase complex, to bind to hydroxylated HIF-1α and HIF-2α and target them for proteasomal degradation. Without the oxygen, the activity of PHD2 is restrained and the function is not fully utilized. This study is a preliminary exploration on the PHD2 function of three different hypoxia-tolerant whales, aiming to provide a basis for further study of the complex feedback regulation of PHD2 and HIF. Future investigations on another PHD isoforms over HIF pathways are able to be achieved. Thus, it also provide the basis for in-depth study on adaptive mechanisms of hypoxic tolerance in cetaceans.
THE ANALYSIS OF MUSCLE NUTRIENT COMPOSITION OF SIX REPRESENTATIVE BREEDING POPULATION OF RAINBOW TROUT (ONCORHYNCHUS MYKISS)
LI Wen-Wen, WANG Bing-Qian, HUANG Tian-Qing, GU Wei, LIU En-Hui, WANG Gao-Chao, ZHOU Jin-Xin, DONG Fu-Lin, JI Kai, LIU Xue-Feng, WANG Xian-Ce, JIAO Wen-Long, XU Ge-Feng
 Available online  , doi: 10.7541/2023.2022.0381 doi: 10.7541/2023.2022.0381
[Abstract](75) [FullText HTML] (56) [PDF 852KB](1)
Abstract:
Rainbow trout (Oncorhynchus mykiss) is an important cold-water fish with high nutritional and economic value in China. However, less researches of high-quality rainbow trout germplasm resources populations were reported. This study aimed to provide essential data for assessing the nutrient composition of rainbow trout muscle, trait screening and the breeding process of new species by comprehensively evaluating the muscle nutritional components and quality of representative breeding populations of rainbow trout in six different regions. The 2-3 years old rainbow trout originally from Mudanjiang, Heilongjiang (HM), Ningan, Heilongjiang (HN), Gansu (GL), Xinjiang (XY), Jilin (JB) and Liaoning (LB). Thirty fish from each population were divided equally into three replicates, and the composition and content of moisture, crude protein, crude fat, ash content, amino acids and fatty acids in muscle were measured according to the national standard. The results showed that there were significant differences (P<0.05) in moisture (66.50%—77.00%), ash (1.12%—1.43%), crude protein (19.00%—21.84%) and crude fat (2.04%—9.08%) among the breeding groups, and the crude protein content of HN (21.26%) and GL (21.84%) was significantly higher than the other populations (P<0.05). In addition, the protein content of arious groups was greater than 16% and met the Food and Agriculture Organization of the United Nations (FAO)/Word Health Organization (WHO) Standard (2013). Seventeen amino acids were detected in the six breeding populations with a total amino acid contents (TAA) were 15.27%—18.90%. The total amino acid components were significantly higher in LB and JB than those in the other four breeding populations (P<0.05), and also had higher essential amino acid index scores (EAAI). Among the 17 amino acids, Glu had the highest content (2.64%—2.88%), followed by Asp (1.58%—2.03%). The content of fresh amino acids was as high as 11.25%-11.79%, indicating that rainbow trout muscles were fresh and tender, and the amino acid index (AAS), chemical index (CS) and EAAI of all populations were higher than the standard of FAO. Twenty-three fatty acids were detected in the six breeding populations, containing eight saturated fatty acid (SFA), four monounsaturated fatty acids (MUFA) and eleven polyunsaturated fatty acids (PUFA), with contents of 17.81%—31.75%, 27.86%—30.35% and 40.25%—54.32%. The PUFA to SFA ratio was between 1.34 to 3.05. HN and XY had higher SFA than other populations, while HM and GL had higher PUFA than other populations. Additionally, JB and LB had relatively higher MUFA than other populations. Taken together, six representative breeding groups of rainbow trout have balanced muscular nutrients and meet the FAO/WHO standard, which provides germplasm resources for rainbow trout breeding.
YEAST SELENIUM ADDED TO COTTONSEED PROTEIN CONCENTRATE DIET ON GROWTH PERFORMANCE AND FLESH QUALITY OF GRASS CARP (CTENOPHARYNGODON IDELLA)
LI Han-Dong, LI Xu-Qiao, JI Hong, SUN Jian, HU Ze-Chao, LIU Sha
 Available online  , doi: 10.7541/2022.2022.0361 doi: 10.7541/2022.2022.0361
[Abstract](110) [FullText HTML] (65) [PDF 1400KB](1)
Abstract:
In aquaculture, selenium has been shown to improve the immune and antioxidant capacity of aquatic animals. As a kind of new style protein resource, cottonseed protein concentrate plays a crucial role in aquaculture industry. However, the antinutritional factors (such as gossypol) seriously hindered the application of cottonseed protein concentrate in aquatic feed. Therefore, the purpose of this study was to investigate the effects of adding yeast selenium (YS) to the diet that containing cottonseed protein concentrate on the growth performance and muscle quality of grass carp (Ctenopharyngodon idella). Four isonitrogenous and isolipidic diets were designed: 0, 0.3, 0.6 and 0.9 mg/kg YS were added to the diet containing cottonseed protein concentrate, respectively, and corresponding named YS0, YS3, YS6 and YS9. A total of 240healthy grass carp with similar size (initial weight: 309.74±0.36 g) were randomly distributed into 12 net cages in the pond. Each of the experimental diets was randomly fed triplicate cages for 56-day three times per day (9:00, 13:00, 17:00). The results showed that: (1) In terms of growth performance, compared with YS0 group, there was no significant difference in growth performance between YS3 and YS6 groups (P>0.05), but the final body weight (FBW), weight gain rate (WGR) and specific growth rate (SGR) of YS9 group were significantly reduced (P<0.05); (2) In terms of muscle quality, compared with YS0 group, the crude protein content, selenium content, hydroxyproline content and hardness of grass carp muscle in YS3 group were significantly increased (P<0.05), and the fiber diameter and cohesiveness of muscle were significantly decreased (P<0.05). The study indicated that the addition of YS to the diet containing cottonseed protein concentrate (the selenium content of the diet was 0.6 mg/kg) had no significant effect on the growth performance of grass carp, and flesh quality were significantly improved. However, exceeded dietary YS had negative influence on the growth performance of grass carp. This study provides a theoretical basis for further application of cottonseed protein concentrate in aquatic feed.
PERCENTAGE OF STARVED INDIVIDUALS IN A GROUP AND SIMULATED PREDATION RISK ON THE COLLECTIVE BEHAVIOR OF CHINDONGO DEMASONI
ZHANG Na, LI Jia-Qian, FU Cheng, FU Shi-Jian
 Available online  , doi: 10.7541/2023.2022.0378 doi: 10.7541/2023.2022.0378
[Abstract](79) [FullText HTML] (66) [PDF 1630KB](1)
Abstract:
Fish are constantly under a dilemma to balance the behaviors of foraging and predator avoidance in their natural habitats. The present study aimed to investigate the balance between sheltering and foraging activities of fish shoal with different percentages of starved individuals, as well as their response to a simulated predation risk. The Chindongo demasoni, a group living cichlid fish species was selected as an experimental model, and a six-arm radius maze equipped with both shelters and food items was used as an observation arena. The fission-fusion dynamics of fish shoals composed of 8 members with different percentages of starved individuals (8F0S, 7F0S, 4F4S, 1F7S and 0F8S, F represents regularly fed member and S represents starved member) were videoed and analyzed. The main results are as follows (1) Regularly fed fish shoal (i.e., 8F0S) showed higher distribution density in the shelter arm compared to other regions of the maze. However, with the increase of starved member, the distribution density showed a linear increase tendency in the food arm, and there had been no significant difference between in shelter- and food-arms in 0F8S. (2) The grouping frequency in shelter arm decreased with the increased number of starved member, however, none of the variables about fission-fusion dynamics in food arm increased with the increased starved member. (3) Simulated predation risk elicited profound increase in grouping in the shelter arm no matter what the shoal composition is. These results suggested that (1) High priority of behavior strategy in C. demasoni is avoiding predation risk when explored in a novel environment. (2) Shoaling behavior of C. demasoni might be decided by majority of group members rather than minority individuals.
A LIGHTWEITGH CONVOLUTIONAL NEURAL NETWORK-BASED METHOD FOR LOSSLESS IDENTIFICATION OF INDIVIDUAL TAKIFUGU RUBRIPES
ZHOU Jia-Long, JI Bai-Min, NI Wei-Qiang, ZHU Song-Ming, ZHAO Jian, YE Zhang-Ying
 Available online  , doi: 10.7541/2023.2022.0422 doi: 10.7541/2023.2022.0422
[Abstract](89) [FullText HTML] (67) [PDF 2455KB](0)
Abstract:
In aquaculture, avoiding duplicate individual biomass estimation is an important prerequisite for achieving accurate fish biomass estimation, the key of which is to perform individual fish identification, while few relevant studies have been reported. In this paper, a lightweight convolutional neural network-based identification method for individual fish identity was proposed, which can achieve high accuracy identification of individual Takifugu rubripes without loss. Firstly, SOLOv2 model was used for foreground segmentation, and combined with the characteristics of the body size of Takifugu rubripes, the dataset generation and filtering were completed by the method of calculating the center of mass and Different Hash Algorithms; subsequently, the effectiveness of mainstream deep learning image classification backbone networks and different loss functions in Takifugu rubripes identity recognition are tested separately from multiple dimensions; following that, an optimal combination method for the lossless identification of individual identity of Takifugu rubripes was established based on MobileNet v2 backbone network coupled with Softmax Loss function. The results showed that the accuracy of the proposed method can reach 90.2%, which is better than other related mainstream methods (accuracy 73.6%—89.3%), and related research results will provide technical support for non-destructive identification of individual fish identity and accurate biomass estimation in recirculating water culture.
COMMUNITY STRUCTURE AND INFECTION CHARACTERISTICS OF NEMATODES IN THE COILIA NASUS IN ANQING SECTION OF THE YANGTZE RIVER
DAI Pei, MA Feng-Jiao, TIAN Jia-Li, WANG Yin-Ping, YANG Yan-Ping, LIU Kai
 Available online  , doi: 10.7541/2023.2022.0099 doi: 10.7541/2023.2022.0099
[Abstract](128) [FullText HTML] (89) [PDF 1198KB](1)
Abstract:
Coilia nasus is an anadromous fish, and the parasitic nematodes are a confirmation of its habitat history. In order to understand the relationship between the migration time of C. nasus and its nematodes, the infection and community structure of nematodes in C. nasus were investigated from April to July 2018 in Anqing section of the Yangtze River. The results showed that the infection rate of C. nasus was 96.0%, the average intensity was (8.06±7.26), and the average abundance was (7.74±7.29) . A total of 7species were identified by ITS molecular markers, including 2species of Anisakis, 4species of Hysterothylacium and 1species of Raphidascaris. All of them are marine parasites and can be used as evidence that C. nasus has seawater life. Anisakis pegreffii (84.5%) had the highest infection rate, followed by Hysterophylaxium aduncum (31.0%). The average intensity and abundance were also high. The average intensity were (6.40±6.08) and (2.81±2.49), and the average abundance were (5.41±6.05) and (0.87±1.90), respectively. The average intensity and abundance of A. pegreffii showed an upward trend in the early stage of migration, and decreased slightly but not significantly in late June(P>0.05), while the H. aduncum showed a downward trend. The community structure of C. nasus nematode varied at different migration times. The richness, mean richness and the Brillouin index showed a downward trend, but the dominant species has always been A. pegreffii, and the number in the intestinal and pyloric caecum accounts for 46.13% and 30.02% respectively. The study will provide a reference for the later development of impact of nematode parasitism and population supplement, and also provide a new method for using parasite markers to study the migratory ecology of C. nasus
TOP-DRESSING OF FISH STEARIN OIL BY STEP-COATING PROCESS ELEVATES THE WATER STABILITY OF HIGH-FAT FEED FOR LARGEMOUTH BASS (MICROPTERUS SALMOIDES)
KE Tian-Hong, DONG Zhi-Yong, SHI Bo, CAI Lin-Wei, WU Bo-Wen, ZHANG Yue-Xing
 Available online  , doi: 10.7541/2023.2022.0488 doi: 10.7541/2023.2022.0488
[Abstract](90) [FullText HTML] (90) [PDF 955KB](1)
Abstract:
The current study was aimed to test if step-vacuum coating with fish stearin oil can elevate the water-stability of high-fat feed for largemouth bass. A batch of uncoated pellet was obtained from a commercial extrusion line, based on the current practical feed formulation of largemouth bass. Four groups of high-fat experimental feed were prepared by direct vacuum coating or step-coating with fish stearin oil and winterized fish oil to the uncoated pellet from the same batch, and named as winterized fish oil direct-coating (WOD) group, homogenized fish oils direct-coating (HOD) group, “1/2” fish stearin oil top-dressing (“1/2” SOT) group and “1/3” fish stearin oil top-dressing (“1/3” SOT) group. The parameters on water stability of feed were measured after soaking in water for 10, 20, 40, 60, 90, and 180 min, respectively, under the conditions of water temperature at 26℃ with slight oscillation. The results showed that the loss rates of dry matter (DM), crude protein (CP), and crude fat (CF) of each feed increased gradually with soaking time, and the average loss rates of DM, CP, and CF were 22.34%, 10.26% and 4.60%, respectively, after soaking for 180min. Soaking within 60 min, the WOD group performed the worst, the loss rates of CF and DM were significantly higher than that of other groups, and the “1/2” SOT group performed the best, the loss rates of CF and DM were significantly lower than that of other groups, but no significant difference was found in the loss rate of CP among all groups (P>0.05). After soaking for 90 min, the CF loss of both “1/2” and “1/3” SOT groups were significantly lower than that of WOD and HOD groups, however, no significant difference was found between the two SOT groups. The DM loss of “1/2” SOT group was significantly lower than that of WOD group, but there was no significant difference among WOD, HOD, and “1/3” SOT groups. The loss of CP in WOD group was significantly higher than that of other groups. After soaking for 180 min, the CF loss in “1/2” SOT group was significantly lower than that of other groups, and the loss of DM and CP in WOD group were significantly higher than that of other groups. Based on the comparative analysis furtherly, the results indicated that by increasing the saturation of oil for coating through blending the more saturated fish stearin oil with winterized fish oil, adopting the step-vacuum coating process to top-dress the fish stearin oil to feed pellet, or increasing the proportion of fish stearin oil for top-dressing was helpful to elevate the water stability of high-fat feed for largemouth bass. And each mean could effectively reduce the loss of CF and DM in the feed, but not the loss of CP.
ACOUSTIC CHARACTERISTICS OF FAST SWIMMING AND ITS INFORMATION UTILIZATION FOR LITOPENAEUS VANNAMEI
LI Zhao-Cheng, XIANG Sheng-Yu, SHEN Meng-Ting, WANG Xiu-Xiu, ZHANG Ri-Xin, CAO Zheng-Liang
 Available online  , doi: 10.7541/2023.2022.0303 doi: 10.7541/2023.2022.0303
[Abstract](118) [FullText HTML] (105) [PDF 4275KB](0)
Abstract:
White-leg shrimp (Litopenaeus vannamei) as an important aquatic economic species in the world, behavioral acoustics research will help to improve the level of aquaculture. In the present study, two sizes of the white-leg shrimp (4—6 cm TL and 10—11 cm TL) from the nursery of Shanghai Ocean University were investigated. The experiment was conducted in 2 glass tanks (4 cm×28 cm×30 cm) which were shaded. In addition, there were two controllable underwater lights of 10W in each tank. One underwater camera and one hydrophone were fixed in each tank. The hydrophone was 20 cm away from the top and connected to an SM4 recorder. Prior to the experiment, the controlled underwater light and the underwater camera (turned on before placing the water) are placed in the desired location. For each measurement, individual white-leg shrimp was used and acclimated for 40—60min under the dark prior to measuring. Sounds were recorded for 10 minutes after the lights were switched on (a timer controlled the time). Meanwhile, the behaviors of the white-leg shrimp were captured by the underwater camera.The results showed that the main peak frequency of the acoustic signals was about 250 Hz, and the secondary peak appeared near 425 Hz produced by the small white-leg shrimp during fast swimming. The primary peak frequency of acoustic signals was 70 Hz, and the secondary peak was 15 Hz produced by the large shrimp. Further, the center frequency and frequency range of the acoustic signals of the tail flick was significantly different from that of the fasting swimming. We also collected a signal of tail flick from the white leg shrimp in the shrimp pond. The energy range of the signal was 0.5—6 kHz. The energy frequency range was 1—4 kHz, and the maximum concentrated energy frequency was about 2 kHz. Different from the laboratory’s results, the main peak frequency of the signal was about 1.8 kHz, and there was a main secondary peak of about 250 Hz. In comparison to the laboratory data, the pond background noise and the sound produced by the white-leg shrimp during fast swimming were low-frequency signals. The frequency of the signal by tail-flick of the white-leg shrimp was higher than the background noise. The signal duration in the pond and laboratory was about 0.01s, and the frequency distribution of the energy was concentrated at 2—3 kHz. In summary, we studied the fast swimming sound production by two size white-leg shrimp. In the future, the tail flick sounds produced by shrimps of different conditions need further study, which is essential to utilizing sound information for monitoring shrimp health.
APPARENT DIGESTIBILITY OF FIVE NEW NON-GRAIN PROTEIN INGREDIENTS FOR LARGE YELLOW CROAKERS (LARIMICHTHYS CROCEA)
ZHANG Jian, LI Lei, DONG Yan-Zou, LI Xue-Shan, WANG Ling, SONG Kai, TAN Bei-Ping, LU Kang-Le, ZHANG Chun-Xiao
 Available online  , doi: 10.7541/2022.2022.0405 doi: 10.7541/2022.2022.0405
[Abstract](116) [FullText HTML] (93) [PDF 741KB](3)
Abstract:
Finding inexpensive and high-quality protein sources to replace fish meal is currently a thorny issue for the feed industry due to the decline in fishery resources and the increased demand for fishmeal, which has led to a significant increase in fishmeal prices. In this study, we selected five new non-grain protein sources, Clostridium autoethanogenum protein (CAP), chlorell meal (CM), Hermetia illucens meal (HM), Tenebrio molitor meal (TM), and cottonseed protein concentrate (CPC). This study was conducted to evaluate the apparent digestibility of dry matter, crude protein, crude lipid, gross energy, and amino acid of these five protein sources by large yellow croakers (Larimichthys crocea) to provide a theoretical basis for the design of artificial compound feed formulations for large yellow croakers. Triplicate groups of fish (initial weight=154.0±5.3 g) were fed the test diets to apparent satiation two times daily for eight weeks. The test diets consisted of 70% basal diet and 30% test ingredients, and 0.1% yttrium oxide (Y2O3) was used as an indicator. The results showed that dry matter coefficients of five test ingredients ranged from 56.77% to 75.53%(CAP>TM>CM>HM>CPC); The apparent digestibility of the crude protein ranged from 69.93% to 89.59%(CAP>CM>CPC>HM>TM); The apparent digestibility of crude lipid ranged from 58.58% to 93.77%(CAP>CM>TM>CPC>HM); The apparent digestibility of the gross energy ranged from 63.39% to 84.33%(CAP>HM>CM>TM>CPC); The apparent digestibility of the total amino acids ranged from 76.62% to 93.24%(CAP>CM>CPC>HM>TM). In conclusion, CAP is the optimum protein source of the five ingredients. However, CM, TM, and CPC require supplementation of deficient nutrients in their diets, and HM involves the addition of a defatting process to improve raw material nutrient levels. Additionally, comparative feeding experiments are required to determine the optimum amount of these five protein sources to be added to the large yellow croaker feed.
DISTRIBUTION OF CUSPIDOTHRIX ISSATSCHENKOI IN THE SHALLOW LAKES IN MIDDLE AND LOWER REACHES OF THE YANGTZE RIVER
LI Wen-Ke, GENG Ruo-Zhen, CHEN You-Xin, LI Hua, LI Ren-Hui, YU Gong-Liang
 Available online  
[Abstract](190) [FullText HTML] (142) [PDF 1541KB](5)
Abstract:
Cuspidothrix issatschenkoi formerly Aphanizomenon issatschenkoi, is the potentially toxic cyanobacterium. Nowadays, this species has been discovered on all continents except the Antarctica. The cyanobacterial blooms and toxins caused by C. issatschenkoi from different countries have caused many aquatic environmental problems. However, there are few studies researched on its geographical distribution and ecological characteristics in China. The present study initiated based on the field survey data derived from 87shallow lakes in the middle and lower reaches of the Yangtze River from June to August 2013, we found C. issatschenkoi occurred in more than half of the freshwater lakes in the investigated area of our study, and its biomass fluctuating from 0.001 to 3.019 mg/L. The correlation analysis between C. issatschenkoi and environmental factors showed that the biomass of C. issatschenkoi is negative with the total phosphorus in freshwater ecosystem, indicated that C. issatschenkoi had better adaptability and competitiveness under the condition of low phosphorus. And there is a positive correlation between its biomass and total nitrogen, thus sufficient nitrogen source in the water may increase the potential risk of forming water blooms by C. issatschenkoi. Since C. issatschenkoi has been reported to be the main cyanobacterial species to synthesis anatoxins in Chinese freshwater bodies, indicating that severe threat in freshwater security may posed by this species. Our results revealed the geographical and ecological characteristics of C. issatschenkoi, which can provide data foundation for the ecological research and management of harmful algae in the future.
PHYSIOLOGICAL RESPONSES TO HEAT STRESS IN THE GILL OF RAINBOW TROUT (ONCORHYNCHUS MYKISS) REVEALED BASED ON UPLC-Q-TOF/MS METABOLOMICS
GENG Chuan-Ye, SUN Yan-Chun, LI Bo-Lun, DING Lu, LIU Ying-Jie, WEI Xiao-Feng, LIU Wen-Zhi, HAN Lin, YUAN Fang-Ying, WANG Peng, HAN Shi-Cheng
 Available online  , doi: 10.7541/2023.2022.0447 doi: 10.7541/2023.2022.0447
[Abstract](115) [FullText HTML] (164) [PDF 3322KB](20)
Abstract:
Rainbow trout (Oncorhynchus mykiss) is a cold-water fish widely cultivated in the world. Heat stress has a great impact on its growth and reproduction. At present, global warming and extreme high temperature in summer have seriously affected its growth and survival. To characterise their metabolic changes under heat stress, this study explored the metabolic physiological responses of rainbow trout gill target organs under high temperature exposure (20℃and 24℃) and subsequent return to initial temperature (14℃) based on UPLC-Q-TOF/MS metabolomics techniques. The results showed that compared to the control group, 128, 130 and 108 differentially significant metabolites were identified in the 20℃ and 24℃ high temperature groups and the 14℃ recovery group, respectively. Metabolites related to lipid metabolism such as linoleic acid and arachidonic acid, as well as metabolites related to cellular redox status such as reduced coenzyme Ⅱ (NADPH), glutathione (GSH) and glutathione disulfide (GSSG) were significantly altered by high temperature exposure. Enrichment analysis showed that these metabolites were mainly involved in metabolic pathways such as glycerophospholipid metabolism, sphingolipid metabolism, linoleic acid metabolism, arachidonic acid metabolism, pentose phosphate pathway and glutathione metabolism in rainbow trout gills. Notably, none of the metabolic pathways, except sphingolipid metabolism, returned to normal after the temperature returned to initial. The above results suggested that heat stress led to disruption of lipid metabolism in rainbow trout gill target organs, which may lead to structural and functional damage to gill cell membranes, induced an inflammatory response in gill cells and generated an immune response. At the same time, rainbow trout gill cells regulated the GSH/GSSG ratio in glutathione metabolism through NADPH production by the pentose phosphate pathway to increase the antioxidant capacity of cells to counter oxidative stress and prevent apoptosis. The results of this study provided a scientific basis for understanding the physiological responses of rainbow trout under heat stress.
EFFECTS OF STOCKING DENSITIES ON GROWTH, ANTIOXIDANT ENZYME ACTIVITIESAND INTESTINAL MICROBIOTA OF HYBRID OF CULTER ALBURNUS (♀)×MEGALOBRAMA TERMINALIS (♂) IN IPRA SYSTEM
LI Qian, SUN Li-Hui, JIANG Jian-Hu, CHEN Jian-Ming, GUO Jian-Lin, GAO Ling-Mei, ZHANG Hai-Qi
 Available online  , doi: 10.7541/2022.2021.0172 doi: 10.7541/2022.2021.0172
[Abstract](227) [FullText HTML] (108) [PDF 1001KB](0)
Abstract:
This experiment was conducted to evaluate the appropriate stocking density of a new hybrid strain of (♀Culter alburnus) × (♂Megalobrama terminalis) [initial body weight of (5.58±0.45) g] for in-pond raceway aquaculture (IPRA) system. The new hybrid strains were farmed in three stocking densities of 0.5 (SD1), 1.0 (SD2) and 1.5 kg/m3 (SD3). The growth and antioxidant enzyme activities were analyzed on 90, 120, 150 and 180 days while the intestinal microbiota composition was analysed when the experiment finished. Growth results showed that the body weight and specific growth rate (SGR) decreased significantly when stocking density was above 1.0 kg/m3 on 120 days (P<0.05). In the day of 150—180, indices of SGR and body weight decreased significantly with the increasing of rearing density (P<0.05). Antioxidant enzyme activities in serum increased with the increasing of stocking density on 90 days, and fish farmed at SD3had significantly higher antioxidant enzyme activities than group of SD1 (P<0.05). In contrast, antioxidant enzyme activities in serum decreased with the increasing of stocking density in the day of 150—180, and the activities of catalase (CAT)and total antioxidant capacity (T-AOC) were significant lower in the group of SD3 than group of SD1 (P<0.05). Antioxidant enzyme activities in liver increased with increasing stocking density in the day of 150—180, and values of GSH-Px decreased significantly with the increasing of stocking density (P<0.05). MDA level decreased with increasing stocking density before the day of 120, whereas fish farmed at SD2 and SD3 groups had significant higher MDA values than the SD1 group on 180 days. The intestinal microbiota results demonstrated that microbiota community changed in genus level obviously, and the relative abundances of pathogenic genus such as Aeromonas, Pseudomonas and Acinetobacter increased while Shannon diversity indices decreased significantly in group of SD3 (P<0.05). In conclusion, when culturing days below 120, the stocking density of SD2had no great effect on the growth and antioxidant capacity, and the suitable stocking density is suggested below 1.0 kg/m3. When culturing time extends to 150 days, the stocking density of SD1 would inhibit growth and increase the relative abundances of pathogenic genus and decrease the Shannon diversity index of intestine microbiota, therefore 0.5 kg/m3 is suggested as an appropriate density.
MICROSATELLITE GENETIC DIVERSITY EVALUATION AND DEVELOPMENT PREDICTION OF THE YANGTZE FINLESS PORPOISE POPULATION IN THE POYANG LAKE
WANG Ren-Yong, CHEN Min-Min, WAN Xiao-Ling, TANG Bing, HAO Yu-Jiang, MEI Zhi-Gang, FAN Fei, WANG Ke-Xiong, WANG Ding, ZHENG Jin-Song
 Available online  , doi: 10.7541/2023.2022.0345 doi: 10.7541/2023.2022.0345
[Abstract](142) [FullText HTML] (131) [PDF 802KB](5)
Abstract:
The Yangtze finless porpoise (Neophocaena asiaeorientalis asiaeorientalis; YFP) is now critically endangered, calling for prompt and effective actions to strengthen research and conservation. The Poyang Lake is the most critical habitat of the YFP, holding almost half of the whole wild population of this species. And thus, this population is vital for the conservation of this critically endangered species. In this study, to evaluate the genetic diversity of the porpoise population living in the Poyang Lake and to predict its development in the future, both blood samples from live YFPs (124 individuals) and tissue samples from 42stranded YFPs have been analyzed, using 10 microsatellite genetic markers. Results indicated that the Poyang Lake porpoise population has a moderate level of genetic diversity, with an average allele number of 5.80, an average observed heterozygosity (Ho) of 0.653, and an expected heterozygosity (He) of 0.664. Meanwhile, when samples from stranded porpoises were excluded, the mean number of alleles decreased to 5.50; three unique and rare alleles at three microsatellite loci were found exclusively among stranded porpoises, indicating that abnormal deaths caused by anthropogenic reasons might lead to genetic diversity loss of this population in the Poyang Lake. Besides, the software BottleSim V2.6 was applied to simulate the developing process of genetic diversity in this population. Simulations results showed that genetic diversity would decline quickly if kept its current effective population size (Ne=62) and sex ratio (0.87﹕1); while an effective population size of more than 200 individuals or a census population size of more than 1000 individuals is necessary, to realize the long-term goal of preserving more than 90% genetic diversity in 100 years. Results obtained in this study are significant for the genetic conservation of the population living in the Poyang Lake, and the whole species as well.
EXPRESSION AND ANTI-BACTERIAL IMMUNITY OF CD8Α AND CD207 IN GRASS CARP
TIAN Ding, JIANG Fei, CHEN Chun-Xiu, LI Ke-Ke, BIAN Bing-Jie, WU Zhi-Xin, CHEN Xiao-Xuan
 Available online  , doi: 10.7541/2022.2021.0246 doi: 10.7541/2022.2021.0246
[Abstract](164) [FullText HTML] (120) [PDF 1484KB](1)
Abstract:
CD8α and CD207 are important phenotypic molecules on Dendritic cells (DCs), which play important roles in DCs-mediated adaptive immunity. To investigate their role in the anti-bacterial immune response of grass carp (Ctenopharyngodon idella) DCs, the extracellular regions of CD8α and CD207 were amplified from the cDNA of grass carp DCs, and the recombinant expression plasmid pET-32a- CD8α/CD207 was constructed and converted to competent cell Transetta (DE3), where it was expressed and purified to produce polyclonal antibodies against CD8α and CD207. The functions of grass carp CD8α and CD207 in the anti-bacterial immune process were revealed by qPCR, Western blot and flow cytometry. The results showed that the prepared polyclonal antibodies recognized both prokaryotic expressed recombinant proteins and endogenous proteins at the individual and cellular levels. Functionally, after treatment with inactivated Aeromonas hydrophila to grass carp DCs, the expression levels of CD8α and CD207 were significantly up-regulated within 24h (P<0.05). Besides, the molecules of CD8α and CD207 play an important role in the process that the antigen presented by grass carp DCs stimulates the proliferation of mixed lymphocytes. Therefore, grass carp DCs exhibits a conservative immunophenotype and function similar to those in mammals, and the results of the study will provide a basis for elucidating the adaptive immune regulation mechanism mediated by grass carp DCs.
POPULATION DYNAMICS AND PARASITISM PREFERENCE OF DIPLOSTOMUM SPATHACEUM IN GYMNOCYPRIS SELINCUOENSES FROM SELINCO LAKE, XIZANG AUTONOMOUS REGION, CHINA
PAN Ying-Zi
 Available online  , doi: 10.7541/2023.2022.0143 doi: 10.7541/2023.2022.0143
[Abstract](619) [FullText HTML] (507) [PDF 848KB](7)
Abstract:
Through the population dynamics, study the temporal and spatial changes of Diplostomum spathaceum infection, and study whether the infection has parasitic preference for host gender, left and right eyes and different parts of eyeball, find out the infection of D. spathaceum in Gymnocypris selincuoenses from Selinco Lake, analyze the causes of population growth and decline, and explore its life history strategy. Catching the G. namensis in different seasons over the year, and recorded the total length, weight and gender. Collected and counted numbers of D. spathaceum, and calculated the prevalence and mean abundance in different seaons and of different total-length groups of G. namensis. Through independent sample nonparametric test, it was judged whether there were significant differences in the number of infections in different gender hosts, left and right eyes and different parts of eyeball, so as to test whether there were parasitic preferences of D. spathaceum. A total of 165 G. namensis (28.7—49.5 cm in length, 37.9±4.0 cm in average length, 196.9—827.2 g in weight, 473.3±127.9 g in average, including 82 females and 83 males) were dissected. A total of 515 D. spathaceum were detected, and the maximum parasitic amount was 32 per fish. We found D. spathaceum can infect D. spathaceum all year round. In the summer and autumn of 2020, the prevalence and mean abundance showed a downward trend. In 2021, the prevalence was high in spring, decreased in summer, and the highest in autumn. The mean abundance showed an upward trend. According to the total-length range of G. namensis, they were divided into five total-length groups at an interval of 5 cm. The prevalence and mean abundance were the lowest in the total-length group of 25 cm≤TL<30 cm, close in the total-length groups of 30 cm≤TL<35 cm, 35 cm≤TL<40 cm and 40 cm≤TL<45 cm, and increased greatly in the total-length group of 45 cm≤TL<50 cm. There was no preference in the host of different genders, and left and right eyes of the hosts, but there was an obvious preference in the lens and vitreous humours, and more parasitic in the lens. The seasonal dynamics of the population growth and decline of D. spathaceum are closely related to environmental factors such as water temperature, the migration time of migratory birds and the existence of snails. With the increase of the total length of G. namensis, the eyeball volume increases, which can accommodate more eye flukes, and the long-term cumulative contact also makes the number of infections more. In the 45 cm≤TL<50 cm total-length group, the prevalence and mean abundance increased sharply, may be because of the larger body size represents a larger surface area, which can not only be invaded by more cercariae, but also can help G. namensis to survive under the increasing infection level to a certain extent, so as to accumulate more D. spathaceum. The parasitic preference of D. spathaceum in Gymnocypris selincuoenses from Selinco Lake is a life history strategy to adapt to the environment, and its purpose is to be conducive to the spread and reproduction of the population.
MORPHOLOGY AND HEREDITARY CHARACTERISTICS OF CHINESE SOFT-SHELLED TURTLE WITH NINE PAIRS OF RIBS
WAN Gang, ZENG Jia-Wei, XIAO He-Wei, XIONG Gang, JIN Li-Zhong, WANG Xiao-Qing, HU Ya-Zhou
 Available online  , doi: 10.7541/2023.2022.0389 doi: 10.7541/2023.2022.0389
[Abstract](156) [FullText HTML] (134) [PDF 3434KB](5)
Abstract:
In this study, a survey of the germplasm resources of Chinese soft-shelled turtle (Pelodiscus sinensis) was carried out in the drainage area of Dongting Lake and Yuanjiang River in Hunan province. P. sinensis with nine pairs of ribs was found. In order to reveal its resource distribution, morphological characteristics and genetic characteristics, a comparative study of morphological markers, mitochondrial DNA, and polymorphisms of genes related to bone development was conducted in P. sinensis with nine pairs of ribs (R9) and P. sinensis with eight pairs of ribs (R8). As a result, a total of 331 R9 were obtained from 12222 cultured P. sinensis in Yuanjiang, Yiyang, Changde and Yueyang, accounting for 2.2%-3.1% of the total population. There are 11 thoracic vertebraes and nine pairs of ribs in the carapace of the R9, which is one thoracic vertebra and one pair of ribs more than the R8. Besides, the carapace width/carapace length, rear side skirt width/carapace length of the R9 were significantly smaller than those of the R8, and the body height/carapace length was significantly larger than that of the R8. Genes including CO I, Cytb, and 12S rRNA in the R9 and P. sinensis shared more than 99% homology. The phylogenetic analysis showed that the R9 and the P. sinensis clustered into one branch, there are shared haplotypes with the geographical populations of the Pelodiscus sinensis, and no population-specific markers were found. A total of 4 mutation sites were detected on the exons of RUNX2 and VRTN between R9 and R8, namely g.977380 C>T, g.6014427C>T, g.6015734A>C and g.6015864A>C. What’s more, there was a significant correlation between the g.6015864A>C mutation of VRTN gene and the number of thoracic vertebrae of P. sinensis (P<0.05). The above studies showed that R9 belongs to the P. sinensis, and its morphological structure differs from that of the R8 in which R9has one more thoracic vertebra and one pair of ribs. The mutation site g.6015864A>C of VRTN gene may be related to the polyvertebrae trait of the P. sinensis. This study has important theoretical reference value for understanding the germplasm characteristics and seed industry innovation of P. sinensis.
ISOLATION, IDENTIFICATION AND VIRULENCE GENE ANALYSIS OF PATHOGENIC AEROMONAS VERONII IN MACROBRACHIUM ROSENBERGII AND ITS HISTOPATHOLOGICAL OBSERVATION
PENG Xin, TU Hai-Hui, LUO Jin-Ping, ZHONG Zhen-Xiao, LAN Xuan, TANG Qiong-Ying, YI Shao-Kui, XIA Zheng-Long, CAI Miao-Ying, YANG Guo-Liang
 Available online  , doi: 10.7541/2023.2022.0335 doi: 10.7541/2023.2022.0335
[Abstract](263) [FullText HTML] (135) [PDF 3369KB](3)
Abstract:
To identify the causative agent causing the death of adult Macrobrachium rosenbergii occurred in a cultured farm of Gaoyou city, Jiangsu Province, a dominant strain named WSQ-1 was isolated from the hepatopantras of dying Macrobrachium rosenbergii and identified as Aeromonas veronii based on morphological observation, physiology characteristics, biochemical identification and sequencing of 16S rRNA and gyrB gene. The symptoms of M. rosenbergii artificially infected with the strain WSQ-1 were similar with those of natural infected M. rosenbergii, showing weakened vitality, decreased appetite and white muscle. The LD50 to Macrobrachium rosenbergii was 2.51×106 CFU/mL at 72h post infection. Histopathological observation showed that the pathological damage of hepatopancreas tissue was gradually aggravated with the increase of concentration or the duration of infection: the connective tissue space was enlarged and a small amount of inflammatory cells were accumulated in the early stage or low concentration, and then the lumen of hepatic tubule was deformed, hepatocytes were vacuolized, and some tissues were necrotic. In the late stage or high concentration, large area necrosis of hepatic tubule and connective tissue led to irreversible damage. The amplification result of virulence gene showed that the WSQ-1 carried 7 virulence genes including Acsv, AexT, Act, Aer, GcaT, Acg and OmpAI, which further indicated that the WSQ-1had high virulence. Drug susceptibility test showed that 18 kinds of drugs such as cefoperazone had the most inhibitive effects on the strain. At the same time, it showed resistance to 11 kinds of drugs such as clarithromycin, completely resistant to 4 kinds of drugs such as penicillin G, only moderately sensitive to kanamycin. The results of this study can provide some reference for the identification of the pathogen of the bacterial disease of M. rosenbergii and the prevention and control of the disease caused by A. veronii.
EFFECTS OF FLOW VELOCITY ON GROWTH AND BEHAVIOR IN BLACK ROCKFISH (SEBASTES SCHLEGELII)
WANG Jie, ZHANG Jia, ZHANG Xu, LI Hai-Xia, HU Yu, MA Zhen
 Available online  , doi: 10.7541/2023.2022.0363 doi: 10.7541/2023.2022.0363
[Abstract](273) [FullText HTML] (200) [PDF 1067KB](2)
Abstract:
In order to investigate the growth and behavior of juvenile black rockfish (Sebastes schlegelii) under different flow velocities, four treatment groups were set up. The average water flows velocity of the four treatments was maintained at 0, 0.5, 1.5, and 2.5 BL/s, expressed as C, L, M, and H, respectively. The experiment lasted for 43 days and eight behavior indicators were analyzed. The results showed the following: (1) The final body lengths in M and L were significantly higher than those in the other two treatment groups (P<0.05); the final weight, specific growth rate and weight gain rate were significantly higher in treatment M than those in treatment C and H (P<0.05); the feed conversion ratio was significantly lower in treatment L than that in treatment H (P<0.05). (2) After 30 days of the experiment, the accumulated residence time of the outer-circle area was significantly lower in both the M and H treatment groups compared with C and L treatment groups (P<0.05); the accumulated residence time in the middle-circle area was significantly higher in M and L treatment groups (P<0.05); the accumulated residence time of inner-circle area in treatment H was significantly higher than that in other treatment groups (P<0.05); the maximum accelerations of M were significantly higher than those of C and L treatment (P<0.05), after 36 days of the experiment, the average velocity of the M treatment was significantly higher than that in the other treatment groups (P<0.05). In conclusion, moderate swimming training significantly improved the growth performance of juvenile black rockfish, and the optimal flow velocity occurred at 1.5 BL/s under the present experimental conditions. Flow velocity significantly influenced the behavioral characteristics of juvenile black rockfish. Behavioral characteristics, such as regional preference and activity status, could be used to assess the respond of juvenile black rockfish to various water flow velocities.
GROWTH CHARACTERISTICS, CHANGES OF MORPHOLOGY AND BODY COMPOSITION OF HONGKONG OYSTERS DURING OFF-SITE FATTENING
TANG Bao-Gui, ZHOU Hui, ZHAO Li-Qiang, WU Xu-Min, PENG Zi-Feng, ZHONG Pei-Gui, YU Ge
 Available online  , doi: 10.7541/2023.2022.0344 doi: 10.7541/2023.2022.0344
[Abstract](206) [FullText HTML] (144) [PDF 728KB](2)
Abstract:
In order to provide the basis data for further study of carbon and nitrogen utilization in integrated culture pond ecosystem, the growth characteristics, morphology and body composition changes of Hongkong oysters during off-site fattening were study. Hongkong oysters Crassostrea hongkongensis (2-year-old) with an initial weight of 68.00 g were obtained from Maowei Sea, Qinzhou, Guangxi, and were fattened on floating rafts for 44 days in a fish-shrimp polyculture pond in Huguang Town, Zhanjiang. The oyster samples were collected during fattening regularly, and the morphological indicators, growth indicators, gross composition of soft tissue, carbon and nitrogen stable isotope values (δ13C and δ15N) of oyster samples were determined, and the correlation of these indicators were analyzed. The results showed that, after 44 days of fattening, the shell height, soft tissue quality, meat yield and fat content of 2-year-old oysters were significantly increased (P<0.05), the protein and ash contents were significantly decreased (P<0.05), while the shell length, shell width, body mass and moisture content did no showed significant difference (P>0.05). The δ15N, δ13C ​​of the soft tissue and shell δ13C values of oysters all decreased significantly (P<0.05), and the δ15N and δ13C values ​​of the soft tissue were significantly different from the initial samples after 16 days of fattening (P<0.05), which indicating that oysters could quickly utilize the abundant food sources of fattening pond, and obtained rapid grow of soft tissues During the fattening process, the meat yield of oyster was significantly positively correlated with the mass of soft body (P<0.05), extremely significantly negatively correlated with shell δ13C, δ15N, δ13C, N% and C% of soft body (P<0.01), and had a extremely significant negative correlation with shell length, shell width, shell height and body mass (P<0.01). However, there was no significant correlation between the meat yield of oyster and the shell length, shell width, shell height and body mass (P>0.05). During the fattening process, C% of oyster shell was positively significant correlated with N% and C% of soft body (P<0.05), and extremely significant positive correlated with δ15N of soft body (P<0.01); while C% of soft body tissue was extremely significant negative correlated with meat yield (P<0.01), significantly positive correlated with shell C% and δ13C of soft body (P<0.05), extremely significant positive correlated with the soft body δ15N and the soft body N% (P<0.01). These correlations indicated that monitoring changes in these indicators can better determine whether fattening oysters are adapted to the fattening environment and have access to sufficient food for rapid growth. The rapid growth of oysters during the fattening process resulted in a significant decrease in the carbon content of oysters, which must be taken into account when calculating the carbon sequestration benefits of oysters. In addition, the results of this study show that the ash content and carbon and nitrogen stable isotope characteristics of Hongkong oyster are easily affected by short-term off-site fattening, this influence must be considered when using inorganic elements and stable isotopes traceability technology for geographical origin traceability of Hongkong oyster.
PERIPHYTIC ALGAE COMMUNITY STRUCTURE AND RELATIONSHIP TO ENVIRONMENTAL FACTORS IN THE LOWER REACHES OF LHASA RIVER
TASHILHAMO, ZHANG Chi, WANG Wan-Liang
 Available online  , doi: 10.7541/2023.2022.0319 doi: 10.7541/2023.2022.0319
[Abstract](203) [FullText HTML] (148) [PDF 1356KB](6)
Abstract:
To understand the spatial and temporal dynamics of periphytic algae colony structure and its relationship with environmental factors in the lower reaches of Lhasa River in Tibet Autonomous Region, artificial matrix method was used to investigate the Periphytic algae community structure in the lower reaches of Lhasa River in February (dry season), June (normal season) and September (wet season). Results showed that 104species belonging to 53 genera and 7 phyla of periplexus were identified, 28species belonging to diatoms with dominance≥0.02, The first three dominant species were Synedra ulna, Diatom aelongatum and Fragilaria intermedia. The average annual biomass was 0.047 mg/cm2, and the highest was found in Qushui County (0.121 mg/cm2), followed by Nimajiangre Township (0.052 mg/cm2) and Lhasa City (0.04 mg/cm2), and the lowest was found in Mozhugongka County (0.015 mg/cm2). The spatial distribution of Periphytic algae biomass in the lower reaches of Lhasa River were Qushui County>Nimajiangre Township>Lhasa City>Alang Township>Zhaxue Township>Dazi County>Mozhugongka county. The temporal distribution of Periphytic algae abundance in the lower reaches of Lhasa River was as follows: normal season>wet season>dry season. The water quality assessment results showed that the water quality of the three sampling points in the upstream was slightly polluted to clean, and the water quality of the four sampling points in the downstream was slightly to moderately over polluted. The canonical correspondence analysis of periphyton community parameters and environmental parameters showed that most dominant species of periphyton were negatively correlated with water temperature, flow rate and pH, and positively correlated with total nitrogen, dissolved oxygen and electrical conductivity. The results of this survey provided the basic data for the conservation and scientific utilization of aquatic biodiversity in Lhasa River basin, Tibet Autonomous Region.
TEMPORAL VARIATION OF FISH BIODIVERSITY IN POYANG LAKE
JIANG Xiang-Long, LI Ming-Zheng, YANG Shao-Rong, LIN Peng-Cheng, CHANG Tao, WANG Chun-Ling, ZHANG Chen, GAO Xin
 Available online  , doi: 10.7541/2023.2022.0317 doi: 10.7541/2023.2022.0317
[Abstract](230) [FullText HTML] (156) [PDF 2151KB](4)
Abstract:
Biodiversity serves as an important index in reflecting the impact of environmental changes on ecological communities. It is also essential in evaluating the health and integrity of ecosystems, providing insights into management and conservation initiatives. The river-lake complex ecosystem in the middle and lower Yangtze River are one of the most threatened areas subjected to anthropogenic activities. However, there is still a lack of research on taxonomic diversity and general understanding of fish community and diversity changes in the Poyang Lake over a long time span. Based on data derived from fish resources investigation in 9 regions of the Poyang Lake area in April and July 2010, August 2018 and May 2019, we analyzed the temporal changes of species diversity, functional diversity and taxonomic diversity of fish communities in the Poyang Lake as well as the relationship between biodiversity and environmental factors. The results showed that 74 and 93species of fish were collected in 2010 and 2018-2019, respectively. There were significant differences in community structure, with Coilia brachygnathus, Pseudobrama simoni, Carassius auratus, Pelteobaggrus nitidus and Cyprinus carpio contributed the most variance. There were also significant differences in environmental factors between different years and seasons (P<0.05). Although the species diversity and functional diversity in 2018-2019 were higher than those in 2010, the variations in functional diversity and taxonomic distinctness (Λ+) were insignificant, suggesting the taxonomic range has narrowed albeit the fish species has increased in the past decade. The randomization test of the average taxonomic distinctness index (Δ+) and the variation in taxonomic distinctness (Λ+) showed that the number of sampling localities below the 95% probability confidence funnel from 2018 to 2019 increased compared with 2010, indicating that the degree of interference in the Poyang Lake area increased. The fish biodiversity in the Poyang Lake area was significantly correlated with water temperature, chlorophyll and total suspended solids concentration (P<0.05). The biodiversity of fish community was positively correlated with water temperature. However, the average taxonomic distinctness index (Δ+) and the variation in taxonomic distinctness (Λ+) were negatively correlated with the chlorophyll and total suspended solids. The results showed that the number of fish species in the Poyang Lake has increased under the periodic fishing ban of the Yangtze River, breeding and releasing project and ecological regulations. However, the small-sized fishes were still the dominant species in fish communities in the Poyang Lake during the past decade. This could be attributed to over-exploitation. Besides, anthropogenic disturbance compromised habitat heterogeneity. In particular, regions that located far from the Yangtze mainstream like the Poyang county, Xinjian county and Yugan county were more impacted by human activities. In order to protect and restore fish diversity in the Poyang Lake as well as the flood plain habitats in the middle and lower reaches of the Yangtze River, we suggest to take a series of measures in complementary to the ten-year fishing ban, such as demolition of small hydro power plants, reduction of reclamation and restoration of natural habitats.
COMPLETE MITOCHONDRIAL GENOME SEQUENCING OF LOTTIA LUCHUANA AND PHYLOGENTIC ANALYSIS OF THE FAMILY LOTTIIDAE
MIAO Jing, LI Ji-Ji, YE Ying-Ying, GUO Bao-Ying, XU Kai-Da
 Available online  , doi: 10.7541/2023.2022.0316 doi: 10.7541/2023.2022.0316
[Abstract](225) [FullText HTML] (163) [PDF 1671KB](1)
Abstract:
The family Lottiidae (Gray 1840), is one of the most primitive gastropods in existence, and the mitochondrial gene (mitogenome) have been used to analyze the phylogenetic relationship in Patellogastropoda, but the complete mitogenome of some species in Lottiidae have not been mentioned. In this study, we obtained the complete mitogenome of Lottia luchuana by next-generation sequencing technology, and analyzed the basic characteristics of its genome. It was found that it contains 38 genes, including 13 protein-coding genes (PCGs), two RNAs, 23 tRNAs, one more trnM than most Gastropoda species. The base content analysis showed that T base content was the highest at 32.34%, and C base content was the lowest at 14.99%. Gly, Phe, Ser2 and Val were the four most commonly used amino acids, UUA (Leu2), UUU (Phe), CCU (Pro) and AGA (Ser2) are the four most commonly used codons. We selected the mitogenomes of Lottiidae 13species for selection pressure analysis and found that all PCGs had a Ka/Ks ratio below 1 and were subjected to purification selection. In addition, a phylogenetic tree was constructed by combining the 13 PCGs of the mitogenomes of six subclass under Gastropoda, and it was found that Lottiidae is a monophyletic group, and has a relatively close relationship with Patellidae, but the results of this analysis are still affected by the attraction of long branches, so that the branch of Patellogastropoda is divided into two parts, but with the increase of species richness, it may gradually resist the attraction of long branches. A linear sequence comparison of the mitogenomes of all species of Patellogastropoda showed that Lottiidae showed the most extensive irregular rearrangement in Patellogastropoda, and also changed in the number of tRNAs. From the reconstructed chronological map of the divergence time of Patellogastropoda, it is concluded that the differentiation of limpet first occurred in the Jurassic period of the Mesozoic, and a large number of species diverged rapidly in the Cenozoic. These results will help people better understand the phylogenetic relationship between limpet, as well as the evolutionary relationship and evolutionary status of each subclass within the Gastropoda, provide more reference for species classification.
FIRST RECORD OF MONGOLODIAPTOMUS MEKONGENSIS IN CHINA AND ITS PHYLOGENETIC ANALYSIS
WEI Chao-Jun, XIONG Dan-Ni, WANG Yu-Lu, FENG Wei-Song, MIAO Rong-Li, GONG Ying-Chun
 Available online  , doi: 10.7541/2023.2022.0309 doi: 10.7541/2023.2022.0309
[Abstract](196) [FullText HTML] (150) [PDF 3812KB](4)
Abstract:
Diaptomidae is one of the most common seen freshwater copepod fauna, the taxonomic study of this taxon is the basic information for the theoretical study of systemic zoology. Five species of genus Mongolodiaptomus (Copepoda, Calanoida, Diaptomidae) were reported in China before. This research reported a new species of Mongolodiaptomus from Hainan Island, which is the first record of Mongolodiaptomus mekongensis Sanoamuang & Watiroyram, 2018 in China. Through scanning electronic and light microscopy, the morphological characteristics are described and illustrated in detail. In addition, 18S rDNA gene sequences were also obtained for the first time to investigate phylogenetic position of this species. Morphological characteristics of female species are described in detail as follows: posterolateral wings of fifth pedigerous segment were asymmetrical and right wing somewhat was larger than left. Left proximal part of genital somite broadly expanded and provided with laterally directed spine; Right proximal region of genital somite produced into posterolaterally directed, triangular process, tipped with variablespine, exceeded the middle of the genital somite. Morphological characteristics of male species are described in detail as follows: Right antennule transformed and geniculated, with 22segments and the antepenultimate with comb-like process; Intercoxal plate of right fifth leg produced into spine-like lobes on distal margin; The principal lateral spine on second exopodite of right fifth leg is obviously bent; The right caudal ramus has two ventral chitinous prominences, one strong spiniform process on prominence proximally and one semi-circular ridges located at the end. The molecular phylogenetic analysis showed that M. mekongensis is closed related with the genus Eudiaptomus and Neodiaptomus. This study provides detailed morphological characteristics and molecular data for M. mekongensis, laying the foundation for future research on this species and genus Mongolodiaptomus.
FOOD COMPOSITION OF RICE FIELD EELS AND PREDATION INTENSITY ON CRAYFISH
HUANG Lu-Quan, XU Ju-Chen, FAN Ze-Yu, HUANG Tao, LÜ Ya-Bing, HOU Jie, HE Xu-Gang
 Available online  , doi: 10.7541/2023.2022.0285 doi: 10.7541/2023.2022.0285
[Abstract](198) [FullText HTML] (141) [PDF 936KB](1)
Abstract:
Rice-crayfih-eel co-culture is a high benefit comprehensive culture model that integrating rice planting, crayfish and eel cultivation. However, study on the predatory relationship between eel and crayfish is lacking, which is one of the key issues related to the establishment of this model. This study explored the potential food organisms and food composition of eel in rice-crayfish fields and its predation selection for crayfish by investigating the resources of macroorganisms and benthos and analyzing the gastrointestinal contents of eel in rice crayfish fields; The results showed that the natural bait for rice field eels was abundant in the paddy field environment, a total of 16 genera of basic bait organisms were found. Crayfish was the most preferred prey for eel, followed by caridina, earthworms and aquatic oligochaetes. The percentage of crayfish in the food mass of rice field eels was highest from April to August, with a maximum of 93.90% in August, and a minimum of (76.85±20.66)% in April. When crayfish was the only food, the average daily predation of each large-size eel (≥200 g) was 1.63±0.065 g; when crayfish, caridina and earthworms were used as food, the rice field eels mainly fed on crayfish and did not feed on earthworms with the selection indices were 0.066, –0.266 and –1.000, respectively, When the live crayfish and feed (fresh surimi and crayfish artificial compound) were used as food, the rice field eels were mainly fed on feed but not on crayfish with the selection indices were –0.846 and 0.591, respectively. The results of this study provide a theoretical basis for the establishment of rice-crayfish-eel co-culture model and reasonable stocking of eel under this model.
CLONING AND IMMUNE FUNCTIONAL ANALYSIS OF THE X-TYPE LECTIN GENE (OMITLN) FROM ONYCHOSTOMA MACROLEPIS
XU Hong-Zhou, PAN Kui-Quan, HAN Xi-Pan, CAI Ying-Jie, YAN Chen-Yang, LIU Cheng-Rong, WANG Li-Xin, LIU Hai-Xia
 Available online  , doi: 10.7541/2023.2022.0395 doi: 10.7541/2023.2022.0395
[Abstract](267) [FullText HTML] (148) [PDF 2589KB](4)
Abstract:
Intelectin is a novel glycan-binding lectin in the innate immune response of fish, which can bind bacterial surface carbohydrates to agglutinate bacteria. To study the role of intelectin in the innate immunity of Onychostoma macrolepis during bacterial infection, the Onychostoma macrolepis intelectin (OmITLN) was identified in liver transcriptome database and cloned. RT-qPCR was used to analyze the expression of OmITLN in different tissues and after Aeromonas hydrophila infection. OmITLN recombinant protein was successfully obtained by prokaryotic expressio and the binding ability of OmITLN to different bacteria was detected by ELISA and fluorescent labeling. The result showed that the sequence was 960 bp in full length, containing 945 bp open reading frame and encoding 315 amino acids. Protein functional domain analysis showed that OmITLN encoded an N-terminal fibrinogen associated domain (FReD) and a C-terminal Intelectin-specific domain. The homology comparison and the phylogenetic tree showed that the OmITLN protein had a higher homology with the other Cyprinidae, such as Ctenopharyngodon idella, Hypophthalmichthys nobilis, Megalobrama amblycephala and Carassius auratus. The qRT-PCR results indicated that OmITLN was expressed in the all examined tissues including liver, muscle, spleen, gonad, intestine, brain and gill in Onychostoma macrolepis, and it was expressed at the highest level in liver and spleen. Compared with the control group, OmITLN was significantly up-regulated and then down-regulated after stimulation with Aeromonas hydrophila. In the liver, the expression of OmITLN reached its maximum at 12hours post-infection (hpi) and was gradually down-regulated over time. In spleen, OmITLN was reached the highest value at 6hpi and then gradually returned to the initial level after 24hpi. OmITLN recombinant protein was successfully obtained and authenticated by SDS-PAGE and Western Blotting. OmITLN can agglutinated all tested bacteria, including three gram-positive bacteria (Escherichia coli, Vibrio parahaemolyticus and Aeromonas hydrophila) and three gram-negative bacteria (Streptococcus agalactiae, Bacillus cereus and Staphylococcus aureus) with Ca2+. OmITLN showed the best binding activity to D-lactose, followed by xylose, D-galactose and sucrose, with the lowest expression in D-glucose, but showed no binding activity to mycose, D-fructose and D-maltose. The binding activity of OmITLN to PGN which is gram-positive bacteria recognition structure was higher than LPS which is gram-negative bacteria recognition structure. As an important pattern recognition receptor, OmITLN is involved in the immune defense of Onychostoma macrolepis against bacteria.
EFFECTS OF HYPOXIA STRESS ON THE ACTIVITY OF ANTIOXIDANT ENZYMES, NEURONAL APOPTOSIS AND EXPRESSION OF RELATED GENES OF TELENCEPHALON IN GYMNOCYPRIS PRZEWALSKII
CHEN Fu-Ju, FU Sheng-Yun, MA Min, CHANG Lan, LI Xue-Yuan
 Available online  , doi: 10.7541/2023.2021.085 doi: 10.7541/2023.2021.085
[Abstract](247) [FullText HTML] (156) [PDF 2430KB](2)
Abstract:
To explore the physiological response of Qinghai Lake naked carp (Gymnocypris przewalskii) telencephalon cells to hypoxia, the carp with body weight (97.68±0.12) g and body length (24.11±0.12) cm were challenged with hypoxia stress [dissolved oxygen content of (0.7±0.1) mg/L] and normoxia [dissolved oxygen content of (8.4±0.1) mg/L] for 24h to measure mitochondrial ultrastructure, membrane potential, antioxidant enzyme activities, telencephalon cells apoptosis, apoptotic-related genes (Caspase 3, Bax, Bcl-2) and hypoxia-induced response-related gene (Hif-2α, EGLN1). The results showed that: (1) nerve cells mitochondria swelled and their cristae dissolved during hypoxia stress, the mitochondrial membrane potential increased significantly at 8h and then significantly decreased at 24h, indicating the destroyed mitochondria of telencephalon cells with the increased hypoxia time. (2) hypoxia enhanced cell apoptosis and the expression levels of Caspase 3, Hif-2α, Bax and Bcl-2 genes in telencephalon cells, and significantly decreased the ratio of Bcl-2/Bax and the expression of EGLN1. (3) the increased content of hydrogen peroxide (H2O2) in telencephalon cells only happened at 8h. Hypoxia significantly induced the activity of superoxide dismutase (SOD), the content of malondialdehyde (MDA) and the total antioxidant capacity (T-AOC) only at 24h. Furthermore, there was no significant difference in glutathione peroxidase (GPX) between the groups. These results suggest that hypoxia stress mediates the permeability of mitochondrial membrane and the expression of Caspase 3, Bax and Bcl-2 genes via ROS production in telencephalon cells to induce telencephalon cells apoptosis, which might be balanced by increasing the activities of T-AOC and SOD and the expression levels of Hif-2α and decreasing the expression levels of EGLN1.
GENETIC DIVERSITY OF THREE CONSECUTIVE GENERATIONS OF ERIOCHEIR SINENSIS “CHANGDANG LAKE 1”
ZHUANG Zhen-Jun, TANG Mei-Jun, ZHANG Dong-Dong, CHEN Wen-Bin, LUO Ming, CHENG Yong-Xu, WU Xu-Gan, CHEN Xiao-Wu
 Available online  , doi: 10.7541/2023.2022.0261 doi: 10.7541/2023.2022.0261
[Abstract](448) [FullText HTML] (241) [PDF 902KB](3)
Abstract:
In order to explore the genetic diversity of the selective breeding population of Chinese mitten crab (Eriocheir sinensis), 20 microsatellite markers were used to analyze the genetic diversity of 3 consecutive generations of strain A and strain B of“Changdang Lake 1” Chinese mitten crab. The results are presented in the following, a total of 551 alleles were detected from 20 microsatellite markers for 6 populations. The average number of alleles (Na) were 27.55, the average number of effective alleles (Ne) was 13.61, the average observed heterozygosity (Ho) was 0.72, the average expected heterozygosity (He) was 0.90, the average Shannon information index (I) was 2.73, and the average polymorphic information content (PIC) was 0.89. In the process of breeding, PIC of strain A and strain B had a downward trend, and He and Ho of each population maintained a high level. The effective population size (Ne) in G1 and G2 of strain A were 72.7 and 111.8, and the Ne in G1 and G2 of strain B were 67.7 and 115.8, maintaining a high level. The Hardy-Weinber balance test showed that 72.5% of the data deviated from Hardy-Weinber balance, indicating that the genetic structure of the breeding population was relatively unstable. The genetic distance between G0 and G1 of strain A was 0.2455, and it increased to 0.2607 between G1 and G2. The genetic distance between G0 and G1 of strain B was 0.1736, and it increased to 0.1751 between G1 and G2. The genetic differentiation coefficients (Fst) ranged from 0.0026 to 0.0125, indicating that the genetic differentiations among populations was light. The results of molecular variance analysis (AMOVA) analysis showed that only 0.87% of the variation originated from different populations of “Changdang Lake 1”, while 99.13% variation occurred among individuals within the population. In conclusion, the genetic diversity and the effective population size were maintained high in each population of “Changdang Lake 1” Chinese mitten crab, but the genetic structure was unstable, so enough breeding parents and genetic diversity should be maintained to prevent inbreeding depression in the future breeding of “Changdang Lake 1”. This study may provide practical reference for the breeding of new strain of Chinese mitten crab, and accumulate data onto the continuous breeding and promotion of “Changdang Lake 1”.
EFFECTS OF THREE EMERGENT AQUATIC PLANTS ON NITROGEN REMOVAL AND ELECTRICITY GENERATION PERFORMANCE OF CW-MFC COUPLING SYSTEM
XU Dan, HUANG Min-yi, HAN Hu-wei, OUYANG Yan-rong, GUO Ya-dan, XIAO En-rong, WU Zhen-bin
 Available online  , doi: 10.7541/2023.2022.0377 doi: 10.7541/2023.2022.0377
[Abstract](214) [FullText HTML] (227) [PDF 1210KB](0)
Abstract:
To explore the effects and mechanisms of different wetland plants on nitrogen removal and electricity generation performance of CW-MFC coupling system, three groups of CW-MFC pilot systems were constructed with Reed, Lythrum Salicaria, and Canna Indica, respectively, which were recorded as CM-R, CM-L, and CM-C. The results revealed that: ① the output voltage and power density of CW-MFC coupling system were CM-L>CM-C>CM-R; ② the NH4+-N and TN removal rates of CM-R coupling system (76.8±9.9%; 54.2±8.2%) were higher than that of CM-L system (61.2±8.0%; 43.1±6.5%), which were higher than that of CM-C system (58.9±9.5%; 42.0±9.8%), P<0.01; ③ the overall growth rate of plants was CM-R> CM-C>CM-L, and the MDA content was highest in the leaves of Lythrum Salicaria (CM-L), indicating that the degree of its damage may be higher; ④ Geobacter, as a typical electrogenesis genus, had a high abundance (4.45% to 7.64%) in all three coupling systems, and its abundance was consistent with the change trend of output voltage and power density, whereas the relative abundance of Acinetobacter and Flavobacterium in CM-R was 21.10% and 14.37%, significantly higher than that of the other two systems (CM-L: 0.33% and 0.10%; CM-C: 0.75% and 0.07%), which was the most dominant genus of denitrification bacteria in CM-R; ⑤ combined with the FACOPTAX predictions, a total of 47 functional groups including chemoheterotrophy, aerobic chemoheterotrophy, iron respiration, nitrate reduction and nitrogen respiration were detected, and the results also showed that the functional groups of the CM-R were quite different from the other two systems, among which the functional groups of chemoheterotrophy and aerobic chemoheterotrophy accounted for a relatively high proportion in CM-R. The results will help to strengthen plant understanding of the effects of electrogenesis and denitrification performance on the CW-MFC coupling system.
ESTIMATION OF POTENTIAL BAIT RESOURCES AND CARRYING CAPACITY OF JUVENILE CHINESE STURGEON (ACIPENSER SINENSIS) IN BAILONG ISLAND MARINE RANCH
LIU Huang-Xin, LENG Xiao-Qian, WANG Pu-Yuan, LUO Jiang, ZHONG Jia, LI Jun-Yi, XIONG Wei, ZHANG Li-Ning, WANG Jia-Xin, WANG Cheng-He, DU Hao
 Available online  , doi: 10.7541/2023.2022.0329 doi: 10.7541/2023.2022.0329
[Abstract](213) [FullText HTML] (174) [PDF 970KB](6)
Abstract:
Mariculture conservation is an important initiative to complement the life history of Chinese sturgeon (Acipenser sinensis) and implement land-sea relay conservation. In order to investigate the potential bait resources of Chinese sturgeon in offshore marine pastures and the ability of marine enclosures, this study conducted an annual survey of the Bailong island marine ranch off the coast of Wenzhou, Zhejiang Province, and assessed the amount of benthic and lower-middle biological resources in the marine ranch. Through the analysis of the feeding and growth status of the Chinese sturgeon and the contents of the digestive tract, the types of food that the Chinese sturgeon can eat in the marine pasture were obtained and verified, and the maximum resource carrying capacity of the Chinese sturgeon was estimated. The results showed that a total of 47species of prey organisms were collected from the Bailong island marine ranch, belonging to 5 phyla and 8 classes, including 38species of benthic animals and 9species of lower-middle organisms. According to historical literature data, all of them could be eaten by Chinese sturgeon; According to the analysis of the contents of the digestive tract, the stocked Chinese sturgeon was adapted to the marine ranch and feed on their own. It is verified that it has ingested a total of 16species of prey organisms collected from 4 phyla and 5 classes. The food composition was arranged according to the relative importance index (IRI): Crustacea (mainly shrimp and crabs)>Gastropoda>Fish>Pleurobranchia>Polychaete, and the feeding preference was arranged according to the size of the feeding selection coefficient: Crustacea>Belly Foot class>Petalbranch class>Polychaete>Fish. The annual maximum sustainable yield of potential bait resources of Chinese sturgeon in Bailong island marine ranch is about 811.389 kg, which can be used for 69 Chinese sturgeon juveniles to grow to sexual maturity. The results of this study indicate that the offshore fenced marine ranch is a potential model for marine conservation of Chinese sturgeon. In the next step, it is necessary to further study how to improve the scale and effect of marine fence conservation under the mode of artificial supplementation of natural bait, so as to provide basic data for the formation of Chinese sturgeon land-sea relay conservation.
COMPARISON OF DIGESTIVE TRACT FLORA AND ENZYME ACTIVITY OF JUVENILE SIGANUS GUTTATUS UNDER TWO FEEDING CONDITIONS
SUN Yan-Qiu, LI Qi, LIU Jian-Yi, ZHUANG Ping, YANG Jun, PENG Biao Biao, QIN Bo, ZHAO Feng, FENG Guang-Peng, HUANG Xiao-Rong
 Available online  , doi: 10.7541/2022.2021.0407 doi: 10.7541/2022.2021.0407
[Abstract](277) [FullText HTML] (184) [PDF 1153KB](1)
Abstract:
Enteromorpha prolifera is a common large-scale alga, which can make filaments grow vertically in the pond in a short time (1—2 weeks). It is a common enemy organism in filter feeding shellfish culture ponds. Once it breaks out, it will not only affect the growth of cultured varieties, but also cause biological diseases and even endanger the survival of cultured varieties, resulting in economic losses. This paper attempts to make use of the habit of Siganus guttatus feeding on Enteromorpha prolifera, and compare Enteromorpha prolifera as a natural bait with artificial feed. In order to study the structure of digestive tract flora, digestive enzyme and nonspecific immune enzyme activity of juvenile Siganus guttatus were fed with artificial feed and Enteromorpha prolifera respectively. High-throughput sequencing technology combined with biochemical analysis methods were used to systematically analyze and compare the composition and distribution of microflora in the stomach, pyloric caecum and intestine of juvenile Siganus guttatus, and to compare the influence on growth performance and digestive enzyme activity of the juvenile Siganus guttatus with the two diets. Biochemical analysis showed that although the growth performance of juvenile Siganus guttatus fed with Enteromorpha prolifera was lower than that of the artificial feed group, its amylase activity was higher than that of the artificial feed group. The juvenile Siganus guttatus had good feeding and digestive ability to Enteromorpha prolifera, which was enough to meet the growth needs of Siganus guttatus. The activities of alkaline phosphatase and superoxide dismutase in the digestive tract of Enteromorpha prolifera group were significantly higher than those in the artificial diet group, showing higher immune and antioxidant capacity. High throughput sequencing results showed that bacterial diversity shows an upward trend with the extension of the digestive tract. The dominant bacteria in the digestive tract were Proteobacteria, Firmicutes and Bacteroidetes. The composition of bacteria in the digestive tract of Siganus guttatus was greatly affected by the diet. The results can provide data support for the bait research of Siganus guttatus. At the same time, it shows that the feeding of Siganus guttatus on Enteromorpha prolifera has a good feasibility basis and significant ecological value, which is worthy of in-depth research and promotion.
SPATIO-TEMPORAL NICHE CHARACTERISTICS AND INFLUENCING FACTORS OF MAJOR NEKTON SPECIES IN MINNAN FISHING GROUND
LI Yuan-Yuan, SONG Pu-Qing, FU Shu-Sen, XIE Shi-Jun, LI Yuan, LIN Long-Shan
 Available online  , doi: 10.7541/2022.2021.0364 doi: 10.7541/2022.2021.0364
[Abstract](274) [FullText HTML] (209) [PDF 1089KB](6)
Abstract:
The spatio-temporal ecological niche characteristics and influencing factors of major nekton species was determined by the relative importance, aggregation intensity, niche width, niche overlap and redundancy analysis based on data from four voyage fixed bottom trawl surveys in October 2019 (autumn), December 2019 (winter), April 2020 (spring) and August 2021 (summer). The results of the study showed that: (1) 214species of nekton were identified in the surveyed sea area, with 18 dominant species. There is an obvious seasonal turnover of dominant species, with higher aggregation intensity of dominant species in summer and lower in spring. (2) In the temporal dimension, Metapenaeposis barbata had the largest ecotone width (0.99); The niche overlap of seven groups was equal to 1.00; In the spatial dimension, the niche width of Trachurus japonicus was the largest (2.57); The spatial niche overlap value of major nekton species exceeding 0.6 accounted for 71.3%; In the spatio-temporal dimension, Trachurus japonicus had the largest niche width (2.45) and Leiognathus ruconius Hamilton had the largest spatio-temporal niche overlap width (0.94) with Thrissa kammalensis Bleeker. (3) The redundancy analysis showed that bottom temperature and bottom salinity were the key factors affecting the spatio-temporal niche characteristics of the major nekton species in Minnan fishing ground.
METABOLOME ANALYSIS ON HEPATOPANCREAS OF PROCAMBARUS CLARKII WITH DIFFERENT STRESS RESISTANCES
LI Dong, MAO Bin, WANG Yu-Feng
 Available online  , doi: 10.7541/2023.2022.0348 doi: 10.7541/2023.2022.0348
[Abstract](278) [FullText HTML] (205) [PDF 1820KB](1)
Abstract:
Procambarus clarkii, commonly known as "crayfish" or "freshwater crayfish", is one of the most important freshwater aquaculture species in Chinese mainland. Recently, the aquaculture area and production of the crayfish in Chinese mainland have been continuously increased. However, the stress response caused by various factors, such as climate change, transportation and environmental change has led to more and more serious problems, including explosive disease and even death during culturing the crayfish, which not only decreased the crayfish product quality, but also resulted in serious damage to the crayfish breeding industry. In this study, we first treated the crayfish by transportation and temperature stresses to select the stronger stress resistant (SSR) and the weaker stress resistant (WSR) crayfishes. Then we dissected the hepatopancreas of SSR and WSR crayfishes to compare the metabolomics by Liquid Chromotography-Mass Spectrometry/Mass Spectrometry (LC-MS/MS). A total of 10292 ions were detected, from which 464 metabolites were identified to be significant different between SSR and WSR (fold change>1.2, P<0.05, and VIP>1.0). Among them, 227 metabolites were down-regulated and 237 metabolites were up-regulated in SSR relative to WSR. KEGG analysis showed that these differential metabolites were mainly enriched in amino acid metabolic pathways, including histidine metabolism, taurine and hypotaurine metabolism, lysine degradation, valine, leucine and isoleucine biosynthesis, and glutathione metabolism. They also enriched in ascorbate and aldarate metabolism, carbohydrate metabolic pathways (pentose and glucuronate interconversions), fatty acid metabolic pathways (unsaturated fatty acid biosynthesis), etc. These results indicate that there are a wide range of metabolic responses in response to transportation and temperature stress, and some metabolites related to antioxidative stress and enhancing immunity, such as γ-L-Glutamyl-L-cysteine, taurine, and oleic acid, may play an important role in the stress resistance in P. clarkii. This study can not only provide new insights for studying mechanisms of animal stress resistance, but also have important value in developing strategies to cope with the stress response and in breeding new aquaculture strains with strong stress resistance.
TRANSCRIPTOME ANALYSIS OF HYPOTHALAMUS IN MALE AND FEMALE SPOTTED SCAT (SCATOPHAGUS ARGUS) AND DIFFERENTIAL GENE EXPRESSION IN 17Β-ESTRADIOL INJECTED MALES
PAN Shu-Hui, ZHOU Tong, YUAN Jia-Hui, LUO Qiong, QIN Ruo-Tong, RU Xiao-Ying, HUANG Yang, SHI Hong-Juan, LI Guang-Li
 Available online  , doi: 10.7541/2023.2022.0286 doi: 10.7541/2023.2022.0286
[Abstract](276) [FullText HTML] (191) [PDF 1386KB](1)
Abstract:
Hypothalamus are the important endocrine organs, which play key roles in regulating body growth, reproduction and hormone activity in other endocrine glands and organs. Estrogen, an important sex steroid hormone, is mainly synthesized and secreted in the gonads. It could regulate the reproduction and growth related genes expression in hypothalamus through feedback, and then participate in the regulation of corresponding physiological activities. Spotted scat (Scatophagus argus) is a good model to investigate the sexual growth dimorphism with a faster growth in females than males. The effect of 17β-estradiol (E2) injection in vivo on genes expression in hypothalamus of XY male spotted scat and the differences in genes expression between XY males and XX females remain unclear. In order to explore gene expression difference between XY male and XX female spotted scat hypothalamus and effect of in vivo injection in XY males, transcriptome analysis of hypothalamus were carried out, including sequencing data quality control, gene function annotation, differentially expressed gene (DEGs) screening and identification and pathway enrichment analysis, then real-time quantitative PCR (qPCR) was performed to detect genes expression. A total of 275833710 clean reads were sequenced in this study, and the Q30 and GC value were more than 95% and 48%, respectively. In Ctrl-XX-H vs Ctrl-XY-H group, 91 DEGs were screened and identified successfully, including 36 up-regulated and 55 down-regulated genes. In Ctrl-XX-H vs E2 -XY-H group, 28 DEGs were screened and identified, including 11 up-regulated and 17 down-regulated genes. GO and KEGG pathway analysis showed that DEGs was significantly enriched in biological processes such as cells, single cell, membrane, membrane components, and signal pathways such as ubiquinone and other terpene quinone biosynthesis, steroid hormone biosynthesis. By transcriptome and qPCR analyses, the expression of nrip1b, prl, hspa8b, snx21, cep63, ccna1, hsp90aa1.1, slc1a5, zar1, slc25a1b and loc124068175, were significantly different between XX and XY spotted scat, while the reproductive axis genes (sbGnRH, sGnRH and cGnRH) and growth axis genes (ghrh, sst1, sst3, sst5 and sst6) expression showed no significant differences. In XY male fish, six hours after E2 injection, the expression of cdc42ep1a, cyp19a1b, greb1, kank1a, snx21, and tmem30c in hypothalamus were significantly up-regulated, while prl expression was significantly down-regulated. Above results suggest that E2 might regulate some reproduction related genes expression in hypothalamus through feedback effects, which plays the critical roles in gametogenesis and reproduction regulation.
EFFECTS OF RICE PLANTING ON NUTRIENTS AND AMMONIA-OXIDIZING ARCHAEA IN POND SEDIMENTS
YANG Zhen, PENG Liang, TAO Ling, SUN Meng, YAO Yan-Hong, LI Gu, ZHU Jian-Qiang
 Available online  , doi: 10.7541/2022.2021.0190 doi: 10.7541/2022.2021.0190
[Abstract](278) [FullText HTML] (203) [PDF 1056KB](0)
Abstract:
Scientific management and properly utilization of sediment is of significance for healthy aquaculture and resource utilization in long-term culture ponds. Rotation of pond culture and cultivation appropriately is an effective way, which can reuse the nutrients in sediments and improve the sediment environment. Nine ponds with the same basic conditions were suspended aquaculture activities and used for the experiment of rice substrate improvement. Empty pond was used as the control (CK), and two treatments were set: planting rice without field drying (T1) planting rice with field drying group (T2). The main chemical properties and abundance of ammoxidation archaea in the sediments during rice growth were determined, and the community diversity and structure difference of AOA in rice after harvest were determined. The results showed that, compared with CK, the TN, TP and OM in sediments of T1 (or T2) decreased significantly by 26.58% (31.04%), 58.84% (58.38%) and 11.17% (16.11%) respectively. Compared with T1 and T2, it was concluded that the degradation of TP and OM in sediment was accelerated by solarization. The nitrification intensity and the abundance of AOA in the sediments increased at first and then decreased. Compared with CK, the nitrification intensity of T1 and T2 was significantly increased at tillering stage and jointing stage, while the abundance of AOA was significantly increased at tillering stage. Diversity index and OUT number of AOA in sediments were increased and a large amount of new AOA populations generated by rice cultiviton. The increased species in T1 was Candidatus nitrosocosmicus cluster (3.84% of the total sequence), and which in T2 was Candidatus nitrosotenuis cluster (3.24% of the total sequence). It indicated that rice planting can effectively alleviate the nutrient enrichment in pond sediments, which can be used as a supporting measure for sustainable pond aquaculture.
IDENTIFICATION AND CHARACTERIZATION OF 2-MIB-PRODUCING CYANOBACTERIA IN FACHB
ZHANG Qi, XIA Yi-Ruo, LI Lin, LI Tian-Li, ZHENG Ling-Ling, SONG Li-Rong
 Available online  , doi: 10.7541/2023.2022.0270 doi: 10.7541/2023.2022.0270
[Abstract](279) [FullText HTML] (405) [PDF 2792KB](8)
Abstract:
Odor problems in freshwater caused by 2-methylisoborneol (2-MIB) have received much attention in China recently. The odorous 2-MIB in freshwater is known to be mainly produced by a group of filamentous cyanobacteria which cause offensive taste and odor in drinking water and fish catch. From the detection of MIB synthase gene and GC/MS analyses, 24strains of 2-MIB-producing cyanobacteria were detected in Freshwater Algae Culture Collection at the Institute of Hydrobiology (FACHB-collection), National Aquatic Biological Resource Center, the largest microalgal culture collection in China. These strains were re-identified as Planktothricoides raciborskii (Wołoszyńska) Suda & Watanabe, Aerosakkonema funiforme Thu & Watanabe, Pseudanabaena cinerea Tuji & Niiyama, Oscillatoria lutea var. contorta Baker et Bold, Microcoleus sp., Desertifilum tharense Dadheech & Krienitz and Sodalinema sp. by morphological descriptions and molecular characteristics based on the 16S rRNA gene, respectively. Most 2-MIB-producing strains of Planktothrix in FACHB-collection should be re-identified as P. raciborskii or A. funiforme. This was the first report of 2-MIB-producing filamentous cyanobacteria of Aerosakkonema, Desertifilum and Sodalinema in the world, and was also the first report of 2-MIB-producing Microcoleus in China. The phylogenetic analyses base on 16S rRNA gene indicated that 2-MIB-producing strains in FACHB-collection were placed on seven separated clades, which reflected true taxonomic relationships. The genera Planktothricoides, Aerosakkonema, Pseudanabaena, Microcoleus, Desertifilum and Sodalinema formed six monophyletic clades in 16S rDNA tree; however, O. lutea var. contorta was closely related to some strains of Oscillatoria, Phormidium and Kamptonema. The phylogenetic analyses based on mic gene indicated that 2-MIB-producing cyanobacteria strains formed five clades with high support values. 2-MIB-producing P. raciborskii and A. funiforme were clustered into Clade I in mic tree. Two 2-MIB-producing Microcoleus strains were placed on Clade Ⅱ and Ⅲ, respectively. All 2-MIB-producing Pseudanabaena strains were clustered into Clade Ⅳ. Phylogenetic topology of some 2-MIB-producing strains in mic tree were incongruent with the topology in 16S rDNA tree. Cell quota of 2-MIB produced by these strains may vary in a wide range, varying from 6—2549 fg/cell. Cell quota of 2-MIB varied considerably among species, such as P. raciborskii > A. funiforme > P. cinerea. The results provide important experimental materials and basic data on morphological, molecular, ecological and 2-MIB-producing characteristics of filamentous cyanobacteria, and contribute to understanding ecophysiological characteristics 2-MIB-producing cyanobacteria.
CORRELATION BETWEEN THE INTESTINAL MICROBIOTA OF LARVAL AND JUVENILE ACROSSOCHEILUS FASCIATUS AND BACTERIAL COMMUNITY OF CULTURE WATER
LI Shan-Shan, ZHANG Wei-Jia, GAO Yang, CHU Zhang-Jie, LI Hai-Dong
 Available online  , doi: 10.7541/2023.2022.0330 doi: 10.7541/2023.2022.0330
[Abstract](238) [FullText HTML] (226) [PDF 2122KB](7)
Abstract:
Acrossocheilus fasciatus has been main economical fish in the mountain areas of Zhejiang province because of its high economic value and increasing demand. Based on 16S rRNA high-throughput sequencing, we systematically studied the correlation between intestinal microbiota of larval and juvenile Acrossocheilus fasciatus and bacterial community of culture water within the same period. The results showed that Chao1 and Shannon indices had no significant changes in intestinal microbiota of larval and juvenile A. fasciatus (P>0.05); however, the Chao1 and Shannon indices of culture water showed a significant downward trend with the development of A. fasciatus (P<0.05). ANOSIM analysis revealed that the compositions of intestinal microbiota in the larval and juvenile A. fasciatus were significantly different from the bacterial community of culture water (P<0.05). The dominant phyla were Proteobacteria, Bacteroidetes and Firmicutes in the intestinal microbiota of larval A. fasciatus, while Proteobacteria was the dominant phylum in culture water within the same period. Fusobacteria and Proteobacteria were the dominant phyla in the intestinal microbiota of juvenile A. fasciatus, while the dominant phylum in culture water within the same period consisted of Proteobacteria, Bacteroidetes and Fusobacteria. Linear regression analysis revealed that the changes of relative abundance of Proteobacteria, Firmicutes and Fusobacteria were consistent in the A. fasciatus and culture water. At the genus level, Acetobacter was the dominant genus in the intestinal microbiota of larval A. fasciatus, while Cetobacterium was the dominant genus in juvenile A. fasciatus. Rare taxa and conditional rare taxa were the main taxa in the intestinal microbiota of A. fasciatus and bacterial community of culture water. Correlation analysis showed that no significant correlation was observed between intestinal microbiota of A. fasciatus and bacterial community of culture water (P>0.05). SourceTracker analysis verified that the proportional contributions of culture water to shaping the intestinal microbiota of the larval and juvenile A. fasciatus ranged from 0.39% to 28.67%. This study revealed the composition, structure and succession changes of the intestinal microbiota in larval and juvenile A. fasciatus and the bacterial community in culture water, which provided a reference for further study on the intestinal microbiota and healthy cultivation of A. fasciatus.
THE MEASUREMENT OF PHOTOSYNTHETIC PARAMENTERS OF SUBMERSED MACROPHYTES WITH AIMS TO EXPLORE THE PLANT DISTRIBUTION DEPTH IN LAKE ERHAI
DENG Jia-Yi, GAO Xiao-Yu, SHAN Hang, ZHANG Xiao-Lin, NI Le-Yi, CAO Te
 Available online  , doi: 10.7541/2023.2022.0210 doi: 10.7541/2023.2022.0210
[Abstract](274) [FullText HTML] (256) [PDF 2038KB](1)
Abstract:
Photosynthesis is vital physiological process producing carbohydrate for the growth and distribution of submersed macrophytes, and thus may closely relate to the plant distribution depth. To clarify the differences of photosynthetic parameters and their relevance to the colonization depths of submersed macrophytes, in this study, we measured the light compensation and saturation points, photosynthetic rate and dark respiration of 15submerged macrophytes, using a liquid-phase oxygen electrode, and investigated the plants distribution depth in Erhai Lake, China. The results showed that the photosynthetic rate ranged from 2.8 to 18.1 μmol O2/(g DW·h), the dark respiration rate ranged from 0.3 to 2.0μmol O2/(g DW·h), the light compensation point ranged from 6.3 to18.1 μE/(m2·s), the light saturation point ranged from 55.6 to 441.5 μE/(m2·s). The plants had significant differences in the photosynthetic parameters. Based on a field survey of the plant distribution depth, the light compensation and saturation points of the submerged macrophytes were negatively correlated with their distribution depths. V. natans had the lowest light compensation and saturation points, and were more suitable to grow in deeper water where the experienced low light stress, and thus V. natans could be taken as a pioneer species for the restoration of submerged macrophytes in eutrophic lakes.
EFFECTS OF NUTRITIONAL STATUS AND AEROBIC SCOPE ON GROUP BEHAVIOUR OF JUVENILE GOLDFISH (CARASSIUS AURATUS)
LING Hong, WANG Chun-Hua, FU Shi-Jian, ZENG Ling-Qing
 Available online  , doi: 10.7541/2023.2022.0339 doi: 10.7541/2023.2022.0339
[Abstract](285) [FullText HTML] (322) [PDF 1454KB](4)
Abstract:
In order to investigate the effects of nutritional status and metabolic range on group behavior of fish, juvenile crucian carp (Carassius auratus) was conducted as the animal model, and its feeding metabolism (specific dynamics, SDA) and metabolic rates (Standard Metabolic Rate, SMR; Maximum Metabolic Rate, MMR) was determined to calculate metabolic scope (AS=MMR–SMR) at (25.4±0.2)℃. Based on the combination of nutritional state and AS, five ‘nutritional state plus AS’ treatments were determined for their individual spatial position within a group, feeding intake, individual characteristics (e.g., individual swimming speed and acceleration), and group characteristics (e.g., synchronization of speed, inter-individual distance, nearest neighbour distance, and group polarization). Our results showed that nutritional status, starvation, aerobic scope, feeding and digestion had no effect on individual spatial position within a group. Starvation and digestion did not affect the group cohesiveness of juvenile crucian carp, but starvation reduced the group coordination of this species only during digestion, i.e., difference in individual food acquisition ability led to a different digestion strategy among group-mates, resulting in a lower synchronization of speed and eventually a decrease in group coordination. In the control group, the space in the front of the group confers the ecological advantage of individuals to obtain more food items, but starvation eliminated this ecological advantage in the front of the group. The feeding intake and feeding level of the control group were negatively correlated with the predicted remaining AS, and which of the starvation group were not correlated with the predicted remaining AS. Our results suggested that both the nutritional status and aerobic scope had no effect on the individual spatial position within schooling in gold fish. Occupying the spatial position at the front of the school can confer to the ecological benefits (e.g., more food resources), but starvation eliminates the heterogeneity of ecological benefits of individual spatial position distribution within the school. Starvation and digestion have no effect on group cohesion of the goldfish, but the phenomenon that starvation reduces the group coordination only appeared during the digestion stage. Individual difference in ability to obtain food within the group may lead to different digestive strategies among group-mates, resulting in more disordered swimming align of individuals, and finally leads to the decline of group coordination.
MOLECULAR CLONING, EXPRESSION ANALYSIS AND POLYCLONAL ANTIBODY PREPARATION OF ANTI-MüLLERIAN HORMONE (AMH) GENE IN LARGEMOUTH BASS MICROPTERUS SALMOIDES
LI Bing-Bu, CAO Zhe-Ming, TAO Yi-Fan, XU Gang-Chun, XU Ai-Guo, LI Ming-Xiao, ZHANG Hong-Ying, CHEN Shi-Yang, QIANG Jun, XU Pao
 Available online  , doi: 10.7541/2022.2021.0343 doi: 10.7541/2022.2021.0343
[Abstract](330) [FullText HTML] (311) [PDF 6489KB](6)
Abstract:
In order to study the characteristics of amh gene in largemouth bass Micropterus salmonids and its potential role during gonadal development, the cDNA full-length sequence of the amh gene was cloned by RACE technology, and the Amh polyclonal antibody was prepared. Quantitative real-time PCR (qRT-PCR) and Western blot technology was used to analyze the expression pattern of amh in different tissues and different developmental stages. Finally, HE staining and Immunohistochemistry were used to observe the morphological and histological changes of gonads at different developmental stages and their potential relationship with Amh expression. The results showed that the cDNA full-length sequence of the amh gene in largemouth bass was 2050 bp in length, including 24 bp at the 5′-UTR, 394 bp at the 3′-UTR, and a 1632 bp open reading frame (ORF) encoding 543 amino acids. The amh mRNA was found expressed in eleven tissues. The expression level in testis was the highest for male fish, then followed by muscle, and the expression level in ovary was the highest for female fish, followed by muscle. There were significant differences in the expression of amh gene in gonads of male and female fish at different developmental stages, and the expression in testis was significantly higher than that in ovary (P<0.05). Western blot showed that Amh protein was highly expressed in testis. The expression in testis increased first and then decreased, and reached the highest after hatching 65 days (P<0.05). Immunohistochemical results showed that Amh was expressed in Sertoli cells of early testis; the expression in male testis decreased significantly at 135 and 215 days after hatching. HE staining showed that the testis of male fish was in the stage of spermatogenesis and sperm deformation, Amh was mainly expressed in Sertoli cells. Sperm occupied most of the space of testis, and the proportion of Sertoli cells decreased. The expression was low in female ovaries at 45, 65 and 135 days after hatching, and increased at 215 days after hatching, and Amh positive signals were detected in the edge of oocyte membrane and peripheral follicular cells and granulosa cells. The results showed that Amh gene may be involved in the early testicular development in testis; in the ovary, it may participate in the development of granulosa cells and follicular cells. In conclusion, Amh played a key regulatory role in gonadal development of Micropterus salmoides.
IMPACT OF TYPHOON LEKIMA ON PLANKTON COMMUNITY IN SHELLFISH MARICULTURE POND
WEI Jun-Cheng, ZHANG Xiang, CAI Yi-Long, CAI Jing-Bo, XIAO Guo-Qiang
 Available online  , doi: 10.7541/2023.2022.0257 doi: 10.7541/2023.2022.0257
[Abstract](844) [FullText HTML] (287) [PDF 1815KB](4)
Abstract:
In order to reveal the changes of plankton community structure during shellfish culture in seawater ponds before and after typhoon, 16S and 18S rRNA genes in the genomic DNA of aquaculture water environment were analyzed by high-throughput sequencing and bioinformatics. The results showed that the number of OTU in prokaryotes (28728) was significantly higher than that in eukaryotes (8498), and the dominant groups of prokaryotes were Proteobacteria, Cyanobacteria, Bacteroidetes, Actinobacteria and Chlorobi; The dominant groups of eukaryotes are ciliates, flagellates, protozoa, cup whipworms, cryptoalgae, Phaeoflagellates, diatoms, etc., among which the diatom abundance increased significantly after typhoon (P<0.05). After the typhoon, the biodiversity of eukaryotes did not change significantly, meanwhile the Shannon index and Simpson index of prokaryotes showed significant differences (P<0.05), which decreased in 5 days and then increased with time, while the OTU number and Chao I index did not change significantly. The PCoA showed that the community structure of prokaryotic and eukaryotic organisms changed markedly after typhoon. ANOSIM showed that prokaryotic microbial communities were significantly different at each time point (P<0.05), while eukaryotic microbial communities significantly in 10 days (P<0.05). Water temperature had a significant impact on prokaryotic community structure (P<0.05), while eukaryotic community was influenced by chemical oxygen demand and phosphat (P<0.05). The study suggested that after the typhoon disturbance, plankton communities markedly changed, prokaryotes was more sensitive than the eukaryotes. The diversity level of bacterial community decreased significantly at first, then returned to the level before typhoon, showing stronger sensitivity than that of eukaryote, and both of them failed to return to the community composition before typhoon. Therefore, the key measures to deal with the impact of typhoon in shellfish culture in seawater ponds should be mainly to prevent cultured organisms from causing stress to the drastic environmental changes, and to supply probiotics for environmental regulation appropriately, so as to make up for the loss of ecological functions possibly caused by the change of bacteria phase caused by typhoon.
CHARACTERISTICS OF ALGAL SOURCE FOULANTS ON MEMBRANE FOULING DURING THE TREATMENT OF ALGAL-RICH WATER USING MICROFILTRATION
ZHANG Shi, SUN Ling-Kai, MA Fang-Kai, XU Wang-Peng, GAO Zhao-Bo, ZHANG Zhong-Yi, LI Ying-Xi, WU Zhen-Bin, ZHANG Xue-Zhi
 Available online  , doi: 10.7541/2023.2022.0264 doi: 10.7541/2023.2022.0264
[Abstract](242) [FullText HTML] (286) [PDF 1463KB](4)
Abstract:
The characteristics of algal source foulants could affect the membrane fouling during the treatment of algae-rich water by microfiltration. Filtration experiments were carried out with algal cells, algogenic organic matter (AOM) and algae suspension at different growth phases to study the influence of algal source foulants characteristics on membrane fouling and its mechanisms. The UMFI method was used to analyze the fouling degree of algae cells, AOM and algae suspension at different growth stages. In particular, the changes in their fouling contribution ratios at different growth phase were further elucidated based on the criteria importance through intercriteria correlation. Meanwhile, the mixed fouling blocking model was used to analyze the main fouling blocking types at different filtration stages of algae suspension at different growth stages. The results showed that the membrane fouling caused by algae cells and AOM in the exponential phase was the lowest compared with the other two growth phases. Notably, the contribution of AOM and algae cells to membrane fouling varied with the growth phase during the treatment of algae-rich water by microfiltration. The objective weight of fouling caused by AOM decreased with the prolongation of growth phase, and the declining phase reduced to 10.2%. Meanwhile, the objective weight of algae cells increased with the prolongation of growth phase, and the exponential phase was only 28.3%. In the filtration process of algae suspension at different growth phase, there were all two stages of fouling mechanisms, and the latter stage was cake formation. These results not only elucidated how the changes in the characteristics of the algae suspension affected characteristics on the membrane fouling and disclosed its mechanism during the microfiltration treatment of algae-rich laden water by microfiltration, but also provided theoretical research guidance for the development of membrane anti-fouling improvement technologies.
THE DYNAMICS OF BACTERIOPLANKTON COMMUNITIES ASSOCIATED WITH MACROBRACHIUM ROSENBERGII ACROSS WHOLE LARVAL DEVELOPMENT: SUCCESSIONAL PROCESSES, ENVIRONMENTAL DRIVERS, AND DEVELOPMENTAL BIOMARKERS
 Available online  , doi: 10.7541/2023.2022.0220 doi: 10.7541/2023.2022.0220
[Abstract](252) [FullText HTML] (302) [PDF 2176KB](8)
Abstract:
A suitable micro-ecological condition is of great significance to the Macrobrachium rosenbergii larval development and health. However, the fine-scale temporal dynamics and assembly mechanisms of bacterioplankton of prawn larval nursery are unexplored. We investigated dynamic succession, environmental drivers, biomarkers and co-occurrence networks of bacterial communities across whole developmental cycle in 3 commercial prawn nurseries, using a high-frequency sampling strategy and bacterial 16S rRNA amplicon sequencing. The bacterial α-diversity showed a U-shaped pattern across the developmental cycle. The bacterial community’s similarity followed a time-decay pattern, with community turnover rate of 0.011. Bacteroidetes, Actinobacteria, Alphaproteobacteria, and Gammaproteobacteria were the dominant phyla, and their relative abundance varied dramatically with prawn larval development. For example, the relative abundance of actinobacterial Microbacteriaceae and Cryomorphaceae (Bacteroidetes) significantly increased with prawn larval development (P < 0.05), while that of two members of phyla Bacteroidetes, Flavobacteriaceae and Crocinitomicaceae decreased. pH is the most important environmental driver for the variations of bacterial diversity and composition. By using random forest analysis, we identified 12 biomarker taxa associated with prawn larval development. Specifically, Burkholderiaceae and Cyclobacteriaceae as the indicative taxa were detected in early (1—2d) and median stage (8—10d), respectively. While Saprospiraceae and Mycobacteriaceae accumulated in mid-late stages (16—21d). Bacterial co-occurrence patterns (mostly positive correlations) weakened and negative interactions accumulated with larval development. These findings reveal notable succession patterns and community assembly dynamics of bacterioplankton across whole prawn larval development, and will provide novel insights into microbiome management practices and prevent disease in prawn nursery.
GENETIC DIFFERENCES OF TWO DIFFERENT SOMATOTYPES SINILABEO DECORUS TUNGTING (NICHOLS) BASED ON CYTB AND ITS1 GENE
FU Wen, CHU Xian-Bin, LIU Wen-Bin, PENG Liang-Yue, LIANG Zhi-Qiang, LI Chuan-Wu, XIAO Ya-Mei
 Available online  , doi: 10.7541/2022.2021.0382 doi: 10.7541/2022.2021.0382
[Abstract](354) [FullText HTML] (240) [PDF 1686KB](2)
Abstract:
Sinilabeo decorus tungting (Nichols) is a wild endemic fish in Hunan Province. However, due to overfishing and environmental damage, the germplasm resources of wild S. decorus tungting are scarce. In order to effectively protect germplasm resources of S. decorus tungting, artificial breeding research has been carried out. In the process of domestication and parental cultivation, it was found that there were two somatotypes in the wild population: the high-back type and the flatback type. The countable traits analysis showed that there was no significant difference between the two different somatotypes S. decorus tungting on fin formula and scales. To explore the genetic differences between the two somatotypes of S. decorus tungting, Cytb and ITS1 gene sequences were used as molecular markers to analyze the genetic differences. The results showed that based on the Cytb and ITS1 gene sequences, both the high-back type and the flatback type were showed a bias in base composition. And two somatotypes of S. decorus tungting were showed high haplotype diversity and low nucleotide diversity. In addition, the results of genetic distance analysis and NJ tree construction showed that the degree of genetic differentiation of the two somatotypes was low, which did not reach the level of population differentiation. In conclusion, the high-back type and flatback type belongs to the same population. The results of this study enriched the molecular biological data of S. decorus tungting, and provided theoretical basis for the protection and industrial development of S. decorus tungting germplasm resources. The reasons for the formation of the high back type of S. decorus Tungting was unknown and needs further study.
CONNECTIVITY LOSS IN LAKE ON FISH COMMUNITIES ——A CASE STUDY OF BAO’AN LAKE
QU Xiao, GAO Wen-Qi, LU Ying, LIU Han, XIONG Fang-Yuan, CHEN Yu-Shun
 Available online  , doi: 10.7541/2023.2022.0117 doi: 10.7541/2023.2022.0117
[Abstract](374) [FullText HTML] (266) [PDF 2243KB](6)
Abstract:
Hydrological connection plays an important role in maintaining biodiversity and ecosystem function. In order to explain the effect of internal hydrological disconnection and response of fish communities, we selected a typical hydrological disconnection lake in middle reaches of Yangtze River—Bao’an Lake as the study object. Field sampling was conducted in Xiaosihai Lake (part of Bao’an Lake, complete disconnection), Biandantang Lake (part of Bao’an Lake, semi- disconnection), Qiaodun Lake (part of Bao’an Lake, semi- disconnection) and the main lake in both summer and autumn from 2019 to 2020. We compared and analyzed the differences of fish communities and functional diversity among those lakes using the multiple statistical methods. Result showed that the fish community structure in the complete disconnection lake had been changed significantly, which species number (15±3) was significantly lower than that in the semi- disconnection lake (22±3) and the main lake (23±3, P<0.05); abundance increased while the biomass decreased; the species richness index, the Shannon index and the Simpson index were significantly lower; and functional richness index, functional dispersion index and functional evenness index were also significantly lower the other lakes (P<0.05). However, the fish community structure in the semi-disconnection lake had no significant difference with that in the main lake. The Permutational multivariate analysis of variance and non-metric multidimensional scaling analysis also showed that the fish community in the complete disconnection lake significantly distinguished from the semi-disconnection lakes and the main lake (P<0.05)., while there was no significant difference between the fish communities of semi-disconnection lakes and main lake was closer. Our study found that the internal hydrological disconnection in lake also has an important impact on the composition of fish communities, and restoring the free hydrological connectivity within lake was crucial to ecological management and biodiversity conservation.
MULTIPLEX PCR SETS OF MICROSATELLITES AND THEIR APPLICATION IN GENETIC ANALYSES FOR THREE POPULATIONS OF LARGEMOUTH BASS (MICROPTERUS SALMOIDES)
FU Jian-Jun, GONG Ya-Ting, ZHU Wen-Bin, QIANG Jun, ZHANG Lin-Bing, WANG Lan-Mei, LUO Ming-Kun, DONG Zai-Jie
 Available online  , doi: 10.7541/2023.2022.0296 doi: 10.7541/2023.2022.0296
[Abstract](258) [FullText HTML] (245) [PDF 1068KB](4)
Abstract:
Largemouth bass (Micropterus salmoides) has been introduced approximately for forty years, and it becomes an economically important cultured fish in China. However, given that it is an exotic species, there is a lack of natural population supply in breeding, and there is a risk of genetic degradation in the utilization progress. The imbalance between large industrial demand and shortage of improved varieties of M. salmoides are arisen in China. Genetic evolution is the baseline for genetic improvement and selection breeding programs. The microsatellites with multiplex PCR method that is popularity applied for genetic analyses in fish species. In this study, we developed six multiplex PCR panels based on 18 polymorphic microsatellites, and subsequently used in genetic analyses for three populations of M. salmoides, i.e., original population of American (USA), “Youlu No. 1” variety (YLO), and their hybrid population (HYB). The results showed that, the parameters of number of alleles (Na), effective number of alleles (Ne), observed heterozygosity (Ho), expected heterozygosity (He) and polymorphism information content (PIC) for 18 loci were ranged from 3 to 14, 1.622 to 5.841, 0.333 to 0.806, and 0.361 to 0.810, and mean with 7.722, 3.056, 0.577, and 0.579, respectively. Excluding two loci deviated from Hardy-Weinberg equilibrium, the lowest values of all diversity parameters were observed in YLO, while the highest Ho was detected in HYB (0.743), and the highest values of other diversity parameters were detected in USA. The farthest Nei’s genetic distance was evaluated between USA and YLO (0.362); meanwhile, similar Nei’s genetic distances were evaluated between HYB with other two populations (i.e., 0.112 and 0.179 for USA and YLO, respectively). Extremely significant genetic differentiations were revealed among all pairwise populations (P<0.01), and the highest fixation index was detected between USA and YLO (FST=0.209). According to the genetic structure analysis based on the allele frequency, relatively independent genetic structures were presented within USA and YLO, while admixture in genetic structure was generally showed in HYB. Additionally, the distinct distributions of individuals from three populations were visualized by using scatter plots of discriminant analysis of principal component (DAPC), and HYB showed with interval distribution between USA and YLO. In brief, six multiplex PCR panels of 18 microsatellites were developed firstly in M. salmoides, relatively high polymorphisms were detected among these loci, and the effective application in genetic analyses was evaluated in this study. That provided valuable tools for genetic and breeding researches in M. salmoides.
FAT DEPOSITION, ANTIOXIDANT CAPACITY, DIGESTIVE ENZYMES AND GUT MICROBIOME ASSOCIATED WITH DIETS CONTAINING SIBERIAN GINSENG IN GENETICALLY IMPROVED FARMED TILAPIA (GIFT, OREOCHROMIS NILOTICUS)
LI Quan-Jie, ZHU Hao-Jun, QIANG Jun, NIE Zhi-Juan, GAO Jian-Cao, SUN Yi, XU Gang-Chun
 Available online  , doi: 10.7541/2023.2022.0281 doi: 10.7541/2023.2022.0281
[Abstract](315) [FullText HTML] (233) [PDF 1462KB](8)
Abstract:
In recent years, the intensive breeding mode has developed rapidly, however, various problems emerge with intensive fish culture methods, especially crowding stress and increased susceptibility to disease, which will ultimately influence the growth performance, welfare, and profitability of the farmed fish. Intestinal microbes play an important role in maintaining the balance of intestinal environment and host health. We are genuinely concerned about the health of fish (via their intestinal flora) under high density culture. Therefore, the present study aimed to describe compositional and functional differences of the gut microbiome of Genetically improved farmed tilapia (GIFT, Oreochromis niloticus) reared under Acanthopanax senticosus ultrafine powder, by investigating their responses to 8 weeks culture experiment. The results showed as follows: 1) adding 4‰ A. senticosus superfine powder to the diet could significantly increase the activities of intestinal amylase, lipase and trypsin, improve the growth and development of tilapia and improve the feed conversion rate. 2) adding 4‰ A. senticosus superfine powder to the diet could significantly reduce the levels of triglyceride and total cholesterol in the liver, and reduce the content of malondialdehyde and increase the activity of superoxide dismutase in the liver. 3) adding 4‰ A. senticosus superfine powder to the diet could significantly affect the composition of intestinal microorganisms and improve the alpha diversity of intestinal microorganisms. Some diversity indexes are significantly positively correlated with amylase, lipase and superoxide dismutase, and negatively correlated with triglyceride and total cholesterol. 4) Proteobacteria, Fusobacteria and Firmicutes were the dominant phyla in the intestinal tract of GIFT. The core difference genera screened were Enterovibrio, Cetobacterium and Grimontia, which were significantly enriched in the control group. In addition, Lawsonia, Acinetobacter, Pseudomonas and Brevinema were significantly enriched in 4‰ A. senticosus adding group, indicating that there may be a certain abundance of potential pathogenic bacteria in fish during the growth cycle. Functional prediction analysis with PICRUSt2 revealed that the bacterial community was active in metabolism at hierarchy level 1. The relative abundance of human diseases in the control group was significantly higher than that in 4‰ A. senticosus adding group. Further, the abundance of functional genes was similar at hierarchy level 2, implying abundant functional diversity. In conclusion, adding 4‰ A. senticosus superfine powder to the feed could affect intestinal enzyme activity, liver biochemical indices and intestinal microflora composition and function of GIFT, and promote the healthy growth of fish.
EFFECTS OF MICROCYSTIS ON THE GROWTH AND THE SYNTHESIS AND RELEASE OF GEOSMIN IN APHANIZOMENON GRACILE
LI Xiao-Yu, ZHOU Wei-Cheng, WEI Hui, HUANG Shun, LI Dun-Hai
 Available online  , doi: 10.7541/2022.2021.0377 doi: 10.7541/2022.2021.0377
[Abstract](310) [FullText HTML] (303) [PDF 1298KB](1)
Abstract:
Aphanizomenon and Microcystis are common dominant genera of bloom-forming cyanobacteria, and they have seasonal succession in some lakes. Aphanizomenon gracile is the most common Aphanizomenon species in Chinese freshwater bodies which can produce odor substance geosmin. The effects of the interspecific interaction between Microcystis and Aphanizomenon on the cell growth and the synthesis and release of geosmin is not clear. In this paper, two Microcystis species with different characteristics, toxic Microcystis aeruginosa and non-toxic Microcystis wesenbergii, were respectively co-cultured with geosmin producing Aphanizomenon gracile at different initial inoculation ratios (1﹕2, 1﹕1 and 2﹕1) to explore the effects of interspecific interaction on algae growth and geosmin synthesis and release. The results showed that both Microcystis inhibited the growth of Aphanizomenon, but the latter promoted the growth of the formers. Microcystis wesenbergii promoted the release of geosmin (when the initial inoculation ratio was 1﹕1, the extracellular geosmin reached 269.43 fg/cell), and promoted the synthesis of geosmin only in early and late growth stages; Microcystis aeruginosa promoted the synthesis of geosmin in the early stage of co-culture, but co-culture inhibited the release of geosmin, and geosmin was not detected in the middle and late stage of co-culture. Our research results showed that during the seasonal succession of Aphanizomenon and Microcystis in natural water bodies, Microcystis has an advantage in the competition with Aphanizomenon, and the competitive pressure of Microcystis on Aphanizomenon urges it to synthesize odor substances. As the Aphanizomenon decays, it may be accompanied by the release of a large amount of odor substances, which increases the risk of odor events.
RAPID VISUAL DETECTION OF KHV BY RECOMBINASE POLYMERASE AMPLIFICATION (RPA) COMBINED WITH A LATERAL FLOW DIPSTICK (LFD)
CHU Xin, FENG Zi-Zhao, JIANG You-Sheng, WANG Hao, LU Li-Qun, XU Dan
 Available online  , doi: 10.7541/2023.2022.0226 doi: 10.7541/2023.2022.0226
[Abstract](291) [FullText HTML] (316) [PDF 1296KB](3)
Abstract:
Cyprinus carpio and Cyprinus carpio kio are important aquaculture varieties in China. Highly pathogenic and infectious of Cyprinid herpesvirus 3 (CyHV-3, KHV) has caused great losses in the culture of Cyprinus carpio and Cyprinus carpio kio. Therefore, the rapid and convenient detection technology is desperately needed to be used for non-laboratory and fast detection. Recombinase polymerase amplification (RPA) is such an Isothermal amplification technology which can amplify DNA within 30 minutes under low reaction temperature. Then we combined RPA with lateral flow dipstick (LFD) and established a rapid and sensitive method which are suitable for field clinical detection of KHV. In this study, primers and probe sequences were designed according to the conserved fragment of SphI-5 gene of KHV. The experimental results show that the RPA technique can detect target fragment by agarose gel electrophoresis within 30 minutes at the optimal temperature of 38℃ and the RPA results can be visualized in only 5 minutes in combination with the LFD and the entire RPA-LFD assay takes 50 minutes which are a lot faster than PCR method.. The method established in this experiment for the detection of KHV by RPA-LFD is so simple and sensitivity that can be useful for rapid diagnosis in aquaculture with limited resources.
APPLICATION OF ENVIRONMENTAL DNA TECHNOLOGY IN FISH DIVERSITY ANALYSIS IN THE YANGTZE RIVER ESTUARY
WANG Ru-Xian, YANG Gang, GENG Zhi, ZHAO Feng, FENG Xue-Song, AND ZHANG Tao
 Available online  , doi: 10.7541/2023.2022.0272 doi: 10.7541/2023.2022.0272
[Abstract](296) [FullText HTML] (327) [PDF 1310KB](14)
Abstract:
Environmental DNA (eDNA) is a booming biological monitoring technology. It has been proved by many studies to be an effective tool for the detection, monitoring and indication of fish species and its biodiversity and abundance. This study applies high-throughput sequencing technology to analyze the eDNA samples of the waters of the Yangtze Estuary and compares the results with the traditional fishery studies. It aims to elaborate the diverse characteristics of the fish communities in the Yangtze Estuary and to explore the prospects of applying eDNA technology to the diversity study of the fish species in the Yangtze Estuary. The study results show that the eDNA detects 45 fish species, which can be classified to 41 genera, 21 families and 10 orders, and there is no significant difference of the abundances of the species, but their diversity characters vary considerably, while the bottom trawl method detects 33 fish species, which can be classified to 29 genera, 16 families and 11 orders. 18species, accounting for 30% of the total fish species, can be detected in both monitoring methods. Among those 18species, the number of Perciformes is the most, followed by Cypriniforms. The results of both monitoring methods show Coilia nasus and Coilia Mystus are the dominant species in the Yangtze Estuary. When comparing the two monitoring methods by Alpha diversity, both Simpson and Shannon indexes show the Alpha diversity of the fish communities in the Yangtze River Estuary detected by eDNA method is significantly greater than of bottom trawl. The study shows that it is feasible to apply eDNA technology in monitoring fishery resources in the Yangtze River Estuary, while during the fishing moratorium different methods can be used to monitor fishery resources based on the actual situation.
EFFECTS OF FASTING ON SWIMMING PERFORMANCE, THERMAL TOLERANCE AND SPONTANEOUS ACTIVITY JUVENILE MYXOCYPRINUS ASIATICUS
HUANG Ti-Ji, LI-XIU-MING, FAN Mei-Xia, FU Shi-Jian
 Available online  , doi: 10.7541/2023.2022.0307 doi: 10.7541/2023.2022.0307
[Abstract](305) [FullText HTML] (276) [PDF 1097KB](7)
Abstract:
To investigate the effects of fasting for 1—2 weeks on swimming performance, thermal tolerance and spontaneous activity juvenile Chinese sucker (Myxocyprinus asiaticus), the body mass and body length of 108 fish with (3.26±0.64) g and (5.32±0.32) cm were randomly divided into 3 groups, i.e., control group, 1 week fasting group and 2 week fasting group. Then, relevant parameters of swimming ability, thermal tolerance and spontaneous activity of these fishes were measured after different fasting times. Fasting for 1—2 weeks has no effects on the rest metabolic rate and critical swimming speed of M. asiaticus. Maximum metabolic rate, metabolic scope, cost of transport, head height/head length and body height/body length significantly increased in 1 week and 2 weeks fasting groups compared to that in control group (P<0.05). Fasting for 1—2 weeks has no effects on the critical thermal minimum and lethal thermal minimum of M. asiaticus. Critical thermal maximum and lethal thermal maximum significantly increased in 1 week and 2 weeks fasting groups compared to that in control group (P<0.05). Fasting for 1—2 weeks has no effects on the total movement distance, average movement speed and percent time spent moving of M. asiaticus. Our results suggested that aerobic swimming capacity and spontaneous activity of M. asiaticus was not affected by fasting for 1—2 weeks, which may be beneficial for maintaining their daily foraging activities. Moreover, fasting for 1—2 weeks has no significant impact on the low-temperature tolerance, but this stress can improve the high-temperature tolerance of M. asiaticus.
CHARACTERIZATION AND FUNCTIONAL IDENTIFICATION OF A PHOSPHOLIPASE A2 GENE FROM THE ARACHIDONIC ACID-RICH GREEN MICROALGA MYRMECIA INCISA REISIGL
LI Si-Qi, BI Yan-Hui, ZHOU Zhi-Gang
 Available online  , doi: 10.7541/2023.2022.0263 doi: 10.7541/2023.2022.0263
[Abstract](254) [FullText HTML] (266) [PDF 1384KB](4)
Abstract:
Myrmecia incisa is a kind of green alga, which was rich in arachidonic acid (AA). On the basis of the available reports, it was speculated that phospholipase A2 (PLA2) might play an important role in the lipid synthesis of M. incisa. In order to identify the function of PLA2, the full- length cDNA sequence of PLA2 gene (MiPLA2) of this alga was cloned by RACE technology. The full- length cDNA sequence of MiPLA2 was 1082 bp in length, and consisted of a 5′-untranslated region (UTR) of 180 bp, a 3′-UTR of 464 bp, and an open reading frame (ORF) of 438 bp, which encoded a protein of 145 amino acids. And the full-length DNA sequence of MiPLA2 gene was 1594 bp, which contained 3 introns and 4 exons. Multi-sequence alignments of the secreted PLA2 (sPLA2) proteins from several different species of plants showed that MiPLA2harbored a conserved Ca2+ binding motif and a catalytically active domain. Phylogenetic analysis illustrated that MiPLA2 belongs to the plant sPLA2-XIA family. Then, the pET32a-Mipla2 prokaryotic expression vector was constructed. After induction and purification, a recombinant MiPLA2 protein with a molecular weight size of 31.36 kD was obtained. Thin-layer chromatography (TLC) analysis of the in vitro enzymatic reaction products showed that the recombinant MiPLA2 could catalyze the hydrolysis of phosphatidylcholine (PC) into hemolytic phosphatidylcholine (LPC). The results might help to reveal the pathway and mechanism of ArA being preferentially used for triacylglycerol (TAG) synthesis, and lay a foundation for improving the oil production in this alga by the genetic modification of pla2 gene.
DIFFERENCES IN ENVIRONMENTAL DNA MONITORING OF FRESHWATER MUSSELS FROM DIFFERENT ENVIRONMENTAL SAMPLE TYPES
LEI Yao, ZHOU Chun-Hua, OUYANG Shan, WU Xiao-Ping
 Available online  , doi: 10.7541/2023.2022.0266 doi: 10.7541/2023.2022.0266
[Abstract](352) [FullText HTML] (478) [PDF 1445KB](7)
Abstract:
In order to clarify how different environmental sample types affect the detectability of mussel species when using environmental DNA metabarcoding technology, surface water, bottom water and sediment were collected in Poyang Lake in winter and spring of 2021 for environmental DNA metabarcoding analysis, and then combined with traditional methods for collection and verification. A total of 33 species of mussels from Poyang Lake were detected by environmental DNA metabarcoding technology, while 18species were collected by traditional methods. All the species collected by traditional methods could be detected by environmental DNA metabarcoding technology. The number of mussel species annotated in surface water and bottom water was respectively higher than that in sediment, and the mussel species annotated in surface water and bottom water completely covered sediment, respectively. There was no significant seasonal difference in α diversity level of mussels based on environmental DNA metabarcoding, but significant seasonal difference in β diversity level of mussels. The mussel diversity in both surface and bottom water was significantly respectively higher than that in sediment samples. The Beta diversity analysis also showed significant differences between water samples (surface and bottom water respectively) and sediment samples. But there were no significant differences in the diversity and community structure between surface and bottom water. Water depth (WD), depth of Secchi disk (SD), water temperature (WT) and total nitrogen (TN) significantly affected the community structure of mussels in Poyang Lake. Environmental DNA metabarcoding is feasible in monitoring mussel freshwater diversity, and water sampling is better than sediment sampling. There is no significant difference between surface water and bottom water.
THE DISTRIBUTION OF VEGETATION IN THE WATER-LEVEL-FLUCTUATION ZONE OF THE THREE GORGES RESERVOIR AND ITS EFFECTS ON PHOSPHORUS TRANSFER AND FISHERY PRODUCTION
WANG Zhi-Cong, ZHOU Wei-Cheng, LI Xiao-Yu, PENG-CHENG-RONG, LI Dun-Hai
 Available online  , doi: 10.7541/2023.2022.0241 doi: 10.7541/2023.2022.0241
[Abstract](344) [FullText HTML] (288) [PDF 1799KB](7)
Abstract:
The water-level-fluctuation zone (WLFZ) of the Three Gorges Reservoir (TGR) has the characteristics of large water level drop, wide area and high vegetation coverage. In order to explore the distribution law of vegetation in the WLFZ of the TGR and its potential contribution to the ecological environment and fishery in the reservoir area, the plant community structural characteristics, plant nutritional components, section slope and soil physical and chemical characteristics of 30 typical sections of the WLFZ in Zigui, Yunyang and Zhongxian Reservoir Areas were investigated and analyzed. The results showed that: (1) 209species belonging to 61 genera and 54 families were found, of which Cynodon dactylon and Xanthium sibiricum were the main dominant species, with an average coverage of 29.73% and 26.87%, respectively. With the decrease of water level elevation, the coverage of C. dactylon, Alternanthera philoxeroides and Abutilon theophrasti gradually increased, the coverage of X. sibiricum, Melilotus officinalis and Bidens tripartite gradually decreased, while the coverage of Humulus scandens, Setaria viridis and Polygonum lapathifolium first increased and then decreased. The distribution of vegetation was also affected by the slope of the sampling sections. The coverage of C. dactylon was significantly negatively correlated with the slope (P<0.001), while that of X. sibiricum showed a significant single peak distribution (P<0.001). Higher soil moisture content promoted the formation of common dominant communities dominated by C. dactylon, and with the decrease of soil moisture content, vegetation types gradually succeed to common dominant communities dominated by X. sibiricum; (2) The surface soil in the WLFZ at low water level elevation (150—160 m) showed an obvious phosphorus absorption trend, while the soil at high water level elevation (160—175 m) showed an obvious phosphorus release trend, which was closely related to the vegetation types and the soil microbial community structure characteristics of the sampling plots; (3) The total ground fresh weights of C. dactylon and X. sibiricum in the whole WLFZ of TGR was 2.51×108 and 2.48×108 kg, respectively, their total amount and protein content are much higher than those of other plants, and their potential contribution to the fishery productivity in the reservoir area are 1.25×108 and 1.24×108 kg, respectively. To sum up, the dominant species of vegetation in the WLFZ of the TGR are C. dactylon and X. sibiricum. The distribution of vegetation is mainly affected by water level elevation, section slope and soil moisture content. The vegetation in the WLFZ of the TGR has high ecological service value in terms of terrestrial phosphorus interception, phosphorus regulation and fishery contribution. This study can provide an important reference for evaluating the ecological fishery function of the reservoir WLFZ and developing the vegetation restoration technology for the WLFZ.
THE COMPLETE MITOCHONDRIAL GENOME OF GRAPSUS ALBOLINEATUS LATREILLE AND COMPARATIVE ANALYSIS OF GRAPSOIDEA
WEI Li-Ming, CHEN Jian, ZHANG Ying, LÜ Zhen-Ming, GONG Li
 Available online  , doi: 10.7541/2023.2022.0259 doi: 10.7541/2023.2022.0259
[Abstract](399) [FullText HTML] (896) [PDF 1149KB](5)
Abstract:
For a long time, the phylogeny of Grapsoidea (Decapoda: Brachyura) has been controversial. Complete mitochondrial genome (mitogenome) provides important information for better understanding of gene rearrangement, molecular evolution and phylogenetic analysis. However, only a few mitogenomes of Grapsidae species have been reported and the phylogenetic status of Grapsidae within Grapsoidea remains unresolved. In order clarify the phylogenetic relationship of Grapsoidea and further explore the correlation between phygeny and mitogenome rearangement, the complete mitogenome of Grapsus albolineatus, the representative species of Grapsidae was sequenced. The total length of this mitogenome is 15577 bp, containing 13 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA genes and a control region. The nucleotide composition is shown as follows: 33.4% A, 12.0% G, 20.6% C, 34.0% T, respectively, with a high AT bias (67.4%). Majority protein-coding genes are initiated by the typical start codon ATN, with an exception GTG in ATP8 and ND1. Most of them terminate with TAN, while two genes (COII and Cyt b) use a single T as a stop codon. Leu (15.8%) and Cys (0.81%) are the most and least frequently used amino acid, respectively. Except for tRNA-Ser1, which lacks DHU arm, all tRNAs have the typical cloverleaf structure. The phylogenetic relationships among Grapsoidea were reconstructed based on nucleotide sequences of 13 PCGs using maximum likelihood (ML) and Bayesian (BI) methods. The phylogenetic trees obtained identical topological structures, which showed that all grapsid crabs clustered into a clade, and G. albolineatus shared the closest relationship with G. tenuicrustatus. Sesarmidae and Xenograpsidae clustered together, and then formed a sister group with Gecarcinidae, and finally form a sister group with Grapsidae. Varunidae formed a separate clade. A significant correlation between gene rearrangement and phylogeny was found in Grapsoidea for the first time. These findings will contribute to a better understanding of gene rearrangement and molecular evolution, as well as provide insights into the phylogenetic studies of Grapsoidea.
SWIMMING ABILITY OF JUVENILE TIGER PUFFER, TAKIFUGU RUBRIPES WITH DIFFERENT BODY MASS AND STARVATION LEVEL
XIONG Yu-Yu, CHEN Lei, LI Ying, WEI Tao, FANG Ding-Hang, WANG Su-Yun, YU Xiao-Ming
 Available online  , doi: 10.7541/2023.2022.0276 doi: 10.7541/2023.2022.0276
[Abstract](255) [FullText HTML] (268) [PDF 1365KB](2)
Abstract:
The tiger puffer, Takifugu rubripes, which distribute in the East China sea, Yellow sea and Bohai sea, is an important fish species in aquaculture and stock enhancement in China. Due to the higher fishing pressure, catches of wild tiger puffer decreased significantly in the late 1980s. Aquaculture-based fisheries enhancement involves the release of cultured organisms to enhance, conserve, or restore fisheries. To restore the stock of tiger puffer, China, Korea and Japan began to release this species. High mortalities in stock enhancement have been found in many species after release due to predation and starvation. Swimming ability directly affects the capacity of finding food, escaping from predators, maintaining position, schooling and migration in released fish. In this study, we investigated the effects of body mass and starvation on the swimming ability of juvenile tiger puffer. The critical swimming speed (Ucrit, cm/s), preferred swimming speed (Upref, cm/s), percentage of accumulated time (Pt, %) under six flow velocities (2—36 cm/s), average flow velocity of preferred zone (Vmean, cm/s) and total swimming distance (D1h, m) of juvenile tiger puffer was determined under different body mass (0.22—3.31 g) and starvation days (1, 3, 6 and 9d). Body mass and starvation significantly affected the Ucrit, Pt, Vmean and D1h of juvenile tiger puffer. The Ucrit, Upref, Vmean and D1h increased from 10.17 cm/s, 2—5 cm/s, 3.79 cm/s and 139.06 m to 17.13 cm/s, 13—26 cm/s, 16.51 cm/s and 580.03 m, respectively, as the body mass increased, whereas the relative Ucrit (Ucrit’, body length/s, BL/s) decreased from 5.83 to 3.56 BL/s. The relationship between body mass and Ucrit, Ucrit’, Pt, Vmean and D1h can be described by the quadratic model. The Ucrit, Ucrit’, Upref, Vmean and D1h decreased from 16.47 cm/s, 3.38 BL/s, 13—26 cm/s, 15.45 cm/s and 566.18 m to 10.03 cm/s, 1.98 BL/s, 2 cm/s, 2.83 cm/s and 119.74 m, respectively, as the starvation day increased. The relationship between starvation day and Ucrit, Ucrit’, Pt, Vmean and D1h can be described by the quadratic model. The Ucrit increased as the body mass increased, which might be due to the increase in muscle mass and efficiency, available energy stores and metabolic capacity with size. Compared to larger conspecifics, the cardiorespiratory system of small fish is more efficient because they have relatively larger respiratory and circulatory organs. The maximum metabolic rate (MMR) decreased as the body mass increased in fish, which might lead to the decrease in Ucrit’. The stronger the swimming ability of the released fish, the higher the survival rate. As the swimming ability of juvenile tiger puffer increased with the body mass, we suggested that the release size should above 5 cm. In order to prevent the released tiger puffer from being flushed away by the current or swimming against the current constantly, the current velocity of the releasing area should below 20 cm/s. The swimming ability of juvenile tiger puffer decreased with the starvation days, which might be due to the decrease in muscle enzyme activity, metabolic capacity and available energy for swimming under starvation. The reduction in the swimming ability might weaken the predation and anti-predation capacity of the released tiger puffer. Results can be of value in understanding ecological processes and improving the stock enhancement of tiger puffer.
EFFECT ON TREATMENT OF RURAL DOMESTIC SEWAGE USING MICROALGA MEDIATED BY TITANATE NANO MATERIALS
JI Li, GE Qi-Li, XIE Fei, ZHANG Gui-Xiang, LI Yuan, BI Yong-Hong
 Available online  , doi: 10.7541/2023.2022.0251 doi: 10.7541/2023.2022.0251
[Abstract](269) [FullText HTML] (263) [PDF 1807KB](1)
Abstract:
The safe disposal of domestic sewage has posed a serious threat to the safety of drinking water sources. Microalgae have remarkable effects on the advanced treatment of domestic sewage, but the sewage has strong inhibitory effects on algae. Nanoparticles have a positive regulatory effect on the growth of microalgae. Therefore, exploring the appropriate nano materials and adding methods, and studying their effects on the treatment of domestic sewage by microalgae are meaningful. In this study, titanate nano materials (TNTs) and microalgae were synergistically used to purify domestic sewage. Different addition methods of TNTS were set up to treat domestic sewage together with five microalgae. The photochemical efficiency of chlorophyⅡ and photosynthetic pigment using different algae species and treatment methods were compared. The superior algae species and efficient treatment methods were screened. The results showed that TNTs could significantly enhance the treatment effect of microalgae on domestic sewage. After the addition of TNTs, microalgae cells all showed aggregation, and the contents of chlorophyll a and carotenoids increased. Inoculation of after Microalgae had the best effect on domestic sewage treatment after TNTs mediated two days later. T. obliquus, T. obliquus, C. vulgaris, and Quadricauda sp. had the highest removal rates of COD, NH3-N, TN, and TP (95.00%, 88.62%, 83.14% and 79.43%), respectively. Compared with microalgae alone, the addition of TNTs significantly increased the degradation rate of pollutants (>10%) and the removal rate from microalgae (>5%). TNTs has a certain application prospect in microalgae advanced treatment of domestic sewage.
SEQUENCE ANALYSIS AND NUTRITIONAL REGULATION OF ISTHMIN-1 IN GRASS CARP (CTENOPHARYNGODON IDELLA)
YANG Lu-Lu, ZHAO Wei-Fang, XU Xin-Xin, ZHANG Yu-Ru, CAO Xiang-Lin, NIE Guo-Xing, LU Rong-Hua
 Available online  , doi: 10.7541/2023.2022.0195 doi: 10.7541/2023.2022.0195
[Abstract](234) [FullText HTML] (296) [PDF 1031KB](7)
Abstract:
In order to explore the role of Isthmin-1 (Ism-1) in glucose and lipid metabolism of grass carp, this study cloned the open reading frame (ORF) of Ism-1 by RT-PCR, and the sequence was analyzed by bioinformatics technology. The distribution characteristics of Ism-1 in different tissues of grass carp were detected by RT-qPCR, and the expression of Ism-1 under different nutritional conditions were analyzed in vitro and in vivo. In this study, ORF region of Ism-1 was successfully cloned. Sequence analysis showed that the ORF region of Ism-1 was 1380 bp, encoding 459 amino acids, and the relative molecular weight of protein was 50.96 kD. Amino acid multiple sequence alignment and phylogenetic tree analysis showed that the evolutionary relationship of Ism-1 between grass carp and fathead minnow was the closest (amino acid similarity was up to 96.51%). Ism-1 was widely expressed in multiple tissues, and had higher expression in red muscle, next are gill, brain and white muscle of grass carp. The fasting and refeeding experiment indicated the expression of Ism-1 in hepatopancreas was significantly upregulated after 14 days of starvation treatment (P<0.05), and the expression decreased after refeeding, but was still significantly higher than that of control group (P<0.05). The expression of Ism-1 in white muscle was significantly up-regulated after starvation and refeeding (P<0.05). The results of intraperitoneal injection of glucagon experiment eventuated that the expression of Ism-1 in hepatopancreas was significantly downregulated compared with control group (P<0.05). In addition, the expression of Ism-1 was significantly decreased (P<0.001) in hepatocyte after treatment with 80 μg/mL oleic acid for 24h. Overall, this research confirmed Ism-1 may be involved in the regulation of glucose and lipid metabolism of grass carp, which would provide essential data for the following study of the function of Ism-1.
THE MOLECULAR CHARACTERISTICS AND REGULATORY FUNCTION OF COMPLEMENT ACTIVATION REGULATOR CD46 IN RAINBOW TROUT
LIANG Jia-Xin, MA Zi-You, LI Wen-Shuo, WANG Peng, TIAN Ding, LIU An-Qi, ZHANG Yong-An, ZHANG Xu-Jie
 Available online  , doi: 10.7541/2023.2022.0234 doi: 10.7541/2023.2022.0234
[Abstract](330) [FullText HTML] (322) [PDF 4030KB](7)
Abstract:
To further study the molecular characteristics and functions of complement activation regulators in teleost fish, this study cloned the CD46 gene of rainbow trout (Oncorhynchus mykiss) and analyzed its molecular characteristics systematically. The results showed that the CD46 gene of rainbow trout was composed of 10 exons and 9 introns; the cDNA sequence of CD46 was 2812 bp and encoded 317 amino acids; the protein sequence of CD46 was composed of 1signal peptide, 4 SCR domains, 1 transmembrane region and 1 intracellular region; and the predicted molecular weight of CD46 was 33.9 kD. Synteny analyses showed that the rainbow trout CD46 gene was located on chromosome 16, and its gene locus had conserved synteny in vertebrates. The expression analyses showed that the rainbow trout CD46 gene was expressed in various tissues and leukocyte subpopulations. To further clarify the immune function of rainbow trout CD46, the GST protein and the fusion protein GST-CD46 were prokaryotically expressed and purified. The experiment of hemolytic activity showed that, compared with GST, GST-CD46 could significantly inhibit the hemolytic activity of rainbow trout serum to rabbit erythrocytes in a dose-dependent manner, indicating that rainbow trout CD46 is a regulator of complement activation. In addition, GFP or GFP-CD46 were overexpressed in HEK293T cells. The experiment of cell damage showed that, compared with GFP, GFP-CD46 could significantly inhibit the damage of rainbow trout serum to HEK293T cells, further indicating that rainbow trout CD46 is a regulator of complement activation and can protect cells from the damage of complement system. In conclusion, this study not only increased the knowledge of the molecular characteristics and regulatory function of rainbow trout CD46, but also provided a theoretical basis for the in-depth study of the immune function of this molecule and its application in disease resistance.
EMBRYONIC AND LARVAL DEVELOPMENTAL CHARACTERISTICS OF THYMALLUS ARCTICUS GRUBEI
XING Jun-Xia, YANG Mao-Yuan, CHEN Peng, LI Li-Wei, ZHONG Xin, CHEN Li-Gang, WU Shi-Yan, HU Jun, GUO Yan
 Available online  , doi: 10.7541/2022.2021.0292 doi: 10.7541/2022.2021.0292
[Abstract](553) [FullText HTML] (401) [PDF 1977KB](3)
Abstract:
Thymallus arcticus grubei is only distributed in the Irtysh River basin in northern Xinjiang Uygur Autonomous Region in China. In recent years, due to overfishing and construction of water conservancy projects, its resources have declined sharply. It was listed as a second-level protected fish in Xinjiang Uygur Autonomous Region in 2004. This research carried out systematic observations on the embryonic development of artificially propagated Thymallus arcticus grubei, and recorded and analyzed the morphological characteristics of their embryos and larvae at various stages of development, aiming to provide necessary basic data for the breeding of Thymallus arcticus grubei and resource protection. The results showed that the fertilized eggs of Thymallus arcticus grubei were spherical, golden yellow, sinking eggs, unabsorbed eggs diameter (2.46±0.14) mm, water-absorbed eggs diameter (3.14±0.18) mm, and there were multiple oil droplets in the yolk. The number and spatial distribution of oil droplets changed regularly during embryonic development. Under the conditions of incubation water temperature (11.06±0.72)℃ and dissolved oxygen of 8.3—9.8 mg/L, it takes 301h to complete the entire embryonic development process, and the required accumulated temperature is 3384.84h·℃. There are 7stages, zygote, cleavage, blastula, gastrula, neurula, organ formation and hatching, totaling 26stages. The differentiation of caudal and pectoral fins and eye pigmentation of Thymallus arcticus grubei larvae have been completed in the late embryonic development of the fertilized egg, and the dorsal fin, pelvic fin, anal fin, adipose fin, etc. differentiated in the post-embryonic development process. The average length of the newly hatched larvae is (9.33±0.35) mm. The yolk sac and oil droplets are completely consumed at the age of 18 days. The growth characteristics of its early developmental stage (0—16 days old) conform to the formula: y=0.0005x4–0.0201x3+0.2264x2–0.3773x+9.6102 (R2=0.9968). This study preliminarily clarified the timing characteristics of the embryonic development and larval development of Thymallus arcticus grubei, and provided a theoretical basis for the future large-scale breeding of seedlings.
MOLECULAR CHARACTERIZATION OF COLD-TOLERANCE RELATED GENES CIRBP, HMGB1, AFP- FROM TAKIFUGU OBSCURUS AND THEIR RESPONSE TO LOW TEMPERATURE STRESS
GAO Yang, WANG Chao-Yu, LIU Xin, LIANG Xia-Ying, ZHAO Zhe, SHI Yan
 Available online  , doi: 10.7541/2023.2022.0239 doi: 10.7541/2023.2022.0239
[Abstract](285) [FullText HTML] (298) [PDF 2295KB](8)
Abstract:
Obscure puffer (Takifugu obscurus) is a euryhaline fugu species and belongs to the Family Tetraodontidae of teleost fish. In China, the Takifugu species is very popular because of its delicious taste and high nutrition, and it is widely farmed on a commercial scale. In recent years, the aquaculture area for obscure puffer is increasing year by year, however, the industry is confronted with many challenges, such as outbreak of diseases and overwintering culture. When winter comes, the growth and breeding of obscure puffer are affected by the environmental temperature. Furthermore, the dramatic decrease of water temperature in winter will cause mass mortality of obscure puffer, and then huge economic losses. Therefore, it is an urgent need for the further development of the industry to obtain low-temperature tolerance fish species through artificial breeding methods, and the premise of this work is to analyze the low-temperature tolerance mechanism of obscure puffer. To explore the response mechanism of obscure puffer to low temperature environment, we cloned the cDNA sequences of tolerance related genes CIRBP, HMGB1 and AFP-Ⅳ and then characterized their molecular features and potential functions. Real-time PCR analysis showed that CIRBP and HMGB1 were highly expressed in the hypothalamus, liver and muscle, while AFP-Ⅳ was mainly expressed in the liver. The obscure puffer was subjected to acute cold stress, then tissue samples were taken at different time periods. Real-time PCR analysis showed that the expression patterns of the above three genes were different in liver and hypothalamus. For example, the expression of CIRBP increased significantly at 48h in liver, while only slightly increased at 12h and 48h in hypothalamus. The expression of HMGB1 showed a gradual increase and reached the highest level at 48h in liver, while it first increased and then decreased in hypothalamus tissue. It reached the maximum at 2h after treatment, decreased at 2—8h, and reached the lowest at 8h, then recovered to the initial level. The expression of AFP-Ⅳ in liver showed no significant change from 0 to 24h, but increased to the maximum at 48h. The antifreeze role of AFP-Ⅳ was further investigated by heterologous expression in Escherichia coli. It was found that the expression of AFP-Ⅳ in E.coli exerted antifreeze effect at -80℃, and the antifreeze activity became apparent with the increase of the concentration of AFP-Ⅳ. Collectively, the results showed that the three genes were involved in the response to low temperature stress, which laid a foundation for further exploring the mechanism of low temperature tolerance in obscure puffer.
IRON STRESS ON THE EXPRESSION OF MICROCYSTIN SYNTHETASE MCYC AND MCYI
WANG Fei, ZENG Xiao-Li, ZHANG Cheng-Cai
 Available online  , doi: 10.7541/2023.2022.0217 doi: 10.7541/2023.2022.0217
[Abstract](309) [FullText HTML] (361) [PDF 1327KB](2)
Abstract:
Microcystin is a class of cyclic hepatotoxin, which poses a great threat to human and animal health. Microcystin synthesis is regulated by a variety of environmental factors, and the synthesis efficiency of microcystin is directly determined by the amount of the corresponding synthetase and the catalytic rate. However, the relationship between protein expression levels of the microcystin synthesis gene cluster and environmental factors is still unclear. In this study, the mcyC and mcyI genes located in the two operons of the microcystin synthesis gene cluster were selected as representatives, using high-efficiency McyC and McyI polyclonal antibodies, detected the effect of iron stress on microcystin synthetase McyC and McyI protein expression levels by Western Blot. The result indicated that the protein levels of McyC and McyI within Microcystis aeruginosa PCC 7806 were consistent with the changes in the synthesis yield of toxins in vivo under iron stress, suggested that iron stress directly regulates the synthesis of the toxin by influencing the expression level of microcystin synthetase. This study provided the basis for further understanding the synthesis mechanism of microcystin.
PREPARATION OF POLYCLONAL ANTIBODIES TO CYHV-2 ORF66 TRUNCATED PROTEIN AND SCREENING OF INTERCALATING PEPTIDES
ZHANG Xiao-Mi, QUE Shun-Zheng, LONG Chen, WANG Hao, LÜ Li-Qun
 Available online  , doi: 10.7541/2023.2022.0269 doi: 10.7541/2023.2022.0269
[Abstract](270) [FullText HTML] (425) [PDF 1848KB](4)
Abstract:
Cyprinid herpesvirus 2 (CyHV-2) causes herpesviral haematopoietic necrosis, which is a serious threat to the health of the crucian carp farming industry. ORF66 is an immunogenic capsid protein of CyHV-2. To investigate the biological function of Cyprinid herpesvirus 2 during infection, a prokaryotic expression plasmid pET28a-tORF66 with ORF66 truncated gene was constructed based on a region with abundant antigenic table, transformed into BL21 receptor cells and then induced to express the protein using IPTG (Isopropyl-beta-D-thiogalactopyranoside) at 16℃. The lysed recombinant protein was obtained by urea lysis dialysis and then immunized in 6-week-old mice to prepare a murine anti-tORF66 polyclonal antibody. The solubilised recombinant proteins were screened for intercalating peptides by phage display techniques. The Western Blot assay showed that the antibody was able to recognize CyHV-2 in infected GICF cells with high potency and good specificity. The results of the phage elution showed by bioinformatics analysis that a peptide with the highest frequency of occurrence, N′-LHLHQNRMSLSR-C′, was obtained. The polypeptide has high homology with three genes in the goldfish genome, including the leukotriene B4 receptor 1 (BLT1) gene, which has six consecutive amino acid repeats with the polypeptide, so it is inferred that the polypeptide may interact with the rORF66 recombinant protein. This will provide a new basis for an in-depth investigation of the biological function of ORF66 during CyHV-2 virus infection, the development of new anti-CyHV-2 virus drugs and the search for potential drug targets.
ANALYSIS ON CULTURABLE FILAMENTOUS FUNGI DOMINANT SPECIES NICHE IN NAM CO LAKE IN SPRING
XUE Wen-Kai, ZHU Pan, GUO Xiao-Fang, DE Ji
 Available online  , doi: 10.7541/2023.2022.0214 doi: 10.7541/2023.2022.0214
[Abstract](501) [FullText HTML] (617) [PDF 1937KB](3)
Abstract:
In order to explore the community characteristics of culturable filamentous fungi in Nam Co Lake in spring, the composition and abundance of filamentous fungi were determined based on the isolation and purification of filamentous fungi, combined with morphological characterization and ITS sequence analysis. At the same time, water environmental factors were determined to analyze correlations between ecological differentiation of dominant species of filamentous fungi and environmental factors in Nam Co Lake. The results showed that a total of 921 filamentous fungi strains were isolated from Nam Co Lake. These strains were identified as 62 species in 20 genera. Fungus resources are abundant, among which, the dominant species (Y>0.02) include: Penicillium commune, Penicillium vinaceum, Penicillium polonicum, Penicillium goetzii, Penicillium griseoroseum, Mucor hiemalis, Mucor racemosus, Pleosporales sp.2 and Penicillium crustosum. The niche indices of the dominant species showed that the sum of ecological response rates of dominant species is negative, and low overlap species accounted for a large proportion (56.94%). Overall, there was a positive correlation among the dominant species, but it did not reach a significant level (χ2>3.841), indicating that the community was in a stage of decline. With weak competition and loose relationships and great differences in resource utilization or ecological adaptability among dominant species. Moreover, the dominant species have not reached a relative dynamic balance, and their succession has not reached the top stage. The correlation between environmental factors and dominant species showed that salinity, conductivity, chemical oxygen demand, turbidity and ammonium nitrogen are the main factors affecting the distribution of dominant species of filamentous fungi in Nam Co Lake. These studies provided basic data for correctly understanding the population characteristics of culturable filamentous fungi in plateau lakes and laid a foundation for the development and utilization of culturable filamentous fungi.
UNDERWATER NOISE ON THE BEHAVIOR AND GUT MICROBIAL COMPOSITION OF HYBRID STURGEON
GAO Yue, LIU Chun-Hua, JIANG Ze-Jian, ZHENG Yue-Ping, XU Jia-Nan, FAN Hou-Yong, WANG You-Ji, HU Meng-Hong
 Available online  , doi: 10.7541/2023.2022.0106 doi: 10.7541/2023.2022.0106
[Abstract](520) [FullText HTML] (408) [PDF 1178KB](15)
Abstract:
In order to investigate the effects of underwater noise on behavior (swimming rate, feeding rate, spatial distribution) and gut microorganisms of sturgeon, hybridized sturgeon were exposed to noise (145±5 dB, 400 Hz) for 0, 48h, 7d, 7d, and 14d, followed by 48h of recovery in an environment without stressful noise. The results showed that the swimming and feeding rates of hybrid sturgeon were significantly reduced and the spatial distribution was changed after noise stimulation. At the beginning of the noise stimulation, the hybrid sturgeon gathered on the side away from the noise source, but gradually approached the noise source after 3min. The microbial composition was significantly different from the other groups at 7 days of noise stress. There was no significant effect of noise on the abundance of gut microorganisms in hybrid sturgeon. Differences in the dominant populations of gut microorganisms existed in each group at different time periods and the dominant populations changed over time. The results of the above microbiological analysis showed that "cell signaling processes", "carbohydrate transport" and "amino acid transport and metabolic functions" were significantly lower than those of the other groups at 48h and 7d of noise stress as predicted by COG. The results showed that noise had significant effects on the feeding rate, swimming rate, and spatial distribution of hybrid sturgeon, changing the composition and proportion of its gut microorganisms and affecting various vital life pathways, such as amino acid metabolism. This experiment simulated the mixed noise of various underwater noise sources and explored their effects on the behavior and gut microorganisms of hybrid sturgeon for the first time, which can provide basic information for the in-depth exploration of healthy ecological breeding and physiological response mechanisms to adversity of hybrid sturgeon.
THE PHYSIOLOGICAL TOXIC EFFECTS OF BENTAZONE ON NOSTOC SPHAEROIDS KüTZING
LIU Shu-Wen, XU Jun-Dang, LIU Huan, NIE Jia-Yin, LI Bao-Lei, LI Yu-Xian
 Available online  , doi: 10.7541/2023.2022.0246 doi: 10.7541/2023.2022.0246
[Abstract](434) [FullText HTML] (375) [PDF 1117KB](0)
Abstract:
Ge-Xian-Mi (Nostoc sphaeroids Kützing) grown in paddy fields is a rare edible cyanobacteria. The yield of wild resources of Ge-Xian-Mi has decreased owing to the extensive use of pesticides and fertilizers. The physiological toxic effects on Ge-Xian-Mi was lack of studies for bentazone, although it was a broad-spectrum and high-efficiency and low-toxicity new herbicide. This study compared and analyzed the physiological toxic effects in growth, oxidation and antioxidant system, photosynthesis and respiration of Ge-Xian-Mi treated by different times and different concentrations of bentazone. The results showed that bentazone inhibited the growth of Ge-Xian-Mi. In the wake of increased concentration and prolonged treatments for bentazone, they showed an upward trend as production rate of \begin{document}${\rm{O}}^-_2 $\end{document} and the content of H2O2, AsA, MDA, Pro and the activities of two antioxidant enzymes, CAT and POD in Ge-Xian-Mi. With the increased concentrations of bentazone, the content of GSH in Ge-Xian-Mi firstly decreased and then increased, but it was little changed overall. The SOD enzyme activity increased with concentrations and time treatments for bentazone, but the SOD enzyme activity was slightly less than 48h after treatment with high concentration of bentazone for 96h. After treated with bentazone for 72h, the total oxygen production and net oxygen production of Ge-Xian-Mi decreased with the increased concentrations of bentazone, however no significant difference was found in respiratory oxygen consumption. The total oxygen production in the treatment of Ge-Xian-Mi was more easily inhibited by strong light and the recovery ability of weak light was reduced. The results of this study provide a reference for further research on the molecular mechanism of the toxicity and adaptation of Ge-Xian-Mi to bentazone and the ecological protection of wild Ge-Xian-Mi.
THE HOST EFFICIENCY OF DIFFERENT SIZE OF FISH FOR GLOCHIDIA OF POTAMILUS ALATUS AND IMPACT ON NUTRITIONAL INDEXES OF HOST FISH
MA Xue-Yan, LIANG Jian-Chao, JIN Wu, LV Guo-Huo, GU Ruo-Bo, XU Pao, HUA Dan, AMD WEN,
 Available online  , doi: 10.7541/2023.2022.0049 doi: 10.7541/2023.2022.0049
[Abstract](535) [FullText HTML] (342) [PDF 759KB](2)
Abstract:
In order to improve the reproductive efficiency of pink heelsplitter, Potamilus alatus, and explore the influence of parasitism on nutritive index of freshwater drum, Aplodinotus grunniens, this experiment measured the effect of parasitism of different scales through comparing the amount of glochidium falling from freshwater drum, and analyzed changes of serum biochemical indices of the host, and content of amino acid and fatty acid under stress of parasitism. Results indicated that the amount of glochidium falling from the hosts in group of big freshwater drum is significantly greater than that in group of small freshwater drum (P<0.05), while the average amount of juvenile mollusk falling from the hosts in each kilogram in group of small freshwater drum is much bigger than that in group of big freshwater drum (P<0.05); creatinine in muscles significantly increases under stress of parasitism (P<0.05), and glutamic-pyruvic transaminase, glutamic oxalacetic transaminase and lactic dehydrogenase greatly drop (P<0.05), while blood glucose, total protein, albumin, triglyceride, total cholesterol, high-density lipoprotein and low density lipoprotein barely change comparing with those in the control group (P>0.05); Ash content in the experimental group barely differs from that in the control group (P>0.05), and water content and crude fat in muscle in the experimental group are significantly higher than those in the control group (P<0.05), while content of crude protein in experimental group is obviously lower than that in the control group (P<0.05); content of aspartic acid, alanine, glutamic acid, tyrosine, glycine and arginine in the experimental group are greatly lower than those in the control group (P<0.05), and content of non-essential amino acid is notably lower than that in the control group (P<0.05), while the content of other amino acids in two groups are barely different (P>0.05); the content of lauric acid (C12:0) and arachidonic acid (C20:1) in the experimental group are remarkably higher than those in the control group (P<0.05), while there is no other significant difference (P>0.05). Results indicated that small size host fish is more suitable for practical production and parasitism had little influence on the nutritive index of freshwater drum.
STABILITY OF DIAGNOSTIC MORPHOLOGICAL CHARACTERS IN CERIAGRION LARVAE (ODONATA: ZYGOPTERA)
ZENG Zheng, CHEN Xue-Yi, YU Xin
 Available online  , doi: 10.7541/2023.2022.0077 doi: 10.7541/2023.2022.0077
[Abstract](473) [FullText HTML] (386) [PDF 4125KB](5)
Abstract:
Although dragonfly larvae can be good bioindictors in fresh water environment assessments, their identification based on morphological characteristics is still a tough work, especially at species level. In the present study, 116 larvae of two Chinese widespread damselfly, Ceriagrion fallax Ris and Ceriagrion auranticum Fraser, were identified depending on sequence data of the mitochondrial genes Cytochrome Oxidase I (COI) and nuclear ribosomal genes ITS. The stability of two important morphological characters, caudal gills and mandibles, was discussed.  For molecular analysis, LCO1490d (TTTCTACWAACCAYAAAGATATTGG) and HCO2198d (TAAACTTCWGGRTGTCCAAARAATCA) were used as COI primers, and Vrain2F (CTTTGTACACACCGCCCGTCGCT) and Vrain2R (TTTCACTCGCCGTTACTAAGGGAATC) as ITS primers. The reaction systems were 31.0 μL: DNA template 3.0 μL, upstream and downstream primers 2.0 μL each, Mix 15.0 μL (Jiangsu ComWin Biotech Co., Ltd's 2×Es Taq Master Mix), ddH2O 9.0 μL. Take 5.0 μL PCR amplification products and detect them by electrophoresis using 1.5% agarose gel. The amplification products with detected by electrophoresis, and then sent to Chongqing Tsingke Xingye Biotechnology Co to sequence. Neighbor-Joining (NJ) trees and genetic distance method were using for the molecular identification of larvae, with the help of identified adults’ sequences as conference. Relative large size of larval specimens, C. fallax (n=110) and C. auranticum (n=6), were dissected and photographed using LY-WN-OPLENC ultra-clear microphotographic system. Detailed comparative morphological examination was conducted focusing on two typical morphological features, caudal gill and mandibles.  Our result showed that: (1) the presence or absence, numbers, and color of the black spots on the caudal gill were unstable, which have nothing to do with populations and sex; (2) characters of mandibles were also variable even within the same population. The discovery of the instability of the two typical diagnostic morphological characters indicates that characters of caudal gills and mandibles, at least, in these two species should be used with caution latterly in taxonomy. Our result also suggests that the similar instability may exist in other diagnostic morphological characteristics in other odonate species. The idea and methodology of this study can be instructive to future morphological studies on insect taxonomy.
RECIRCULATING AQUACULTURE POND ON EDIBLE QUALITY OF POLYCULTURE GRASS CARP (CTENOPHARYNGODON IDELLUS)
WEN Li, LI Wen-Rong, TAO Ling, AN Yue-Qi, LIU Ru, LI Gu, XIONG Shan-Bai
 Available online  , doi: 10.7541/2023.2022.0177 doi: 10.7541/2023.2022.0177
[Abstract](384) [FullText HTML] (360) [PDF 887KB](4)
Abstract:
In order to explore the influence of farming mode on the quality of grass carp (Ctenopharyngodon idellus), a comparative study was conducted on edible quality of grass carp between traditional pond farming and recirculating aquaculture system. The results showed that the muscle quality and edible quality of grass carp farmed in recirculating water were better than those farmed in the traditional pond. The whiteness and springiness of recirculating aquaculture grass carp were higher than those of traditional pond farmed grass carp, the contents of unsaturated fatty acids and essential amino acids in recirculating water aquaculture grass carp were significantly higher than those in the traditional pond. The contents of n-3 and n-6 unsaturated fatty acids in recirculating water aquaculture grass carp were significantly higher than those in the traditional pond grass carp, indicating better nutritional characteristics and better muscle quality. Besides, the contents of the total amino acids in recirculating cultured grass carp was significantly higher than that of traditional cultured grass carp, which made grass carp have higher nutritional characteristics. The contents of protein in grass carp cultured by recirculating aquaculture was higher, in line with contemporary nutrition. Recirculating aquaculture could reduce the contents of hexanal, heptanal and 1-octen-3-ol in grass carp with off-odor, and the content of hypoxanthine nucleotide (IMP) was higher than that in the traditional pond, which made grass carp taste more delicious and dense. The results showed that the muscle quality and nutritional characteristics of grass carp farmed in recirculating water were better than those of the traditional pond.
GEOMETRIC MORPHOMETRIC ANALYSIS OF SILVER CARP LARVAE AFTER EXPOSURE TO TDCIPP
YANG Hao, PU Yan, GAO Lei, DUAN Xin-Bin, LIU Shao-Ping, CHEN Da-Qing, LI Yun
 Available online  , doi: 10.7541/2023.2022.0162 doi: 10.7541/2023.2022.0162
[Abstract](441) [FullText HTML] (427) [PDF 1493KB](8)
Abstract:
Tris(1,3-dichloro-2-propyl) phosphate (TDCIPP), widely used as a kind of organophosphorus flame retardant, has been detected in the Yangtze River water environments. Many toxicological assessments have shown that TDCIPP could change morphology of fish. Silver carp (Hypophthalmichthys molitrix) lives in the Yangtze River for its entire life story. However, the effects of TDCIPP on silver carp is unclear. In order to clarify the main morphological characters of growth inhibition of silver carp larvae caused by TDCIPP, the present study analyzed the morphological traits between four environmentally relevant concentrations (0.05, 0.5, 5 and 50 μg/L) and the control group by geometric morphometric analysis. After the image information of larvae simple was obtained, the body length and body weight were measured. Then, digitization of landmarks was carried out with the TPS series software. Finally, principal component analysis (PCA), canonical variates analysis (CVA) and results visualization were carried out with Morpho J software. The body length and body weight of silver carp larvae decreased significantly under exposure to 0.5、5 and 50 μg/L of TDCIPP compared with the control group, but no effects were observed in 0.05 μg/L. This indicated that environmentally relevant concentrations of TDCIPP induced growth inhibition in silver carp larvae. The results of PCA and CVA indicated that the first principal component (PC1) and the second principal component (PC2) together accounted for 62.15% of the overall variables (47.36% and 14.51%, respectively). The first canonical variates (CV1) and the second canonical variates (CV2) together accounted for 79.48% (54.55% and 24.93%, respectively), which satisfied the requirement of morphological analysis of silver carp larvae. The results of grid profile analysis indicated that the average morphology of silver carp larvae in different concentrations was significantly different with the control group(P < 0.05), which identified by the growth retardation of the head, longitudinal axis of body and tail. As a conclusion, TDCIPP could induce the growth retardation of head, longitudinal axis of body and tail in silver carp larvae. Therefore, attentions should be paid to the environmental concentrations of TDCIPP in the Yangtze River Basin, and the ecological risk of TDCIPP to the replenishment of silver carp population resources should be assessed.
ESTABLISHMENT AND CHARACTERIZATION OF A TESTICULAR CELL LINE FROM CHINESE STURGEON (ACIPENSER SINENSIS)
YE Huan, WANG Yi-Zhou, DU Hao, YUE Hua-Mei, RUAN Rui, LUO Jiang, LI Chuang-Ju
 Available online  , doi: 10.7541/2023.2022.0139 doi: 10.7541/2023.2022.0139
[Abstract](461) [FullText HTML] (542) [PDF 1365KB](16)
Abstract:
The Chinese sturgeon, Acipenser sinensis, is a large anadromous fish, with an average 14 years for males and 21 years for females. It was listed as critically endangered by the International Union for Conservation of Nature (IUCN) since 2010, and its spawning activity was not observed during the past five spawning seasons. Therefore, there is an urgent need to preserve the genetic resources of Chinese sturgeon. To investigate the germplasm conservation of Chinese sturgeon and its spermatogonia stem cell culture in vitro, a new cell line (designated as AST) derived from the testis of Chinese sturgeon was established and characterized. The AST cell line are fibroblast-like cells, and have been stably subcultured for more than 80 passages. The optimal growth conditions for the AST cell line are DMEM medium, 25℃, and 15% FBS. After cryopreservation in liquid nitrogen, the viability of AST cells was about (81.36±1.13)%, as measured by trypan blue staining. Chromosome analysis of AST cells at the 30th passage showed that the number of chromosomes ranged from 142 to 310, and the modal number was 264. To detect the expression characterization of Sertoli cell-related genes (amh and gsdf), Leydig cell-related genes (cyp17a1), and germ cell-related genes (dazl, dnd, and vasa) in AST cells by RT-PCR, all of the genes were found in the P0 and P1 cells, where their amounts were similar with those of in testis; however, in P15, P30, and P60 AST cells, only amh and vasa genes were detected with very low level, suggesting only a few number of Sertoli cells and germ cells in the late passage of AST cells. The signal of enhanced green florescence protein (GFP) were detected in a few of AST cells after transfection with pEGFP-N3 plasmid. The establishment of the AST cell line could provide important experimental material for the conservation genetic resources of Chinese sturgeon, the in vitro study of proliferation and differentiation of spermatogonia stem cell, and function analysis of testicular related genes.
ANALYSIS OF MOLLUSCS COMMUNITY STRUCTURE IN THE ZHEJIANG COAST
LU Zhan-Hui, ZHOU Yong-Dong, ZHU Wen-Bin, XU Kai-Da
 Available online  , doi: 10.7541/2023.2022.0203 doi: 10.7541/2023.2022.0203
[Abstract](484) [FullText HTML] (584) [PDF 0KB](8)
Abstract:
Based on survey data collected in 4seasons of 2019 by single bottom trawling of Zhejiang surrounding waters, the paper analysed species composition, dominant species and the distribution of resources density of molluscs. Ecosystem diversity index, Species similarity index(Js), Alternate index (AI), Migration index (MI) and abundance/biomass comparison curve (ABC curve) were adopted to analyse species diversity of community and its dynamic changes. The results showed that 62 molluscs species were captured belonging to 3 classes 10 orders, and 32 families, and the dominant species were Octopus variabilis, Loligo edulis, Turritella bacillum, Abralia multihamatai, and Sepiola birostrata all the year. The seasonal variation of dominant species was quite different. The annual average resource density was 204.94 kg/km2, The resource density in summer was the highest value in the whole year, and Winter was the lowest. The average resource density was increasing gradually from north to south roughly. The annual average values of species abundance index (D), species diversity index (H’) and species evenness index (J’) were 0.70, 0.88 and 0.61 respectively. Three indices values indicated that molluscs community diversity was on a low level. The values of Species similarity index (Js), Alternate index (AI) and Migration index (MI) indicated that the community stability was higher in spring and winter than in summer and autumn. According to the ABC curve, molluscs community all the year were moderately disturbed respectively.
TAXONOMY OF MICROCOLEACEAE IN BIOLOGICAL SOIL CRUSTS IN THE GURBANTUNGGUT DESERT
LIU Yan-Jin, LI Kai-Kai, ZHANG Ya-Li, ZHAO Kang, ZHANG Bing-Chang
 Available online  , doi: 10.7541/2023.2022.0160 doi: 10.7541/2023.2022.0160
[Abstract](472) [FullText HTML] (613) [PDF 1578KB](4)
Abstract:
Biological soil crusts (BSCs) play critical ecological functions in desert ecosystem. Microcoleus sp. are key filamentous cyanobacteria and play vital roles in BSCs. More and more strains of Microcoleaceae were found in desert areas. However, it is difficult to distinguish them in species level due to similar morphological characteristic. In this manuscript, 11 filamentous cyanobacterial strains with similar morphology to Microcoleus were isolated and purified from BSCs in Gurbantonggute desert. The experimental cyanobacterial strains were examined morphologically as well as phylogenetically using 16S rRNA gene and the 16S—23S internal transcribed spacer (ITS) rigion. The results show that the experimental cyanobacterial strains belong to the genera Microcoleus and Symplocastrum, including two newly recorded species in China: M. steenstrupii and S. flechtnerii, as well as M. vaginatus and a suspect species similar to M. steenstrupii. The number and alignment of cyanobacterial filaments, cell size and the shape of apical cells, and phylogenetic relationship based on 16S rRNA are key evidence to identity different species of Microcoleaceae. Secondary structure of ITS are also vital reference to distinguish to different species in same genus.
COMMUNITY ECOLOGY OF INTESTINAL HELMINTHS IN GYMNOCYPRIS WADDELLII FROM YAMDROK LAKE, XIZANG AUTONOMOUS REGION, CHINA
PAN Ying-Zi, TASHILHAMO
 Available online  , doi: 10.7541/2023.2022.0144 doi: 10.7541/2023.2022.0144
[Abstract](463) [FullText HTML] (508) [PDF 1330KB](4)
Abstract:
In order to reveal the diversity and distribution of parasites, as well as the interaction and coexistence mechanism among parasites, analyze the relationship among parasites, hosts and environment, study the community ecology of intestinal helminths in Gymnocypris waddellii from Yamdrok Lake, understand the species diversity of aquatic organisms in Xizang Autonomous Region, explore the community characteristics and interspecific relations, and accumulate data for studying the relationship among parasites, Tibetan plateau environment and unique fish hosts, 180 G. waddellii (120 females and 60 males, with a total length of 22.20—49.20 cm, an average length of 36.76±4.18 cm, a body weight of 77.3—896.7 g, and an average weight of 425.92±148.27 g) were dissected in July 2020. The contents of community ecology such as community structure and interspecific relationship were analyzed. The results showed that the intestinal helminth community of G. waddellii in Yamdrok Lake were composed of five species: Parabreviscolex niepin, Contracaecum eudyptulae, Streptocara sp., Neoechinorhynchus sp. and Allocreadium sp.. From high to low, the prevalence of populations were Neoechinorhynchus sp., P. niepin, Allocreadium sp., C. eudyptulae and Streptocara sp.; the infection intensity of populations were P. niepin, Neoechinorhynchus sp., C. eudyptulae, Allocreadium sp. and Streptocara sp.; the average abundance of populations were P. niepin, Neoechinorhynchus sp., Streptocara sp., Allocreadium sp. and C. eudyptulae. The Margalef index of community was 0.59, Shannon-Wiener index was 1.26, Pielou index was 0.83 and Berger- Parker index was 0.50. The dominant species was P. niepin. There were positive correlations among four populations, and the order of correlation from high to generation were as follows: Neoechinorhynchus sp.and Allocreadium sp, C. eudyptulae and Neoechinorhynchus sp., C. eudyptulae and Allocreadium sp., C. eudyptulae and Streptocara sp.. There were no interspecific association between other parasitic worm populations. In terms of infection or not, the number of infected hosts was more than half of that of the sampled population. Among them, the host frequency with one parasite was the most, the host frequency with two parasites was also more, the host frequency with three and four parasites were significantly reduced, and no hosts infected with five parasites at the same time was found. Compared with Lake Chugutso, which is also located in southern Xizang and once connected with Yamdrok Lake, although the two lakes are geographically similar, the host fish species are the same, and the intestinal helminth species composition is the same, intestinal helminths in G. waddellii from Yamdrok Lake has its own characteristics, that is, higher average abundance, and most parasitic worm populations also have higher prevalence, and the dominant species in the community are also different from Chugutso Lake. Interspecific association is used to judge whether there is coexistence or exclusion between various groups in intestinal helminths community, that is, interspecific affinity. In the intestinal helminths community of G. waddellii from Yamdrok Lake, the affinity between the undetermined species of Neoechinorhynchus sp. and Allocreadium sp. were the highest. However, this relationship is not stable and will change with the changes of water ecological environment and species composition in the community. The frequency of co-infected hosts suggests that with the increase of species in a sub community, the greater the interaction between species, the more difficult it is to maintain coexistence.
REMOVAL EFFICIENCY AND MECHANISM OF BDE-47 BY THE ZN-FE LDHS MODIFIED QUARTZ SAND-BIOFILM SYSTEM
CAI Qin, LI Yan-Ni, WANG Chang, WANG Ya-Fen
 Available online  , doi: 10.7541/2023.2022.0158 doi: 10.7541/2023.2022.0158
[Abstract](431) [FullText HTML] (428) [PDF 2261KB](3)
Abstract:
In this paper, Zn-Fe layered double hydroxides (LDHs) modified quartz sand was prepared by coprecipitation method and cultivated with inoculation of Shewanella putrefaciens CN32 under aerobic, anaerobic and alternating conditions, to examine the biofilm formation process on LDHs modified matrix and its removal efficiency of BDE-47 as the target pollutant. The biotic and abiotic removal mechanisms of BDE-47 were further explored by monitoring variations of Fe2+ and H2O2 concentrations in the reaction systems. The results showed that LDHs coating would not affect the formation of biofilm on the surface of the modified quartz sand, but Zn-Fe LDHs modified matrix showed certain inhibitory effect on electron transport system activity of CN32 under aerobic condition, while the composition of extracellular polymer substance (EPS) of matrix biofilm changed with an increase in the proportion of polysaccharide under anaerobic condition. Total concentrations of EPS in the matrix biofilm reaction systems were significantly higher than those in the pure CN32system under both aerobic and anaerobic conditions.The formation of matrix biofilm significantly improved the removal efficiency of BDE-47 in the reaction system (about 25%) under aerobic and anaerobic alternating condition. Under the alternating condition, the removal of BDE-47 in the first three cycles (within 72h) depended mainly on matrix adsorption; while 72h later, biofilm adsorption and biodegradation contributed together, and LDHs modified matrix exhibited greater boost potential in the later stage. This study demonstrated the biofilm formation characteristics of LDHs modified matrix and its potential for the removal of PBDEs from the aqueous phase, and provided new ideas for enhancing the biodegradation of PBDEs in constructed wetlands.
IDENTIFICATION AND INDUCED EXPRESSION OF THE METALLOTHIONEIN GENE OF A HIGH CD-TOLERANCE COLPODA INFLATA POPULATION
HOU Sen, ZHAO Xue, GAO Rong, WANG Ying, ZHENG Wei-Bin, WANG Li, PAN Xu-Ming, REN Nan-Qi, CHEN Ying
 Available online  , doi: 10.7541/2023.2022.0165 doi: 10.7541/2023.2022.0165
[Abstract](498) [FullText HTML] (491) [PDF 1711KB](6)
Abstract:
Cadmium is the first of the heavy metal pollutants to be controlled in water. Metallothionein is one of the key proteins that can bind to cadmium and regulate the oxidative stress response of organisms. The protozoan MT has been reported in two ciliates, Tetrahymena and Paramecium. In this study, we obtained a northeast population of Colpoda inflata with high cadmium tolerance. Metallothionein content of C. inflata showed a positive correlation with cadmium concentration and growth rate of population in five gradient concentration of cadmium stress experimental groups from 24—96h. The highest cd-tolerance concentration was 10 mg/L in 96h. Metallothionein gene of Colpoda inflata was cloned and named Col-MT1. The gene sequence and amino-acid sequence were analyzed. The results showed that Col-MT1 had high homology with the amino acid sequences of other ciliates, and contains two conserved sites XXCXX and XCCX. It was a new member of subtype 7a of metallothionein gene family. TASSER protein model predicted that the secondary structure of Col-MT1 protein was composed of α-helix, β-folding and random crimp, accounting for 67.90%, 11.11% and 20.98%, respectively. SWISS-MODEL predicted that the 3D structure of Col-MT1 protein was the most similar to that of cyanobacteria metallothionein. qRT-PCR experiment confirmed that at 60h, 84h and 108h, the expression of Col-MT1 gene was up-regulated to different concentration cadmium and showed a dose-response relationship with cadmium concentration. The molecular mechanism of gene expression still needs further study. Above results supplemented the MT gene database of protozoa and lay a foundation for revealing the mechanism of C. inflata MT gene. As well as provide reference for monitoring and remediation of cadmium pollution.
SCREENING OF PEPTIDES INTERACTING WITH GRASS CARP REOVIRUS VP39 PROTEIN BY PHAGE DISPLAY TECHNOLOGY
LONG Chen, XU Ning, XIE Ya Qing, LÜ Li Qun
 Available online  , doi: 10.7541/2023.2022.0179 doi: 10.7541/2023.2022.0179
[Abstract](522) [FullText HTML] (574) [PDF 968KB](8)
Abstract:
VP39 is a protein encoded by S9 gene of type Ⅲ grass carp reovirus (GCRV-Ⅲ). In order to study the biological function of VP39 protein in the process of GCRV infection of grass carp cells, the sequence of VP39 gene was cloned and the prokaryotic expression vector PET32A-VP39 was constructed. The fusion protein VP39-HIS was obtained by using prokaryotic expression method. Mouse anti-VP39 polyclonal antibody was prepared by immunizing mice with VP39solution protein, and the antibody was evaluated by Western Blot. The polyclonal antibody was used to investigate the expression dynamics of VP39 protein in GCRV infected cells. The results of SDS-PAGE showed that the fusion protein of vp39-his was well soluble in PBS and the protein size was about 39kDa. Western Blot analysis showed that the prepared VP39 polyclonal antibody could recognize both the prokaryotic expression of VP39-HIS fusion protein and the expression of VP39 protein after GCRV infection with CIK cells at the dilution ratio of 1:10000, showing good titer and specificity. In the process of virus infection, the expression of VP39 was low in the early stage and high in the middle and late stage. Two peptides were screened by phage display technology for specific binding to VP39 protein, and further bioinformatics analysis also found that 7 genes in grass carp genome had homology with the peptide, indicating that these genes may interact with VP39. In this study, mouse anti-VP39 polyclonal antibody was prepared, which provided a new immunological method for GCRV-Ⅲ detection. The screening of binding peptides also laid a foundation for the study of the biological function of VP39 in the process of GCRV infection.
COMPARISON OF IMMUNE CHARACTERISTICS OF CHINESE STURGEON CULTURED IN SEA AND FRESH WATER
CHEN Xue-Hui, LENG Xiao-Qian, LUO Jiang, DU Hao, LIU Zhi-Gang, QIAO Xin-Mei, XIONG Wei, WEI Qi-Wei
 Available online  , doi: 10.7541/2023.2022.0129 doi: 10.7541/2023.2022.0129
[Abstract](535) [FullText HTML] (414) [PDF 5661KB](7)
Abstract:
Chinese sturgeon (Acipenser sinensis) is a large anadromous migratory fish. In order to understand the immune characteristics of freshwater cultured Chinese sturgeon in seawater, a 5-month mariculture trial was conducted with 4-year-old Chinese sturgeons, and the adaptive changes of blood physiology, biochemistry and immune tissue were explored. The results showed that the white blood cell counts were significantly increased (P<0.05), and there was no significant difference on red blood cell count. But the hemoglobin and hematocrit increased significantly in the seawater from (46.50±10.59) g/L, (13.7±3.23)%, (9.19±1.10)×109/L to (74.5±1.10) 11.05) g/L, (21.80±3.33)% and (10.88±3.73)×109/L, respectively. In the differential count of white blood cells, lymphocytes accounted for the largest proportion, followed by neutrophils, and there was no significant difference in the percentages of various types of white blood cells. Blood biochemical indexes such as SOD, MDA, LZM, IgM, AKP and ACP have no significant changes in freshwater and seawater. Observation of immune tissue structure showed that there was no obvious change in the thymus in seawater, but the cells were aggregated, the shape distribution was more orderly and the center of melanin macrophages increased in the head kidney tissue; Lymphocytes and red blood cells are more densely distributed in the spleen tissue. The results showed that marine aquaculture can enhance the immunity and hematopoietic function of Chinese sturgeon to a certain extent, and maintain a good physiological state.
PURGING TIME ON MUSCLE QUALITY AND NUTRITIONAL VALUE OF YELLOW CATFISH (PELTEOBAGRUS FULVIDRACO) UNDER OPEN FLOWING WATER MODE
FU Yun-Yin, ZHEN Wei-You, ZHANG Heng, RUAN Guo-Liang, LIU Yu-Lin, CHAI Yi, FANG Liu
 Available online  , doi: 10.7541/2023.2022.0075 doi: 10.7541/2023.2022.0075
[Abstract](510) [FullText HTML] (696) [PDF 764KB](10)
Abstract:
This experiment was conducted to investigate the effect of purging time on muscle quality and nutritional value of yellow catfish (Pelteobagrus fulvidraco) under open flowing water mode. Yellow catfish of (15.69±2.28) g at the rapid growth stage were randomly divided into 4 groups with 3 replicates in each group. The yellow catfish were temporarily fed for 0 (control), 20, 30 and 40 days respectively. During the experiment, Pelteobagrus fulvidraco were fed with a compound diet, and the water quality was regularly measured during the breeding process. After the experiment, the growth performance and serum biochemical indexes were measured; the composition of amino acids, fatty acids and textural properties in muscle were compared. The results showed as follows: 1) During the purging time period, the content of ammonia nitrogen in the water of the test tank was between 0.03—0.05 mg/L, the content of nitrite nitrogen was 0.01 mg/L, and the dissolved oxygen level exceeded 9.0 mg/L. 2) With the extension of purging time, the final body weight (Wt) and weight gain rate (WGR) of yellow catfish showed an increasing trend, while the specific growth rate (SGR) showed a decreasing trend, with significant differences among groups (P<0.05). There were no significant differences in survival rate (SR), condition factor (CF), hepatosomatic index (HSI) and viscerosomatic index (VSI) of purging time groups for 20, 30 and 40 days (P>0.05). 3) The contents of albumin (ALB) and total protein (TP) in serum of purging time 30 and 40 days group were significantly higher than those of control group and purging time of 20 days group (P<0.05), but the activities of gamma-glutamyltransferase (γ-GGT), alkaline phosphatase (ALP), the contents of total cholesterol (TC) and total bile acids (TBA) were significantly lower than those of the control group and the purging time of 20 days group; serum total bilirubin (TBIL) content and aspartate aminotransferase (AST) activity in the control group, the purging time of 20 days and 30 days groups were significantly higher than those of the purging time group for 40 days (P<0.05). The content of serum creatinine (CRE) and urine creatinine ratio (UCR) of Pelteobagrus fulvidraco in the purging time groups for 30 and 40 days were significantly lower than those in the control group and the purging time for 20 days group (P<0.05). 4) The crude protein content in muscle of purging time groups for 30 and 40 days was significantly higher than that of control group and purging time group for 20 days (P<0.05), but the crude lipid content was significantly lower than that of control group and purging time group for 20 days (P<0.05). 5) The total amount of amino acids (ΣAA), total essential amino acids (ΣEAA), total non-essential amino acids (ΣNEAA), total umami amino acids (ΣDAA) and essential amino acid index (EAAI) in the 30d and 40d purging time groups were significantly higher than those in the control group and the 20d purging time group (P<0.05). The first limiting amino acid in muscle of four groups was all phenylalanine+tyrosine. 6) The contents of C20:5n-3+C22:6n-3 (EPA+DHA), monounsaturated fatty acid (MUFA) and polyunsaturated fatty acid (PUFA) in muscle of yellow catfish in purging time group for 40 days were significantly higher than those in other groups (P<0.05). 7) The muscle hardness and gumminess properties of purging time group for 40d was significantly higher than those in other groups (P<0.05), and the muscle springiness, chewiness and resilience were significantly higher than those of control group and purging time group for 20d (P<0.05). In this experiment, under the conditions of temporary cultivation, purging time for 40 days can improve the muscle quality and nutritional value of yellow catfish, increase the contents of amino acids and fatty acids, reduce the earthen smell of pond cultured fish, and increase the aquaculture benefit of Pelteobagrus fulvidraco.
EXHAUSTION EXERCISE STRESS ON HYPOXIA AND THERMAL TOLERANCES OF THREE CYPRINID SPECIES
ZHANG Yong-Fei, HUANG Ke-Ren, LUO Yu-Lian, LIU Qian-Ying, PANG Xu, FU Shi-Jian
 Available online  , doi: 10.7541/2023.2022.0193 doi: 10.7541/2023.2022.0193
[Abstract](491) [FullText HTML] (478) [PDF 1082KB](6)
Abstract:
The hypoxia and thermal tolerances of fish are important physiological characteristics that determine their distribution, habitat change, and adaptability to climate change. While in the nature, fish are always in the process of swimming or recovery of post-exercise, whether the hypoxia and thermal tolerances change during swimming or immediately after exhaustive recovery process is unknown for fish. Thus, to study the effects of exhaustion exercise stress on fish hypoxia and thermal tolerances, we investigated three cyprinid fish species (i.e. Carassius auratus, Spinibarbus sinensis and Cyprinus carpio) living in different habitats as study cases. Hypoxia and the thermal tolerance indicators of the three fish species were measured after exhaustion exercise, respectively, to determine whether exhaustion exercise stress would affect the stress resistance of fish. In the present study, we found that body weight only affected significantly on minimal critical temperature (CTmin), and the indicators of hypoxia and thermal tolerances were different significantly between species. Moreover, exhaustion exercise stress led to a significant increase in critical oxygen tension (Pcrit) of common carp and a significant increase in critical metabolic rate (CMR) of all the three species as well, but a significant decrease in point of oxygen tension for loss of equilibrium (LOE) of qingbo. Meanwhile, it also resulted in a significant decrease in maximal critical temperature (CTmax) of goldfish and qingbo. However, there was no significant effect on the species and other related measured parameters besides the fish species and their corresponding experimental parameters mentioned above. It could be said based on the results that changes in the hypoxia and thermal tolerances of fish living in different habitats are different after exhaustion exercise stress, and that fish species vary in physiological mechanisms responding to other environmental stressors following exhaustion exercise stress, which may be related to difference in their energy metabolism patterns.
COMPARISON OF FISHERIES BIOLOGICAL CHARACTERISTICS OF STHENOTEUTHIS OUALANIENSIS IN THE NORTHWEST INDIAN OCEAN IN DIFFERENT CLIMATIC YEARS
LU Hua-Jie, HE Jing-Ru, CHEN Jing, WANG Hong-Hao, CHEN Xuan-Yu, LIU Kai, CHEN Xin-Jun
 Available online  , doi: 10.7541/2023.2022.0159 doi: 10.7541/2023.2022.0159
[Abstract](468) [FullText HTML] (439) [PDF 1823KB](4)
Abstract:
According to the 1896samples of Sthenoteuthis oualaniensis collected by Chinese light falling-net fishery during the same months (February-May) in the northwest Indian Ocean, this study presents the differences of fisheries biological characteristics of Sthenoteuthis oualaniensis between 2019 (Ei-Niño) and 2020 (normal). The result indicated that the mantle length (ML) range and dominant ML group of 2019 were larger than that of 2020, especially for females. The ML range of females in both years were 129—347and 284—582 mm, and the dominant ML group were 171—220 and 481—530 mm, respectively. The ML range of males were 138—273 and 94—235 mm, and both of the dominant ML group were 171—220 mm. The analysis of covariance (ANCOVA) showed that the relationships between body weight (BW) and ML of Sthenoteuthis oualaniensis in different years was significantly different between the sexes. By fitting and optimizing the equations and comparing the AIC (Akaike’s information criterion), the relationship between ML and BW of males were most suitable to be expressed by exponential functions, except for the males of 2020 when the relationship between ML and BW of males was most suitable to be expressed by a exponential function. The relationships between ML and BW for both the 2019 and 2020 were the best expressed as power functions, except for the relationship between ML and BW for the 2020 males, which were the best expressed by a exponential function. The gonad maturity composition varied between different years, the females were mostly at immature stages (I and II) in 2019 but mature stages (stages III and IV) in 2020, while the males were mostly at stages II and III in 2019 but mature stages (III and IV) in 2020. The age composition and hatching characteristics differed between years, the females ranged from 97—263d and 148—267d, and dominant age groups were 171—200d and 231—260d with hatching dates from June to December and May to October, and peaked in August-September and July-August, respectively. The males age ranged from 131—253d and 133—221d, with a dominant age 171—200d for both years, and the hatching dates were from August to December and September to December, and the peak periods were September-November and October-November, respectively. This study shows that the fisheries biology of Sthenoteuthis oualaniensisthe in the northwest Indian Ocean varies from climate year to climate.
CHANGES IN CAROTENOID COMPOSITION AND ANTIOXIDANT CAPACITY OF PORTUNUS TRITUBERCULATUS DURING OVARIAN DEVELOPMENT
SUN Qiu-Feng, LIU Mei-Mei, HE Jie, ZHANG Min, TAO Xian-Ji, WU Xu-Gan
 Available online  , doi: 10.7541/2023.2022.0152 doi: 10.7541/2023.2022.0152
[Abstract](431) [FullText HTML] (478) [PDF 1021KB](2)
Abstract:
Female P. trituberculatus at different stages of ovarian development (stage I—V) were investigated for their color, carotenoids contents, antioxidant and non-specific immune parameters. The results indicated that: (1) the gonadosomatic index (GSI) increased significantly (P<0.05), while the hepatosomatic index (HSI) rose slightly, then declined gradually. The redness (a*) and yellowness (b*) values in ovaries showed an increasing trend, as did lightness (L*) and b* values in hepatopancreas, but L* values in ovaries showed a decreasing trend. (2) Total carotenoids, astaxanthin, zeaxanthin and β-carotene content in ovaries showed an increasing trend followed by a decreasing trend, with the highest astaxanthin content in stage IV. Astaxanthin content in hepatopancreas was on the rise, while β-carotene was on a significant decline. Regarding the content of carotenoids in different tissues, the epithelium contained the highest amount of astaxanthin. L* values in the ovary and hepatopancreas exhibited a significant negative correlation with total carotenoids, and a* and b* values in the ovary both showed a significant positive correlation with total carotenoids, astaxanthin, luteolin, echinenone and β-carotene. There was no significant correlation between a* values and various carotenoids in hepatopancreas, and b* values only showed a significant positive correlation with astaxanthin. (3) For antioxidant indexes, T-AOC in hepatopancreas showed a significant decrease in stage I—V (P<0.05), while SOD, CAT and GPX showed an "increasing and then decreasing" trend. The T-AOC in hemolymph showed a trend of "high-low-high-low". SOD and GPX showed an increasing trend and then decreasing trend, while CAT and MDA showed a "low-high-low-high" trend. In terms of immune indexes, ACP, ALP and NO in the hepatopancreas showed an overall decreasing trend during ovarian development, while ACP, ALP and Hc in the hemolymph showed an increasing trend in stage I—IV and a slight decrease in stage V. (4) Correlation analysis showed that astaxanthin content in hepatopancreas was significantly negatively correlated with T-AOC, lutein content was significantly positively correlated with GPX (P<0.01), and no significant correlation was found between the other carotenoids content and antioxidant indexes. In conclusion, the increase of total carotenoids, astaxanthin and β-carotene in the ovaries of P. trituberculatus occurred mainly in stage II-IV, while most of the carotenoids in the epithelium showed a significant decreasing trend and only astaxanthin in the hepatopancreas showed an increasing trend.
GROWTH AND BIOENERGETICS OF THE SEA CUCUMBER APOSTICHOPUS JAPONICUS (ECHINODERMATA: HOLOTHUROIDEA) IN RESPONSE TO SEAWATER ACIDIFICATION AND WARMING
QU Liang, XIE Xi, LU Yu-Jie, YANG Xiao-Long, ZHANG An-Guo, WANG Qing-Zhi, YUAN Xiu-Tang
 Available online  , doi: 10.7541/2023.2022.0073 doi: 10.7541/2023.2022.0073
[Abstract](444) [FullText HTML] (482) [PDF 765KB](3)
Abstract:
In recent years, threat to nearshore marine ecosystems and marine organisms caused by seawater acidification and seawater warming are becoming increasingly serious. In order to study the effects of CO2-driven ocean acidification and warming on growth and energy budget of the sea cucumber Apostichopus japonicus, which is a key species in the coastal ecosystem of East Asia, four experimental treatments were set up, namely, control (seawater temperature of the Dalian coast, pCO2 400 µatm), ocean warming (OW, seawater temperature of the Dalian coast plus 3℃, pCO2 400 µatm), ocean acidification (OA, seawater temperature of the Dalian coast, pCO2 1100 µatm) and Ocean acidification and warming (OAW, seawater temperature of the Dalian coast plus 3℃, pCO2 1100 µatm). The result showed that A. japonicus in OW were not significantly affected in contrast to control. However, the specific growth rate (SGR) of A. japonicus in OA was the lowest, which decreased by 0.19 %/d compared with the control treatment, and the body weight Coefficient variations of A. japonicus in OA was the largest. The final body weight and SGR of A. japonicus in OAW showed no significantly difference with those in control, bur ingestion rate and feces production rate were both significantly higher than those in the control. The bioenergetic pattern of A. japonicus in OW and OA did not change significantly compared with that in the control, but it changed significantly in OAW, with the percentage of the FCE being significantly higher than the other three treatments. Our study suggests that seawater acidification inhibited the growth of A. japonicus versus change its energy distribution pattern. The decrease of growth in OA mainly depended on the decrease of food ingestion. The combined effect of seawater acidification and rising temperature may compensate for the negative effect of seawater acidification on growth by changing the energy distribution pattern of A. japonicus.
FISH COMMUNITY STRUCTURE AND ITS RELATIONSHIP WITH ENVIRONMENTAL FACTORS IN JUMA RIVER IN HAIHE RIVER BASIN
WANG Meng, WANG Yin-Xiao, TAN Hui-Min, WANG Min, MU Shu-Mei, Kang Xian-Jiang, CHEN Yong-Xia
 Available online  , doi: 10.7541/2023.2022.0034 doi: 10.7541/2023.2022.0034
[Abstract](557) [FullText HTML] (1397) [PDF 1285KB](24)
Abstract:
In order to understand the fish community structure in Juma River and its relationship with the environmental factors, 15sampling stations in Juma River were surveyed in May, August and October, 2019, August and October, 2020 and May, 2021. A total of 37 fish were collected, belonging to 11 families and 5 orders. Cypriniformes were the most, accounting for 64.86% of the total species captured. Ecologically, the fish community in Juma River is dominated by demersal and omnivores species and there are fewer carnivorous fish. Compared with the historical data, the number of fish species has decreased. Index Relative Importance (IRI) shows that 10species had IRI≥500, Carassius auratus, Pseudorasbora parva, Zacco platypus were the dominant species. C. auratus, P. parva and Micropercops swinhonis were collected in all seasons and all sampling sites. One-way analysis of variance (ANOVA) showed that the number of individuals (N), species (S), Shannon-Wiener diversity index (H') and Margalef richness index (DMa) of the fish community had significant differences between different seasons, Pielou evenness index (J') showed no significant differences. SNK multiple comparison test showed that the number of individuals and species was the highest in May 2019, Shannon-Wiener diversity index (H') and Margalef richness index (DMa)was the highest in August 2019. The numbers of individuals showed significant differences between different altitudes, an average of 143.91 fishes can be collected at sampling station above 500 meters and only 48.19 fishes can be collected at sampling station below 500 meters. Cluster analysis and Non-metric Multidimensional Scaling (NMDS) divides the source of the Juma River and the Diaojianghui into group Ⅰ, the Zijingguan Bridge and Qingliangjian into group Ⅱ, remaining sites are divided into group Ⅲ. The abundance biomass comparison curve (ABC) showed that the fish community was undisturbed only in August 2020 and was moderately disturbed in the remaining months. Redundancy analysis (RDA) showed that altitude, chlorophyll a, and temperature were the main environmental factors affecting the fish community in Juma River. Altitude is the environmental factor that greatestly affects the structure of fish communities in the Juma River, it has a great influence on Triplophysa cuneicephala, Triplophysa dalaica and Rhynchocypris oxycephalus. Chlorophyll a was highly correlated with the density of phytoplankton and it has a great influence on Micropercops swinhonis, Zacco platypus and other omnivorous fish.
RESPONSE OF PERIPHYTON IN AQUACULTURE WATER TO SULFAMETHOXAZOLE STRESS AND ITS DEGRADATION
ZHANG Xin-Yi, MIN Fen-Li, ZHANG Shu-Xian, ZHANG Hao-Kung, LI Zhu-Xi, PENG Xue, WU Zhen-Bin, LIU Bi-Yun
 Available online  , doi: 10.7541/2023.2022.0171 doi: 10.7541/2023.2022.0171
[Abstract](578) [FullText HTML] (492) [PDF 1263KB](5)
Abstract:
The extensive use and accumulation of sulfamethoxazole (SMX) in the aquaculture contributed to its residues in aquaculture water, which may cause various negative impacts on the aquatic ecological environment. Furthermore, periphyton is a common micro-ecosystem in water bodies composed of autotrophs and heterotrophs, including algae, fungi, bacteria, protozoa, metazoans, extracellular polymers (EPS) and debris, etc. Nevertheless, there is a lack of research on the impact of SMX on the growth and development of periphyton and its purification function in aquaculture water. In this survey, the effect of SMX on periphyton was researched in simulating aquaculture water, and the response of periphyton to SMX was explored through the biomass and total antioxidant capacity of the periphyton. The removal effect and the main degradation intermediates of SMX by periphyton were investigated by high-performance liquid chromatography (HPLC) and ultra-performance liquid chromatography quadrupole-time-of-flight mass spectrometry (UPLC-QTOF-MS). This research demonstrated that under 5 and 10 mg/L SMX, the secretion of extracellular polymer (EPS) of the periphyton increased by 31.3% and 21.5% compared with the control group, and the antioxidant capacity diminished by 20.6% and 31.8%, but there was no significant difference in biomass accumulation. And it showed that SMX decreased the total antioxidant capacity of the mature periphyton, their oxidative systems were damaged, and more extracellular polymers were secreted to enhance tolerance to SMX. The results of the removal experiment indicated that the periphyton would promote the reduction of SMX, and the removal rate of SMX at 1 g/L was 25.10% on the 14th day. It is supposed that SMX was used by periphyton as a carbon source to promote biodegradation and shorten the half-life of SMX degradation. Thus, periphyton had a certain potential for SMX bioremediation in aquaculture water. The main routes of SMX biodegradation by the periphyton are the cleavage and activation of the sulfonamide group (N-S bond) and the amine group (-NH2) on the benzene ring. The primary degradation intermediates were N4-acetyl-SMX, p-Benzoquinoneimine, Desulphone-SMX and Desamino-SMX. Among these degradation products, N4-acetyl-SMX, p-Benzoquinoneimide and Desamino-SMX were fewer toxic than SMX, and Desulphone-SMX was somewhat more toxic than SMX. The research provides theoretical support for assessing the ecological risk of SMX in aquaculture water and the engineering application of periphyton to remove SMX.
DISTRIBUTION CHARACTERISTICS OF MICROPLASTICS IN THE SEDIMENTARY ENVIRONMENT IN ADJACRNT SEA AREAS OF CHANGSHAN ARCHIPELAGO
SUN Xue-Mei, MENG Di, ZHENG Xin-Yan, CHEN Bi-Juan, QU Ke-Ming, XIA Bin
 Available online  , doi: 10.7541/2023.2022.0170 doi: 10.7541/2023.2022.0170
[Abstract](459) [FullText HTML] (481) [PDF 1375KB](5)
Abstract:
As an emerging pollutant, microplastics have spread all over the marine environment. Studies have shown that the marine sedimentary environment is the sink for marine microplastics, The Changshan Archipelago (Changdao) are located at the throat of the Bohai Sea and belong to a typical island ecosystem. In recent years, the coastal area of ​​Long Island has been affected by human factors such as the construction of breeding ponds and port terminals, and the ecological environment is relatively fragile. In this study, the sediments of Changshan Archipelago were collected, and the microplastics in these sediments were analyzed by microscope observation and fourier transform infrared spectroscopy. The results showed that the abundance of microplastics in the Changshan Archipelago sediments ranged from 133.14 to 499.82 N/kg, with an average abundance of 252.59 N/kg. The size of microplastics is mainly <500 μm, accounting for more than 70% of the total number of microplastics; the shape of microplastics is mainly granular, followed by fragments, fibers and small spheres; the color of microplastics is mainly transparent. The polymer type of plastic is mainly cellophane, followed by polyethylene, polyethylene terephthalate, cellulose, etc. Because Changdao is located at the intersection of the Yellow Sea and the Bohai Sea, the overall hydrodynamic exchange capacity is well. Although the water mobility of the southern waters of Changdao is weaker than that of the northern waters, and the southern waters are closer to the rivers entering the sea, and are more affected by the input of land sources, the abundance of microplastics in the sediments of the southern water of Changdao is not significantly higher than that of the northern water. This study provides a scientific basis for the scientific assessment and management of microplastic pollution in the marine ecological environment of Long Island.
FISH BACKGROUND INVESTIGATION AND COMMUNITY STRUCTURE ANALYSIS OF FIVE BACKBONE ARTIFICIAL RIVERS IN SHANGHAI
CHEN Zhen-Feng, TANG Wen-Qiao, ZHAO Zhen-Guan, ZHANG Yan-Yan, GONG Long, TANG Zhen, ZHANG Ya, GUO Hong-Yi, LIU Dong, YANG Jin-Quan
 Available online  , doi: 10.7541/2023.2022.0164 doi: 10.7541/2023.2022.0164
[Abstract](751) [FullText HTML] (619) [PDF 1292KB](9)
Abstract:
In this study, a total of 13379 fish specimens were collected from 20sections using gill nets in June (summer) and November (autumn), 2021 to reveal the fish species resources formed in five backbone artificial rivers of Shanghai Huangpu River in the past half-century. Sixty fish species were identified, belonging to 45 genera, 17 families, and 8 orders, comprising 41species of Cypriniformes belonging to 28 genera and 2 families, 8species of Perciformes belonging to 8 genera and 7 families, 2species of Migratory fish, 8species of estuarine fish, and freshwater species. There were 9 dominant species with IRI≥1000 in total, and Coilia nasus was the dominant species in all 5 rivers. ABC curve demonstrated that except for the Jinhui River, small and medium-sized fishes dominated other rivers, and fish communities were severely disturbed. ΒC index and ΒR index reflected that the Chuanyang River and the Dazhi River in Pudong had the highest difference in fish composition; the difference in fish composition between the Jinhui River and the Longquan River in Punan was the least. The 20sections were divided into three groups; group I ( D1 and Z2sections), group II (the Jinhui River, the Longquan River, and the Dazhi River except for the Z2section), and group III (the Chuanyang River and the Dianpu River except for the D1section). Pseudobrama simony, Coilia nasus, Carassius auratus, and Hemiculter leucisculus were the main diverging species causing the differences in fish community structure among groups. As suggested in the study, more fish species were preserved in these five artificial backbone tributaries than in the headstream, mainstream, and natural tributaries of the Huangpu River, and population density would be a crucial reason for the significant spatial differences in fish community structure in these rivers.
BIOLOGICAL CHARACTERISTICS OF CLUPANODON THRISSA IN PEARL RIVER ESTUARY
ZHANG Cui-Ping, YUAN Li-Mei, WU Yu-Xin, YE Zhi-Quan, CHEN Xiao-Ying, LAI Xing-Xing, LI Qiang, SHU Hu
 Available online  , doi: 10.7541/2023.2022.0036 doi: 10.7541/2023.2022.0036
[Abstract](741) [FullText HTML] (762) [PDF 2464KB](6)
Abstract:
In order to understand the biological characteristics and resource status of Clupanodon thrissa in the Pearl River, a total of 408samples of C. thrissa were collected monthly from October 2020 to September 2021 in Guangzhou section of the Pearl River Estuary. The age composition, growth and reproductive characteristics of C. thrissa were analyzed according to the methods such as biological measurement, age structure analysis and histological observation. The results showed that the average standard length and body weight of females were (173.60±17.10) mm and (92.30±24.37) g, respectively. While the average standard length and body weight of males were (155.94±15.10) mm and (65.81±19.97) g, respectively. The population age was ranged from 0+ to 5+, and the dominant age was 1+—3+, accounting for 89.03 % of the total number of samples. There was power function relationship between standard length and body weight of C. thrissa: W=1×10–5L3.0525 (R2=0.9057), indicating that it was uniform growth pattern. Von Bertalanffy growth equation was used to describe the growth characteristics of C. thrissa with the growth parameters: L=176.14 mm, W=71.70 g, k=0.62, t0=−0.27, φ=4.28, and ti=1.53. The sex ratio (female/male) was 2.28﹕1, and the number of female individuals was significantly higher than that of male. The trend of gonadosomatic index and hepatosomatic index is opposite, indicating that the liver may provide energy for gonad development. It was speculated that the propagation period was from March to July. The absolute fecundity ranged from 1625 to 72882 eggs, with a mean of (20361±2601) eggs, and the relative fecundity ranged from 19 to 602 eggs/g, with a mean of (190±23) eggs/g. The distribution of egg diameter frequency was unimodal, which indicates it was one-time spawning fish. Compared with privious data, the fecundity of C. thrissa showed a decline tendency, so it is necessary to strengthen the protection and utilization of its resources.
DIFFERENT CULTURE MODES ON GROWTH, SERUM BIOCHEMICAL INDEXES AND MUSCLE NUTRIENT OF YOUNG SALMO TRUTTA
WANG Wan-Liang, ZHANG Bian-Bian, TANG Da-Ming
 Available online  , doi: 10.7541/2023.2022.0120 doi: 10.7541/2023.2022.0120
[Abstract](483) [FullText HTML] (480) [PDF 0KB](15)
Abstract:
To explore the diversified culture mode of Salmon trutta, a study was conducted to compare the growth performance, serum biochemical indexes, and muscle nutrient composition between recirculating water and open water culture modes with an initial body mass of juvenile S. trutta (100.05g±1.12 g) for 180 days. The results showed that weight gain rate, fatness, liver body index, specific growth rate, and feed conversion rate were significantly higher in open flow water mode than in recirculating water mode (P<0.05), but there was no significant difference in survival rate between them (P >0.05). Meanwhile, complement C4, total protein, and growth hormone were significantly lower in the circulating water mode than in the open running water mode (P<0.05), but the opposite was true for lysozyme, ghrelin, and glutamate (P<0.05), while complement C3, alkaline phosphatase, acid phosphatase, and globulin were not significantly different between the two modes (P>0.05). In addition, the crude protein and crude fat contents of the main muscle nutrients were higher in the open running water mode than in the circulating water mode, the amino acid composition was not significantly different between the two (P>0.05), and the fatty acid contents of oleic acid, α-linolenic acid, C20:1, C20:2, and MUFA were significantly lower than in the open running water (P<0.05), while the contents of EPA+DHA, SAFA, and PUFA were significantly different (P<0.05). Furthermore, mineral magnesium content was significantly higher in the recycled water model than in the open running water model (P<0.05), calcium content was the opposite (P<0.05), and the differences in zinc, iron, and selenium content were not significant (P>0.05). In conclusion, the circulating water culture mode of S. trutta in Tibet can make full use of the abundant local solar and geothermal resources or rely on the greenhouse for water temperature control, while further optimizing the micro-ecological purification capacity of the water body to make its growth conditions more similar to the open water culture environment, thus improving the efficiency of S. trutta culture and ensuring the nutritional quality.
SUSTAINED SWIMMING ON THE ENDURANCE TIME AND PHYSIOLOGICAL METABOLISM OF ACANTHOPAGRUS SCHLEGELI AND SCIAENOPS OCELLATUS
CHAI Ruo-Yu, YIN Heng, HUO Run-Ming, WANG Han-Ying, HUANG Ling, WANG Ping
 Available online  , doi: 10.7541/2023.2022.0186 doi: 10.7541/2023.2022.0186
[Abstract](562) [FullText HTML] (539) [PDF 1232KB](4)
Abstract:
It has become possible to set up deep-water cages in the open ocean in response to the further development of the marine aquaculture industry. In these conditions, fish encounter strong currents and waves, and ensuring their wellness becomes a crucial part of the farming process, so studying the endurance of farmed fish species is necessary. However, there are few studies on the ability of fish to swim continuously in constant current mode. Breeding of black snapper and American redfish is currently expanding into more open waters, so its endurance swimming ability needs to be assessed to ensure farmed yields and fish farming welfare. At 20°C, we tested the endurance swimming ability of two fish with no significant differences in body length (P>0.05). First, determine the endurance swimming time at different flow rates, and then choose the speed when the endurance swimming time is 150min to carry out the endurance swimming experiment. Black snapper and American redfish were tested for 0, 30 minutes, 60 minutes, 90 minutes, 120 minutes, and 150 minutes at constant swimming speeds of 3.15 and 4.32 BL/s, respectively. Measure the concentrations of metabolites in the muscle, blood, and liver of the fish at six-time points, ensuring that each time point produces three sets of valid data. At 0 and 150 minutes, the concentrations of fish liver glycogen, back muscle lactic acid, and blood glucose were significantly different between the experimental groups (P<0.05), but the concentrations of muscle glycogen was not (P>0.05). A bivariate correlation analysis revealed that liver glycogen concentration decreased and dorsal muscle lactate and blood glucose increased with increasing fatigue. Gray-scale correlation analysis and principal component analysis showed that blood glucose and liver glycogen concentrations were the main factors affecting fatigue. However, the concentration range of black sea bream was larger than that of American redfish. Our experimental results concluded that: (1) American redfish have stronger swimming abilities than black snapper, and black snapper and American redfish are unsuitable for culture at flow rates exceeding 3.15 and 4.32 BL/s, respectively. (2) Liver glycogen concentration limits the endurance swimming ability of both fishes, and the results also provide a reference for the study on swimming and metabolism in other fishes.
FASTING AND REFEEDING ON THE EXPRESSION OF CHOLECYSTOKININ AND ITS RECEPTOR GENE IN LARGEMOUTH BASS
SHAO Jia-Qi, LI Sheng-Jie, DU Jin-Xing, DONG Chuan-Ju, LEI Cai-Xia, SONG Hong-Mei, JIANG Peng
 Available online  , doi: 10.7541/2023.2022.0175 doi: 10.7541/2023.2022.0175
[Abstract](492) [FullText HTML] (538) [PDF 1069KB](5)
Abstract:
CCK as brain-gut peptide, binds to its receptor (CCKR) and participates in physiological processes such as feeding and digestion in animals. In order to study the function of CCKs and CCKRs in largemouth bass (Micropterus salmoides) in feeding activities, the coding sequences of CCK1, CCK2, CCK1R and CCK2R were cloned in this study. Their lengths were 414, 387, 1368 and 1359 bp, and their encodes were 137, 128, 455 and 452 amino acids, respectively. Fluorescence quantitative results showed that both CCK1 and CCK2 were highly expressed in brain, followed by intestinal, while CCK1R and CCK2R were highly expressed in gallbladder and brain, respectively. Within 24h after ingestion, the relative expressions of CCK1, CCK2, CCK1R and CCK2R increased first and then decreased. The relative expression of CCK1, CCK1R and CCK2R reached the highest value at 3h after ingestion, while the relative expression of CCK2 was at 12h after ingestion. The relative expression reached the highest value (P<0.05). During fasting, the relative expression of CCK1, CCK1R and CCK2R was significantly increased on the 14th day of fasting (P<0.05). The relative expression trends of CCK1, CCK1R and CCK2R after refeeding were similar to those after meals, showing a trend of first increasing and then decreasing. However, there was no significant change in the relative expression of CCK2 during fasting and refeeding. In conclusion, the results of this study indicated that CCK1 can be combined with CCK1R and CCK2R to act as a satiety signal factor to regulate physiological processes such as feeding and digestion of largemouth bass by suppressing appetite; and CCK2 may act as a short-term appetite factor to regulate feeding. Activity. The results of this study can provide a theoretical basis for the regulation of feeding activities of largemouth bass.
GROWTH DIFFERENCES BETWEEN HYDRILLA VERTICILLATA AND MYRIOPHYLLUM SPICATUM AND THE EFFECTS ON WATER ENVIRONMENT IN NEWLY BUILT WATER SUPPLY LAKES IN CHANGSHU CITY
LI Shi-Qi, SHI Xue-Feng, LI Jun-Feng, MAI Zhan, GUO Chao, CHU Ji-Yang, DI Chun-Hua, LI Wei, LIU Jia-Shou
 Available online  , doi: 10.7541/2023.2022.0100 doi: 10.7541/2023.2022.0100
[Abstract](552) [FullText HTML] (556) [PDF 1390KB](8)
Abstract:
In order to explore the effect of submerged plant community construction on the water environment of newly built water supply lakes, a comparative study was conducted on the growth of Hydrilla verticillata and Myriophyllum spicatum under artificial planting conditions and their effects on water quality and chlorophyll-a in the newly built emergency water supply lake from May to November 2019 in Changshu City, Jiangsu Province, China. The results showed that the two kinds of submerged plants could grow normally in the experimental lake, and their biomass showed an upward trend from May to September, but H. verticillata was in a rapid growth period from May to July, while M. spicatum was in a rapid growth period from July to September. The decay period of H. verticillata was earlier than that of M. spicatum, and the decay process was shorter. In November, H. verticillata withered completely, while M. spicatum was still in the middle stage of decay. The concentration of Chl.a can be effectively reduced during growth period of two submerged plants, inhibiting phytoplankton growth, while the results are opposite during the period of decline in Autumn. The comprehensive membership function value calculated by TP, TN, CODMn, Chl.a, DO and SD showed that the water quality of submerged plants group was better than that of the control group during the period of vigorous growth, while deteriorating during decline period. Pearson analysis showed that the biomass of H. verticillata had a significantly negative correlation with Chl.a, and the biomass of H. verticillata and M. spicatum had a significantly negative correlation with TP. This study can provide theoretical support for selecting, planting and harvesting of submerged plants during lake restoration in the middle and lower Yangtze River Basin.
CHARACTERISTICS OF PHYTOPLANKTON COMMUNITY STRUCTURE IN NEWLY-BUILT RESERVOIRS IN MOUNTAINOUS AREA GUIZHOU PROVINCE
ZHANG Chao-Shuo, LUO Bin, ZHOU Xian-Jun, LI Wei, LI Zhong-Jie, LIU Jia-Shou, YU Gong-Liang, DUAN Ming
 Available online  , doi: 10.7541/2023.2022.0108 doi: 10.7541/2023.2022.0108
[Abstract](562) [FullText HTML] (513) [PDF 1141KB](11)
Abstract:
Phytoplankton, as an important primary producer in aquatic ecosystem, is very sensitive to the changes of water nutrient status and environment. At the initial stage of operation of the new reservoir, the changes of hydrological situation may improve the interception ability of the water body to exogenous pollutants, which easily leads to abnormal phytoplankton reproduction and even blooms. Therefore, the study on the characteristics of phytoplankton community during this period is helpful to understand the succession trend of phytoplankton community in the reservoir and provide reference for the management. Guanyinyan Reservoir and Wanying Reservoir in Liupanshui city, Guizhou Province, were newly built in 2018 and 2017, respectively. Based on field investigation, this paper studied the phytoplankton community structure and its relationship with environmental factors in the two reservoirs. A quarterly survey was conducted on both reservoirs, and the results showed that diatoms and green algae dominated the phytoplankton in both reservoirs. A total of 32species of phytoplankton were detected in Guanyinyan reservoir, among which diatoms and chlorophyta accounted for 31.3% and 28.1%, respectively. The average annual density of phytoplankton was 3.46×106 cells/L. The total species of phytoplankton was 28 in Wanying reservoir, diatoms and chlorophyta accounted for 35.7% and 39.3%, respectively. The average annual density of phytoplankton was 4.79×106 cells/L. According to the results of redundancy analysis (RDA), water temperature, total phosphorus and transparency were the main environmental factors affecting the changes of phytoplankton communities in the two reservoirs. In general, the newly built reservoirs in this study have a low risk of algal eruption in the early stage of operation. In subsequent management, attention should be paid to the influence of temperature, exogenous nutrition and seasonal changes on phytoplankton density.
TEMPORAL AND SPATIAL VARIATION CHARACTERISTICS AND DRIVING FACTORS OF BACTERIAL COMMUNITY STRUCTURE IN BAO’AN LAKE
XUE Lu, XIANG Dong-Fang, XIAN Bo, BAO Shao-Pan, TANG Wei, LUO Shuai, XIONG Jie, FANG Tao
 Available online  , doi: 10.7541/2023.2022.0112 doi: 10.7541/2023.2022.0112
[Abstract](573) [FullText HTML] (719) [PDF 6600KB](18)
Abstract:
To explore the temporal and spatial variation characteristics and driving factors of bacterial community structure in Bao’an Lake, water samples were collected in spring, summer, autumn and winter of 2019 in Bao’an Lake, and the composition and diversity of bacterial community in surface water of Bao’an Lake were studied using metagenomic sequencing. The results showed that: (1) There was no significant difference in bacterial community structure among different lake areas. The Richness index, Pielou index, Shannon index and Simpson index in summer and autumn were significantly higher than those in spring and winter (P<0.05). The dominant phyla in summer and autumn were Proteobacteria, Actinobacteria and Cyanobacteria, while in spring and winter, the dominant plyla were Proteobacteria and Actinobacteria; (2) Temperature, transparency, pH, dissolved oxygen, CODMn, Chl.a, and total phosphorus were main driving factors accounting for the temporal and spatial of bacterial community structure in Bao’an Lake; (3) The assembly process of bacterial community in Bao’an Lake was dominated by stochastic process in spring, summer and autumn, while deterministic process dominated in winter; (4) The bacterial network interactions in Bao’an Lake had obvious seasonal characteristics: the bacterial interspecific interaction in Bao’an Lake was becoming closer and more complex from spring to winter. In conclusion, the seasonal variation characteristics of the bacterial community structure of Bao’an lake is obvious, and the factors such as temperature, transparency, pH, dissolved oxygen and CODMn have the potential to shape the bacterial community structure. This study provides the basis for understanding the spatial-temporal characteristics of bacterial community and driving factors in freshwater lakes.
VISUAL DETECTION OF POLY-L-LYSINE ON THE COVER GLASS
LIU Tao, ZHOU Fang, YE Ding
 Available online  , doi: 10.7541/2023.2022.0185 doi: 10.7541/2023.2022.0185
[Abstract](640) [FullText HTML] (567) [PDF 1169KB](11)
Abstract:
Poly-L-Lysine (PLL) with a molecular weight of 150000-300000 is often used in cell culture and histology to promote cell or tissue adhesion. After treating the cover glass with 0.05—0.1% PLL solution, PLL adhered to the surface of the cover glass to form a monolayer. The density of the PLL directly affects the adhesion effect of the cover glass. However, because PLL is colorless and transparent, it is difficult to distinguish the PLL density and distribution on the surface of PLL-treated cover glass with the naked eye, so it is crucial to establish a simple and effective PLL detection method. However, there are still no relevant methods reported worldwide. In this study, a laboratory visual and quanitative detection method of PLL was developed. In this method, the fluorescein isothiocyanate (FITC) is added to the side chain amino group (-NH2) of the PLL on the surface of the cover glass in sodium bicarbonate solution, and fluorescence imaging is applied to detect the FITC-PLL.In this study, we firstly coated cover glass of 0.1% PLL of three different brands (S, M and A), and found that only the brand S PLL-coated cover glass still had intact tissue section after several washes with phosphate buffer. Accordingly, we found that the FITC-PLL of brand S on the cover glass was bright and uniform, while both the FITC-PLL of brand M and A were dim (3.4% for M, and 4.5% for A compared with S). Therefore, this method is suitable for the quality control of the homemade or commercial PLL-coated cover glass. Furthermore, the method also provides a reference for the establishment of a visual and quantitative detection method of material with a -NH2 group attached to glass or plastic surface.
RESPONSE OF CYANOBACTERIA WITH DIFFERENT INORGANIC CARBON TRANSPORT GENOTYPES TO ENVIRONMENTAL CO2 CHANGES
ZENG Jia-Ying, JIANG Jing-Yu, ZUO Jun, LI Shu-Xin, ZHANG Si-Long, SONG Li-Rong, GAN Nan-Qin
 Available online  , doi: 10.7541/2023.2022.0078 doi: 10.7541/2023.2022.0078
[Abstract](505) [FullText HTML] (721) [PDF 1371KB](8)
Abstract:
The continuous rise of atmospheric CO2 concentration will alter the physiological and ecological response in cyanobacteria. The CO2 concentration mechanism (CCM) of cyanobacteria is one of the important competitive advantages in the formation of water bloom. Different transport systems in the CCM of cyanobacteria have different characteristics. For example, bicA is a bicarbonate transporter with high throughput and low affinity, while sbtA with high affinity but low throughput. In order to explore the relationship between different inorganic carbon (Ci) transport genotypes of cyanobacteria and pH changes in lake water, this paper optimized the detection protocol of the relative abundance of cyanobacteria with different inorganic carbon transport genotypes in water. We measured the relative abundance of various cyanobacteria species with different Ci transport genotypes in Taihu Lake, Dianchi Lake and 18 lakes in Wuhan, and combined with the pH value in the water body to analyze the response of different Microcystis genotypes to CO2 changes. It was showed that bicA strains, sbtA strains and bicA+sbtA strains all exist simultaneously in the sampled lakes, and the sbtA strains was the most widely distributed. With the increase of pH in water, the dominance of sbtA strains increased. In order to further analyze the response mechanism of different Ci transport genotypes of cyanobacteria to the change of CO2 concentration, we studied the competition of bicA strains, sbtA strains and bicA+sbtA strains under high concentration (1000 ppm) and low concentration (100 ppm) carbon dioxide respectively. The results showed that sbtA strains had obvious competitive advantage at low Ci level, while bicA strains occupied a dominant position at high Ci level. Our study showed that with the increase of CO2 concentration, bicA strains in cyanobacteria bloom would have a competitive advantage. Therefore, we predict that the increase of atmospheric CO2 concentration will affect the community composition of bloom cyanobacteria.
TETRAPLOID INDUCTION OF THE PACIFIC OYSTER “HAIDA NO. 3” USING CYTOCHALASIN B AND LOW SALINITY
ZHOU Jian-Min, JIANG Gao-Wei, XU Cheng-Xun, LI Yong-Guo, LI Qi
 Available online  , doi: 10.7541/2023.2022.0044 doi: 10.7541/2023.2022.0044
[Abstract](1292) [FullText HTML] (644) [PDF 1060KB](12)
Abstract:
To investigate the optimal conditions for the tetraploid induction of the Pacific oyster Crassostrea gigas “Haida No. 3” by cytochalasin B (CB) and low salinity, the effects of CB concentration (0.2, 0.4, 0.6 and 0.8 mg/L), low salinity (6, 8, 10 and 12) and induction duration (10, 15, 20 and 25min) on the cleavage rate, hatching rate, tetraploid rate and the efficiency of tetraploid induction were estimated by inhibiting the first polar body of fertilized eggs. At the same time, the growth and survival of the larvae were analyzed. The results showed that the maximum point of tetraploid rate (65.69±2.47)% and the efficiency of tetraploid induction was found at CB concentration of 0.6 mg/L and induction duration of 15min. In low-salt induction, the maximum point of tetraploid rate (38.77±2.69)% and the efficiency of tetraploid induction was found at salinity of 8 and induction duration of 15min. The shell height of CB and low-salt treatment groups were larger at the early stage and smaller at the later stage compared with the control group. The shell height of the CB treatment group was significantly greater than the low-salt treatment group (P<0.05), and the mean daily growth of larvae in the CB and the low-salt treatment groups was (14.2±1.08 μm/d) and (10.49±0.60 μm/d), respectively, which were smaller than the control group (15.43±1.08 μm/d). The survival rate of the two induction treatment groups was consistently lower than the control group, and the survival rate of the low-salt treatment group was higher at the early stage and lower at the late stage compared with the CB treatment group. In general, the CB induction method showed better results in terms of tetraploid rate, the efficiency of tetraploid induction, 12-day survival rate and growth rate, and has better applicability for the tetraploid induction of the Pacific oyster “Haida No.3”.
MAJOR PREDATORS AND PREDATION PRESSURE OF FIVE KEYSTONE PREY SPECIES IN HAIZHOU BAY
GAO Ming-Wei, LIU Shu-De, XU Cong-Jun, XU Bin-Duo, ZHANG Chong-Liang, JI Yu-Peng, REN Yi-Ping, XUE Ying
 Available online  , doi: 10.7541/2023.2022.0020 doi: 10.7541/2023.2022.0020
[Abstract](923) [FullText HTML] (688) [PDF 1726KB](5)
Abstract:
This study aims to understand the fluctuation of predation pressure and natural mortality of keystone prey species in the food web of Haizhou Bay. Keystone prey species play a crucial role in the energy flow and material transference in the marine food webs. Researches on the importance of keystone prey species in the food web can provide a scientific basis for the restoration of ecosystem and conservation of fishery resources. Based on the bottom trawl survey data in Haizhou Bay and stomach contents analysis, the predation pressure index (PPI) of five keystone prey species (including Leptochela gracilis, Alpheus japonicus, Loligo sp., Larimichthys polyactis and Oratosquilla oratoria) were used to analyze the major predators of these prey species and their predation pressure. Results showed that the PPI of Chelidonichthys kumu to L. gracilis and Loligo sp. was the highest, being 168.89 and 75.77, respectively. The PPI of Miichthys miiuy to A. japonicus and O. oratoria was the highest, being 39.41 and 9.85, respectively. The PPI of Saurida elongata to L. polyactis was the highest (109.65). Anova showed that there was no significant difference in PPI in different years (P>0.05), and there were significant differences among predators (P<0.05). The natural mortality coefficient varied with the fluctuation of predation pressure index. There were differences in the feeding habits of these predators, which will help to reduce the food competition among them and benefit the ecosystem stability. Trophic interactions between species are instrumental in maintaining the stability of ecosystems. These keystone prey species play a vital part in the food web and can directly affect the structure and function of ecosystems, providing energy for the high trophic level predators and contributing to the energy flow and material circulation in the food web. Based on the findings of the present study, It is suggested to strengthen the research in the field of keystone prey species, explore the relationship between species, and analyze in-depth the ecological function and regulation mechanism of keystone prey species. This is pivotal in maintaining ecosystem stability and species diversity and developing ecosystem-based fishery management strategies.
COMPARATIVE STUDY ON REPRODUCTIVE BIOLOGY OF TWO CO-INVASION TILAPIA SPECIES IN THE SHANMEI RESERVOIR
LI Jun-Feng, WANG Jiang-Bin, LIU Zhi-Yang, LIU Qiao, GUO Chao, LIAO Chuan-Song, LI Wei, GUO Chuan-Bo, ZHANG Tang-Lin, LIU Jia-Shou
 Available online  , doi: 10.7541/2023.2022.0089 doi: 10.7541/2023.2022.0089
[Abstract](843) [FullText HTML] (758) [PDF 4055KB](13)
Abstract:
The redbelly tilapia Coptodon zillii and the mango tilapia Sarotherodon galilaeus are two invasive fish species in the Shanmei Reservoir, which have become dominant species of the fish community in the reservoir. In order to compare their reproductive traits for developing invasive control measures for the two tilapia species, we monthly sampled fishes from March to October 2021 in the Shanmei Reservoir, and analyzed their reproductive time, sex ratio, absolute fecundity, relative fecundity and egg size. We also analyzed the reasons for their stable coexistence after co-invasion through the reproductive biology of two species of tilapia. Results showed that both populations started to spawn in April, but the spawning activity was peaked at July and June, and ended at October and September for C. zillii and S. galilaeus, respectively. The absolute fecundity of C. zillii was (4009.85±1305.69) eggs, the body weight relative fecundity was (67.32±15.63) eggs/g, and the body length relative fecundity was (31.31±5.03) eggs/mm for C. zillii, which were significantly higher than those of S. galilaeus [(1701.85±591.29) eggs, (6.46±0.87) eggs/g, and (8.22±2.33) eggs/mm]. However, the mature egg size of C. zillii was significantly smaller than that of S. galilaeus. The sex ratios (female/male) of C. zillii (1.59) and S. galilaeus (1.83) showed non-significantly difference and females outnumbered males in these two species but both ratios were significantly biased with 1﹕1. This study suggested that the two co-invasive tilapia exhibit different reproductive strategies, which should be key factors explaining their dominant abundance and stable coexistence after successful co-invasion. This study can provide implications for the management of the two co-invasive tilapia populations, which contribute to the sustainable development of fisheries resources management in the Shanmei Reservoir.
HIGH DIETARY DOSES OF ORGANIC AND INORGANIC SELENIUM ON GROWTH PERFORMANCE, TISSUE SELENIUM ACCUMULATION AND BLOOD BIOCHEMICAL PARAMETERS OF GIBEL CARP (CARASSIUS AURATUS GIBELIO VAR. CAS V)
LI Yuan-Ze, LIU Hao-Kun, GONG Yu-Long, GAO Wei-Ye, ZHU Xiao-Ming, HAN Dong, YANG Yun-Xia, JIN Jun-Yan, XIE Shou-Qi,
 Available online  
[Abstract](890) [FullText HTML] (680) [PDF 1075KB](18)
Abstract:
To investigate the effects of high doses of organic and inorganic selenium in feed on the growth performance, selenium accumulation and plasma biochemical parameters of gibel carp, organic selenium and inorganic selenium were used as different types of selenium sources, and gibel carp with an initial body weight of 62.95±0.23 g was used for a 90d feeding experiment. The results indicated that the addition of 0, 10 and 20 mg/kg organic and inorganic selenium to the feed did not have a significant effect on the survival rate and the digestibility of the dry matter. Moreover, the addition of organic selenium significantly increased the selenium digestibility of the organic selenium treatment group (P<0.05), while the addition of inorganic selenium to the feed had no significant effect on the selenium digestibility (P>0.05). The addition of organic selenium to the feed increased the growth of gibel carp (P<0.05), reaching the highest level in the 20 mg/kg treatment group (P<0.05). The addition of inorganic selenium to the feed significantly reduced the specific growth rate of the gibel carp (P<0.05), and there was no significant difference in the specific growth rate between the 10 mg/kg inorganic selenium treatment group and the control group (P>0.05). The addition of organic selenium to the feed did not have any significant effect on the hepatosomatic index of gibel carp, while the addition of 10 mg/kg inorganic selenium significantly reduced the hepatosomatic index (P<0.05). The addition of organic and inorganic selenium to the feed did not have any significant effect on the renosomatic index of gibel carp. The addition of both organic and inorganic selenium significantly increased the selenium content of whole fish, liver, kidney, muscle, bone and gonads, and the organic selenium addition group had significantly higher selenium content in bone, muscle, gonads and whole fish than the inorganic selenium addition group (P<0.05). The addition of organic selenium and inorganic selenium to the diet significantly increased the plasma glucose content, decreased the total plasma bilirubin content and reduced the activity of glutamate and ghrelin (P<0.05), and the addition of 20 mg/kg organic selenium and 10 mg/kg inorganic selenium to the diet significantly reduced the plasma iron ion content (P<0.05). The results showed that the high levels of organic and inorganic selenium in the feed were well tolerated by the gibel carp and that the high levels of organic selenium in the feed had no toxic effect on the gibel carp after 90 d of the feeding trial, which showed a boost in growth performance and a high level of bioaccumulation in various tissues.
THE INFLUENCE OF STOCKING DENSITY ON THE GROWTH, BLOOD BIOCHEMISTRY, AND ANTIOXIDANT CAPACITY INDICATORS OF CHINESE PERCH (SINIPERCA CHUATSI)
LU Ke, ZHANG Yan-Peng, LIANG Xu-Fang, TANG Shu-Lin
 Available online  , doi: 10.7541/2022.2021.0395 doi: 10.7541/2022.2021.0395
[Abstract](1366) [FullText HTML] (584) [PDF 967KB](11)
Abstract:
The present study was to explore the influence of stocking density on the growth, blood biochemistry, and antioxidant capacity indicators of Chinese perch (Siniperca chuatsi) cultured in the bank (60×60×40 cm) based recirculating systems for 40d. Fish (average weight 175.76±15.85 g) were reared in triplicate under five densities: extra-low stocking density (ELD; 3.34 kg/m3); low stocking density (LD; 9.51 kg/m3); medium stocking density (MD; 15.82 kg/m3); high stocking density (HD; 21.05 kg/m3) and extra-high stocking density (EHD; 25.99 kg/m3). After 40 days, growth performance, biochemical parameters, appetite-related genes expression and stress indicators of fish were evaluated. The results showed that the ELD and LD groups showed better productive performance for weight gain (WG) and feed conversion ratio (FCR) (P<0.05), and increased plasma superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GSH-Px) activities, and decreased the formation of malondialdehyde (MDA) (P<0.05). Additionally, the EHD group performed higher glucose levels, cholesterol levels and lower triglyceride levels in plasma (P<0.05). The mRNA expression of agouti gene-related protein (agrp) was riesd in LD group, whereas gene expressions of pro-opiomelanocortin (pomc) resulted in a down-regulation in ELD group. In sum, the suitable stocking density for culturing Chinese perch in recirculating systems is recommended to be between 3.34 and 9.51 kg/m3. It is of great significance to select the best stocking density for improving the economic benefit of fish culture.
IDENTIFICATION OF HC-GSK3Β GENE AND SCREENING OF SNPS RELATED TO INNER SHELL COLOR OF HYRIOPSIS CUMINGII
GUO Bai-Ying, LI Xing, WANG He, YAN Ling, LU Gao-Lun, BAI Zhi-Yi
 Available online  , doi: 10.7541/2023.2022.0107 doi: 10.7541/2023.2022.0107
[Abstract](667) [FullText HTML] (601) [PDF 1708KB](2)
Abstract:
Melanin is an important factor for the formation of purple shells and pearls of Hyriopsis cumingii. Glycogen synthesis kinase-3β (GSK3β) is a key gene of animal melanin synthesis pathway. In order to explore the effect of Hc-GSK3β gene on shell color of H. cumingii, the full-length cDNA of Hc-GSK3β gene of 1867 bp was successfully cloned by RACE technology, including the ORF region of 1261 bp encoding 420 amino acids. The ORF contained a S_TKc domain, whose sequence is highly conserved. Tissue expression(qRT-PCR)analysis showed that the expression of Hc-GSK3β gene in purple mussel was significantly higher than that of white mussel in gill, foot, hepatopancreas and fringe mantle tissues (P<0.05), and the expression existed extremely significant difference in foot and fringe mantle tissues (P<0.01). The expression in the adductor muscle tissue of purple mussel was significantly lower than that of white mussel (P<0.05). The results of in situ hybridization (ISH) showed that positive signals appeared in the outer fold, middle fold, inner fold, dorsal mantle area and ventral mantle area of H. cumingii, and the signal expression in the outer fold was stronger. 6 SNPs locus were identified by re-sequencing and comparison. The distribution frequencyof genotype CA at C+185A locus was significantly higher in purple mussels than that of white mussels (P<0.05). At the T+341G locus, the value of color parameter b of the genotype TT was significantly lower than genotype TG (P<0.05). The study showed that Hc-GSK3β gene was involved in shell color formation of H. cumingii, and SNP markers could be used for the shell color breeding of H. cumingii.
A PILOT STUDY ON SPECIES IDENTIFICATION OF BRYDE’S WHALES INHABITING IN THE WEIZHOU ISLAND WATERS, BEIBU GULF
HE Rui-Lin, CHEN Mo, ZHANG Yao-Yao, MEI Zhi-Gang, FAN Fei, WANG Ding, ZHENG Jin-Song
 Available online  , doi: 10.7541/2023.2022.0105 doi: 10.7541/2023.2022.0105
[Abstract](897) [FullText HTML] (751) [PDF 1337KB](6)
Abstract:
The Bryde’s whale is a medium sized baleen whale that is widely distributed in the tropical and subtropical waters. However, the taxonomy of the Bryde’s whale has long been controversial. Currently, both the IUCN (the International Union for Conservation of Nature and Natural Resources), and the IWC (the International Whaling Commission) assign the whale as two subspecies, Balaenoptera edeni edeni and B. e. brydei. Although, several studies indicate that they should be regarded as two separate species, B. e. edeni and B. e. brydei are so similar in their external morphology, and are sometimes sympatric, which make it is difficult to correctly identify them in the field just through observation. Therefore, accurate species delimitation usually requires molecular methods. Recently, a Bryde’s whale population was reported inhabiting in the Weizhou Island waters, Beibu Gulf. However, it is unclear which species these animals belong to. In this study, we collected two fecal samples from two individuals in this population, and tried to identify them using molecular methods. Genomic DNA was extracted from one of the two fecal samples. Fragments of the mitochondrial genes Cyt b and COⅠ were PCR amplified and sequenced. Based on the mitochondrial gene sequences, the whale was identified as B. e. edeni. In addition, a baleen whale that died in 2019 in the same waters was also identified as B. e. edeni using the same methods outline in this study. Thus, we infer that the population living in the Weizhou Island waters is B. e. edeni. This is the first study which successfully identified a living Bryde’s whale based on mitochondrial DNA present in fecal samples. This non-invasive sampling-based species identification method should be further developed and applied in the future. Additional studies, such as population genetics should be carried out to provide a scientific basis for the conservation of this Bryde’s whale population.
INFLUENCE OF ASSISTED FILTRATION PRETREATMENT ON MEMBRANE FOULING DURING THE TREATMENT OF ALGAE-RICH WATER BY MICROFILTRATION
ZHANG Shi, MA Fang-kai, XU Wang-peng, WANG Jian, LI Ying-xi, WU Zhen-bin, ZHANG Xue-zhi
 Available online  , doi: 10.7541/2023.2022.0056 doi: 10.7541/2023.2022.0056
[Abstract](773) [FullText HTML] (667) [PDF 2294KB](4)
Abstract:
Membrane filtration technology has the advantages of well algae-water separation and sewage purification during the treatment of algae-rich water. Different pretreatment methods can affect the filtration characteristics and membrane fouling. In this study, three different pretreatment methods of diatomite, cotton plant and activated carbon were employed to filter Microcystis aeruginosa suspensions to compare their filtration characteristics, retention of algogenic organic matter and membrane fouling. The results revealed that the three pretreatment methods increased filtration flux and reduced membrane fouling. Among them, the diatomite pretreatment could increase the filtration flux by 915%, which was significantly better than other pretreatment. Activated carbon pretreatment could effectively adsorb aromatic protein-like compounds, and obviously decrease the resistance of irreversible chemical fouling. OCT and SEM analysis showed that no pretreatment caused the most serious membrane fouling, the lowest roughness and thickness of cake layer structure, while diatomite pretreatment could obviously mitigate membrane fouling by optimizing the cake layer structure. Meanwhile, the XDLVO theoretical results further confirmed that diatomite pretreatment had the best alleviating effect on membrane fouling. For further insight, the results provide valuable guidance for the development of membrane filtration of algae suspensions.
EFFECTS OF DIETARY BILE ACIDS SUPPLEMENTATION ON LIPID METABOLISM IN LIVER OF EUROPEAN EEL (ANGUILLA ANGUILLA) JUVENILES
MA Zhi-Ru, ZHAO Pan-Yue, ZHAI Shao-Wei
 Available online  , doi: 10.7541/2023.2022.0035 doi: 10.7541/2023.2022.0035
[Abstract](775) [FullText HTML] (693) [PDF 1523KB](11)
Abstract:
The present study was conducted to investigate the effects of dietary bile acids (BA) on the lipid metabolism in the liver of European eel (Anguilla anguilla) juveniles. Nine cement tanks stocked with similar fish size (141.5 g/fish) and fish weight (681.7±22.7 kg/tank) were randomly divided into three treatment groups. The trial fish were fed diets with BA levels being 0 (control group), 500 mg/kg (BA1 group), and 1000 mg/kg (BA2 group), respectively. There were three tanks in each treatment group. The trial lasted for 15weeks.Compared with the control group, the numbers of the fat vacuole in hepatocytes of European eel juveniles were decreased in BA1 and BA2 groups. The decreased lipid content in the liver were found in the BA1 and BA2 groups in comparison with the control group (P<0.05). The levels of fatty acid synthetase in the liver were significantly increased in the BA1 and BA2 groups(P<0.05). The acetyl CoA carboxylase level in the liver of the BA1 group was significantly higher than that of the control group (P<0.05). The activities of hepatic lipase, lipoprotein lipase, and total lipase in the liver of BA1 and BA2 groups were significantly higher than those in the control group (P<0.05). There were no significant differences in lipid metabolism enzymes activities or levels in the liver between the BA1 group and BA2 group (P>0.05). The levels of phosphatidylcholine and lysophosphatidylcholine were up-regulated in the liver in European eel juveniles of BA1 group, which might mainly enhance theglycerophospholipid metabolism and glycerolipid metabolism. In conclusion, dietary BA supplementation might decrease lipid accumulation by decreasing the levels of enzymes related to lipid synthesis and increasing the activities of enzymes related to lipid decomposition with mainly up-regulating theglycerophospholipid metabolism and glycerolipid metabolism in the liver of European eel juveniles.
ACUTE HYPOXIA/REOXYGENATION STRESS AFFECT ANTIOXIDANT AND ENERGY METABOLISM OF PROCAMBARUS CLARKII
XU Yu, XU Zhi-Qiang, YAN Wei-Hui, LI Jia-Jia, HUANG Hong-Bing, SUN Meng-Ling, TANG Jian-Qing, PAN Jian-Lin
 Available online  , doi: 10.7541/2022.2021.0390 doi: 10.7541/2022.2021.0390
[Abstract](779) [FullText HTML] (671) [PDF 2320KB](11)
Abstract:
Dissolved oxygen (DO) is vital in aquaculture, which influences the survival and growth of red swamp crayfish, Procambarus clarkii. To reveal the profiles of antioxidant and energy metabolism in response to acute hypoxia/reoxygenation stress, the activity of some key enzymes associated with antioxidant and non-specific immunity were measured and the ultrastructure changes in the hepatopancreas and gill were observed. Experimental crayfish with average body weight of (26.5±1.8) g were subjected to acute hypoxia stress (DO 1.0±0.1 mg/L), followed by reoxygenation (DO 6.8±0.2 mg/L). Hepatopancreas, gill and hemolymph from five groups of crayfish (six crayfish per group), including normoxia, hypoxia for one and six hours, and reoxygenation for one and 12h, were used to measure the changes of antioxidant and non-specific immunity enzymes. Cell ultrastructure of gill and hepatopancreas were also examined by transmission electron microscope. The results showed that the activity of superoxide dismutase (SOD) in hepatopancreas and hemolymph decreased significantly under hypoxia stress (P<0.05), while it increased significantly in hepatopancreas, hemolymph and gill in the reoxygenation stage (P<0.05). The significant increase of SOD activity may be related to the excessive production of superoxide anion (ROS) in the reoxygenation process. The content of malonaldehyde (MDA) in hemolymph and gill tissue was significantly higher than that of the control group (P<0.01), indicating lipid peroxidation occurred in cells under hypoxia/reoxygenation stress. Under hypoxic stress, the activities of acid phosphatase (ACP) and alkaline phosphatase (AKP) in hepatopancreas, gill and hemolymph were both significantly increased (P<0.05), and the activities of ACP in hepatopancreas and gill tissue were significantly decreased after reoxygenation for 12h (P<0.01). These results suggested that hypoxic-reoxygenation stress may affect the immune response of the crayfish. Compared with the control group, lactic dehydrogenase (LDH) content and total ATPase activity in hepatopancreas, hemolymph and gill tissue were significantly increased under acute hypoxic stress (P<0.05), indicating that the energy metabolism function of cells was seriously affected. Observation of mitochondria ultrastructure revealed that the organization structure of gill and hepatopancreas were seriously injured after acute hypoxic/reoxygenation stress. Mitochondrial damage, including mitochondria dissolved into vacuole, mitochondria swelled irregularly and their cristae fractured and become fuzzy. During hypoxia/reoxygenation stress, the number of mitochondria in hepatopancreas cells significantly increased while the number of lysosomes decreased significantly. The results showed that hypoxic-reoxygenation stress can cause great damage to the hepatopancreas and gill of P. clarkii, and affect the activities of antioxidant and non-specific immunity enzymes. Furthermore, the results indicated that hypoxic-reoxygenation stress has great influence on immune defense ability and energy metabolism function of P. clarkii.
EFFECTS OF SELENIUM-RICH CARDAMINE HUPINGSHANENSIS ON GROWTH, BIOCHEMICAL INDICES, SELENIUM METABOLISM, ANTIOXIDANT CAPACITIES AND INNATE IMMUNITIES IN JUVENILE BLACK CARP (MYLOPHARYNGODON PICEUS)
ZHANG Chen, JIA Xiao-Wei, QIAN Peng-Cheng, CHEN Yan-Ting, WU Cheng-Long, YE Jin-Yun
 Available online  , doi: 10.7541/2023.2022.0063 doi: 10.7541/2023.2022.0063
[Abstract](816) [FullText HTML] (814) [PDF 1089KB](10)
Abstract:
In order to investigate the effects of different levels of dietary selenium-rich Cardamine hupingshanensis on the growth performance, physiological and biochemical parameters, selenium metabolism, antioxidant capacities and innate immunities in black carp (Mylopharyngodon piceus), 360 juvenile black carps with initial body weight of (5.51±0.02) g were randomly divided into four groups, and each group had 3 replicates. Four levels of selenium-rich C. hupingshanensis (0, 0.5, 1.0 and 2.0 g/kg) (selenium levels 0.04, 0.43, 0.75 and 1.57 mg/kg) were added and made four isonitrogenous and isoenergetic diets. The culture period was conducted for 60 days. The results showed that adequate selenium-rich C. hupingshanensis (0.5 and 1.0 g/kg) could significantly increase the weight gain (WG) and specific growth rate (SGR), while significantly decrease the feed conversion ratio (FCR), comparing with the control group and the excessive group (2.0 g/kg) (P<0.05). In the fish body composition, the crude protein levels were significantly increased in fish fed with 1.0 g/kg selenium-rich C. hupingshanensis, and then decreased at 2.0 g/kg selenium-rich C. hupingshanensis. Adequate supplemental level of selenium-rich C. hupingshanensis (0.5 and 1.0 g/kg) could significantly increase the serum albumin (ALB), triglycerides (TG) and total cholesterol (TCH), while decrease serum glucose (GLU) levels. Higher activities of superoxide dismutase (SOD), the catalase (CAT) and glutathione peroxidase (GSH-PX), levels of total antioxidant capacities (T-AOC), and the glutathione (GSH) (P<0.05) were shown in the liver of fish fed adequate supplemental level of selenium-rich C. hupingshanensis. Meanwhile, adequate supplemental level of selenium-rich C. hupingshanensis could significantly increase expression level of nuclear factor-erythroid-2-related factor 2 (Nrf2), Mn-superoxide dismutase (Mn-SOD), catalase (CAT), glutathione peroxidase 1 (GPX1) and glutathione peroxidase 4 (GPX4), while decrease the expression level of Kelch-like-ECH-associated protein 1 (Keap1) in the fish liver (P<0.05). In addition, adequate supplemental level of selenium-rich C. hupingshanensis significantly increase expression level of selenium-metabolic proteins, including selenocysteine lyase (SCLY), selenide, water dikinase 1 (SPS1), 15kDa selenoprotein (SEP15), selenoprotein T2 (SEPT2), selenoprotein H (SEPH), selenoprotein P (SEPP) in the liver of juvenile black carp compared with the control group (P<0.05). Furthermore, the expression level of innate immune defense molecules, including liver-expressed antimicrobial peptide 2 (Leap2), hepcidin (HEPC), lysozyme (LYS) and complement 3 (C3) were significantly up-regulated by adequate supplemental level of selenium-rich C. hupingshanensis (P<0.05). In conclusion, these results suggest that the adequate dietary supplemental level of selenium-rich C. hupingshanensis could significantly increase growth performances, promote the selenium metabolism, improve antioxidant capacities and enhance innate immunities in black carp.
EFFECT OF VITAMIN D3 ON POLARIZATION PHENOTYPE OF HEAD KIDNEY MACROPHAGES IN PELTEOBAGRUS FULVIDRACO
WANG Meng, CHENG Ke, MA Chun-Song, WANG Chun-Fang
 Available online  , doi: 10.7541/2023.2022.0037 doi: 10.7541/2023.2022.0037
[Abstract](800) [FullText HTML] (1117) [PDF 1546KB](5)
Abstract:
As a key class of immune cells, macrophages are not only the first line of defense against pathogen invasion, but also play different functions through polarization. Macrophages can secrete pro-inflammatory factors and cause excessive inflammatory response, resulting in a variety of inflammatory diseases when polarizing into M1 type. Macrophages can secrete anti-inflammatory factors and play an anti-inflammatory role when polarizing into M2 type. Macrophages are characterized by phenotypic heterogeneity and functional diversity, and it is important to target macrophage-type polarization through nutritional regulation. Vitamin D3 has been proved to play important role in fish anti-inflammatory response. In this study, the effects of 200pM vitamin D3 on polarization phenotype of head kidney macrophages of Pelteobagrus fulvidraco were studied. The primary macrophage cells of Pelteobagrus fulvidraco head kidney were isolated and cultured. After being challenged by LPS and cAMP to induce macrophage polarization, the cell morphological changes were observed by inverted light microscopy, and the functional changes were studied by measuring survival rate, phagocytosis, reactive oxygen species and nitric oxide production, superoxide anion radical and arginase activity, as well as the related gene expression charactering in different macrophages polarization states. The results showed that vitamin D3 reduced the mortality of M1 and M2 macrophages and enhanced the phagocytic activity of macrophages. In M1 macrophages, vitamin D3 inhibited the production of reactive oxygen species (ROS) and inflammatory mediator nitric oxide (NO), reduced the activity of superoxide anion free radical, and decreased the expression of interleukin-1β (IL-1β) and tumor necrosis factor (TNF-α)(P<0.05). The activity of arginase as well as the expression of interleukin-10 (IL-10) and transforming growth factor (TGF-β) in M2 cells was up-regulated by vitamin D3 (P<0.05). In conclusion, vitamin D3 inhibited the polarization of macrophages to M1 phenotype, promoted the polarization of macrophages to M2 phenotype, and played an anti-inflammatory role. In the current study, Nos-2 and arg-2 were found to be biomarker genes of M1 and M2 macrophages, respectively. These results preliminarily reveal the mechanism of vitamin D3 on the polarization of head kidney macrophages of Pelteobagrus fulvidraco, and favor the regulation of macrophage phenotypes in the treatment of inflammation, which provides useful information for further study on the polarization of fish macrophages and the effect of vitamin D3 on polarization regulation.
MOLECULAR SYSTEMATICS OF XENOCYPRINAE (CYPRINIFORMES, CYPRINIDAE)
LI Lin, CHEN Wei-Tao, YANG Yong-Tao, ZHOU Chuan-Jiang, HE Shun-Ping, FENG Cheng-Guang
 Available online  , doi: 10.7541/2023.2022.0085 doi: 10.7541/2023.2022.0085
[Abstract](966) [FullText HTML] (964) [PDF 1443KB](11)
Abstract:
Xenocypridinae, as one of the benthic fishes of Cyprinidae (Cypriniformes) in East Asia, contains three genera of about nine species and is, therefore, one of the smallest subfamilies in Cyprinidae. Despite the small number of species, the phylogenetic relationships of Xenocypridinae still lack a valid and extensive assessment. To this end, this study assessed the phylogenetic relationships and divergence times between members of the subfamily Xenocypridinae using a variety of phylogenetic approaches based on two mitochondrial genes and five nuclear genes. The results show that analyses based on maximum likelihood and Bayesian approaches harvest consistent topologies, but there are some conflicts in the results based on different datasets. In particular, the monophyly of each of the three genera was well supported in all analyses, but the evolutionary relationships between them were discordant between the results based on mitochondrial and nuclear genes. Analyses based on the coalescent algorithm yielded a third phylogenetic relationship among the genera. These results imply that both ancient gene flow and lineage sorting influenced the relationships between deep clades of the subfamily Xenocypridinae. Additionally, these analyses give insights into the classification of these species, for example, Xenocypris hupeinensis should belong to the genus Xenocypris; the nested relationships among species X. argentea, X. yunnanensis, and X. davidi suggest the possibility of gene flow and the need for taxonomic reconsideration. Finally, a fossil-based molecular clock assessment indicates that the divergence of key Xenocypridinae clades occurred mainly in the late Miocene (ca. 15—­12 Ma), which coincides with the intensification of the Asian monsoon and supports the hypothesis that the ichthyofauna of East Asia was established in the early Pliocene and flourished to date. In summary, this study has systematically assessed the phylogeny of Xenocypridinae and made recommendations for future work.
FEEDING STRATEGIES ON GROWTH AND REPRODUCTION OF YELLOW CATFISH (PELTEOBAGRUS FULVIDRACO)
GAO Wei-Ye, FEI Shu-Zhan, LIU Hao-Kun, HAN Dong, YANG Yun-Xia, JIN Jun-Yan, ZHU Xiao-Ming, ZHANG Zhi-Min, XIE Shou-Qi
 Available online  , doi: 10.7541/2023.2022.0096 doi: 10.7541/2023.2022.0096
[Abstract](1631) [FullText HTML] (802) [PDF 951KB](12)
Abstract:
Most of feeding strategies which maximize the feeding rate are just designed for fish farming but not suitable for broodfish. Overfeeding caused by these feeding strategies will even impair the reproductive performance. However, moderate feed restriction can maintain fecundity while lowering breeding costs. Feeding strategies based on compensatory growth may promote growth and fecundity of broodfish, or make them mature faster. To test the effects on growth and reproductive capacity of female yellow catfish Pelteobagrus fulvidraco, fish were fed with four groups for 67 days: satiety feeding (AS), 80% satiety (80AS), 50% satiety (50AS) and starvation for 35 days and then satiety feeding for 31 days (HAS). Samples were taken at the middle (34 days) and the end of the experiment and various indexes were measured in this time. Results showed that the total food intake of the 80AS, 50AS and AS group roughly conforms to the proportion of the experimental design. The daily food intake of the HAS group was the highest. No significant difference was observed in weight gain rate and final weight between the 80AS group and the AS group. Meanwhile, the final weight of the HAS group was significantly lower than that of AS group, which shows the growth of the HAS group failed to reach those who fed at satiety level in the same period. As the serum lipid and protein concentrations increased in each group, the retention of lipid and protein in gonad increased. It can be inferred that parent fish preferentially transmit nutrition to gonads rather than muscles. There was no significant difference in final egg diameter between the AS group and 80AS group, which were significantly higher than the 50AS group and lower than the HAS group, indicating that the refeeding has a compensatory effect on egg growth. Feeding strategy did not impact absolute fecundity and fecundity, but alterd the expression of genes which related to gonad development. The relative expression of StAR, SF-1, 3β-hsd and cyp19a1 in the 80AS, 50AS and HAS was significantly lower than that in AS group in the middle stage. Nevertheless, no significant difference was found between these group and AS group in the end stage. The trend of plasma estradiol and testosterone was consistent with the above expression of genes, indicating that the synthesis and secretion of sex hormones and gonadal development in 80AS, 50AS and HAS groups were only inhibited by feeding strategy in the early stage. Finally, the inhibition effect was relieved, and the relevant indexes of each group recovered. These may be the result of interaction between the stress response and reproduction of broodfish. Based on the data above, satisfying the material and energy needs of gonadal development has priority in yellow catfish’s resource allocation. Although the growth of HAS group was lower than that of AS group, there was no difference in reproductive ability between HAS group and AS group, indicating that parent Pelteobagrus fulvidraco mainly compensated for fecundity rather than growth after starvation. Therefore, it is necessary to redesign the feeding strategy based on compensatory growth according to the physiological characteristics which need further exploration to improve the fecundity of Pelteobagrus fulvidraco broodfish. The growth and reproduction indexes of 80AS group were not significantly different from those of AS group, and the food intake was significantly lower than that of AS group, which was a more suitable feeding strategy in the breeding period of yellow catfish.
TRANSCTIPTOMIC RESPONSES TO ACUTE LOW TEMPERATURE STRESS IN GIANT FRESHWATER PRAWN MACROBRACHIUM ROSENBERGII
YANG Min-Min, TU Hai-Hui, XING Qian-Qian, TANG Qiong-Ying, YI Shao-Kui, XIA Zheng-Long, CAI Miao-Ying, CHEN Guo-Zhu, LAN Xuan, ZHONG Zhen-Xiao, HUANG Xiao, GAO Quan-Xin, YANG Guo-Liang
 Available online  , doi: 10.7541/2022.2022.0033 doi: 10.7541/2022.2022.0033
[Abstract](878) [FullText HTML] (832) [PDF 1229KB](6)
Abstract:
The giant freshwater prawn (GFP) Macrobrachium rosenbergii is one of the important economically freshwater shrimp species, and its annual production in China is dominant in the world. However, its tolerance to low temperatures is extremely poor, and acute low temperatures can lead to large-scale deaths and cause huge economic losses. In order to explore genes related to the GFP response to acute low temperature, comparative transcriptomic analyses were performed for the hepatopancreas of adult GFPs exposed to low temperature. The low temperature stress group (16℃) and the control group (24℃) were set up. The water temperature of the stress group was decreased from 24℃ to 16℃ at a rate of around 2℃/h through adding ice cubes. The hepatopancreas were collected for transcriptomic analyses from exposed shrimps respectively at 1, 3, 6, 12, 24h after acute cooling at 16℃, rewarming to 24℃ and control group. The results of differentially expressed genes (DEGs) showed that 1702 DEGs were identified between samples of cooling for 1h and the control group (M1 vs. C0); the number of DEGs between the stress group and the control group began to increase gradually with stress time, and reached the maximum at 6h (M3 vs. C0, a total of 2899), then gradually decreased, maintaining the homeostasis under low temperature stress. After rewarming to 24℃, the number of DEGs (M6 vs. C0, 1969) returned to the level of 1h stress. Additionally, the DEGs number (5062) between samples of stress for 3h and rewarming to 24℃ (M2 vs. M6) was almost 1.5 times of that (3516) between samples of stress for 1h and rewarming (M1 vs. M6). With the extension of time, the number of DEGs decreased gradually, suggesting that the homeostasis of the GFP had drastic changes in the first 3h of acute low temperature stress, but the adaptability to low temperature gradually increased with stress time, and a steady state under low temperature was established probably after being stressed from 3h to 6h, and after rewarming, the homeostasis returned to the equilibrium of short-term cold stress. KEGG enrichment analysis showed that DEGs was enriched in lysosome, starch and sucrose metabolism, antigen processing and presentation. Adhesion spots, ECM-receptor interaction, metabolism of cytochrome P450 to isobiotic substances, glutathione metabolism, oxidative phosphorylation, and p53signaling pathway were also involved in the regulation of acute cold stress in the GFP. The common DEGs among all groups were clustered as the cell function and immunity modules and energy metabolism modules. In addition, the up-regulated cytochrome P450 2L1-like gene in the arachidonic acid metabolic signaling pathway was screened, and its expression increased firstly and then decreased with the increase of cold stress time. NADP-specific isocitrate dehydrogenase, an upregulated gene in glutathione metabolic signaling pathway, was firstly reduced and then increased with time. Expression of hexokinase, a down-regulated gene in starch and sucrose metabolic signaling pathways, increased and then decreased over time. The above mentioned enriched pathways indicated that the metabolic function of the GFP might have been seriously affected under acute low temperature stress, with a large amount of reactive oxygen species being produced, the balance of energy circulation being disrupted, and the immune system being also damaged, which was corroborated with the phenomena of fasting, slow movement, susceptibility to diseases and even death of the GFP under acute low temperature. Consequently, these screened pathways and genes may play important roles in energy metabolism and immune regulation during acute cold stress in the GFP. The present study provides basic data for revealing the molecular regulatory mechanism of the response of the GFP to acute low temperature stress, also provides a theoretical basis for the selective breeding of new cold-tolerant GFP varieties.
EFFECTS OF DIETARY SUPPLEMENTATION OF BOVINE LACTOFERRICIN ON GROWTH PERFORMANCE, DIGESTIVE ENZYMES ACTIVITY, INTESTINAL TISSUE STRUCTURE AND DISEASE RESISTANCE OF JUVENILE LARGEMOUTH BASS (MICROPTERUS SALMOIDES)
HUANG He, ZHUANG Yi, ZHONG Guo-Fang, TANG Xiang-Shan
 Available online  , doi: 10.7541/2023.2021.0386 doi: 10.7541/2023.2021.0386
[Abstract](926) [FullText HTML] (1153) [PDF 2387KB](20)
Abstract:
Largemouth bass (Micropterus salmoides), commonly known as California bass, has been introduced to China since the 1980s. After years of breeding development, it has now become one of the important species of freshwater aquaculture in China. However, with the rapid development of intensive aquaculture and irregular feeding methods, California bass diseases frequently occur. The traditional method to prevent and treat bacterial diseases in fish is to add antibiotics to aquafeeds. However, the abuse of antibiotics can lead to problems such as bacterial resistance, drug residues and environmental pollution. Therefore, the selection of suitable antibiotic substitutes for the aquaculture industry is an urgent matter, and it has far-reaching significance for the growing largemouth bass aquaculture industry. Research on alternatives to antibiotics has found that antimicrobial peptides are a kind of polypeptides produced by the non-specific immune system in organisms. Because of their unique biological activity, antibacterial and bactericidal mechanisms different from traditional antibiotics, they are not easy to produce drug resistance and no resistance. Pollution and other advantages are expected to be developed into a new type of high-efficiency antibacterial drugs, which have great potential to replace antibiotics in the field of feed additives. The bovine lactoferricin (LfcinB) used in this test is a cationic antimicrobial peptide containing 25 amino acid residues produced by pepsin hydrolysis of bovine lactoferrin under acidic conditions. It has a broad-spectrum and high-efficiency antibacterial ability and antiviral ability. However, its research as a feed additive has not been reported yet. This study investigated the effect of the dietary supplementation of bovine lactoferricin on growth performance, digestive enzymes activity, intestinal tissue structure and disease resistance against Aeromonas hydrophila in juvenile largemouth bass, aiming to evaluate its potential to replace antibiotics and provide a theoretical basis with the application of functional feed. A total of 450 tails largemouth bass with an average body weight of (19.88±0.03) g were randomly allocated into 5 groups with 3 replicates per group, and fed with basal diet (negative control), basal diet supplemented with 30 mg/kg florfenicol (positive control), basal diet supplemented with 1000, 1500, and 2000 mg/kg bovine lactoferrin peptide, respectively. The experiment lasted for 8 weeks. The results showed that: 1) With the increase of the addition of bovine lactoferrin peptide, final body weight (FBW), weight gain rate (WGR) and specific growth rate (SGR) of largemouth bass showed a trend of first increasing and then decreasing. The 1000 mg/kg bovine lactoferrin peptide group had the best growth performance of largemouth bass, which was significantly different from the negative and positive control groups (P<0.05). 2) Compared with the negative and positive control groups, the intestinal trypsin, α-amylase and lipase activities of the 1000 mg/kg bovine lactoferrin peptide group of largemouth bass increased significantly (P<0.05). 3) Compared with the negative and positive control groups, the addition of 1000 mg/kg bovine lactoferrin peptide to feed could significantly increase the height and width of villi of the foregut, midgut and hindgut of largemouth bass (P<0.05). 4) After challenge with Aeromonas hydrophila, the survival rates of largemouth bass in the bovine lactoferrin peptide groups were higher than that of the negative control group, but there were no significant differences from the positive control group (P>0.05). In summary, under the experimental conditions, the addition of bovine lactoferrin peptide to feed could improve growth performance of juvenile largemouth bass, and the appropriate dosage was 1000 mg/kg. At the same time, bovine lactoferrin peptide could increase the intestinal digestive enzyme activity of largemouth bass, improve intestinal tissue structure, and improve disease resistance.
PHYTOPLANKTON COMMUNITY STRUCTURE AND ITS RELATIONSHIP WITH ENVIRONMENTAL FACTORS IN XI'AN URBAN RIVERS SYSTEM
SUN Lai-Kang, YANG Tao, WAN Xu-Hao, YAN Xue-Rong, HU Chang-Tong, ZHENG Yi-Wen
 Available online  , doi: 10.7541/2023.2021.0345 doi: 10.7541/2023.2021.0345
[Abstract](1241) [FullText HTML] (927) [PDF 1720KB](16)
Abstract:
As the largest city in Northwest China, Xi'an's water ecological environment has been severely damaged with the expansion of the city and the development of industrialization. In water ecological health assessment, phytoplankton can objectively evaluate water quality and nutritional health status of water bodies.In order to determin the relationship between structural characteristics of phytoplankton communities and environmental factors in the Xi’an city, the composition of phytoplankton community, phytoplankton cell density and phytoplankton biomass of 24 sampling points in the Bahe, Chanhe, Fenghe and Heihe river were investigated on October 2020 and June 2021. The results showed that 115 species of phytoplankton in 6 phyla were identified during the dry season. The main species include 11.30% Cyanophyta, 54.78% Bacillariophyta and 26.96% Chlorophyta. The average cell density of phytoplankton was (3.36±3.50) ×106 cells/L, and the mean biomass was (1.79±3.59) mg/L. In addition, 168 species of phytoplankton were identified in 7 phyla during the wet season. The main species include7.74% Cyanophyta, 51.79% Bacillariophyta and 29.76% Chlorophyta. The average cell density of phytoplankton was (9.17±9.73%) ×106 cells/L, and the mean biomass was (6.54±11.57) mg/L. Compared with the dry season, the number of species, cell density and biomass in the wet season were larger than those in the dry season. Furthermore, the results of cluster analysis showed that the phytoplankton community structure and water environment condition were similar among most sampling points in the Xi'an urban river, and human interference may be the main reason for the spatial differences in the remaining points. The results of redundancy analysis (RNA) showed that the main environmental factors determing the distribution of phytoplankton community structure in urban river in the Xi'an city were temperature (Temp), ammonia nitrogen (NH3-N), pH, dissolved oxygen (DO), river width (Wide) and chlorophyll (CHL). Therefore, comprehensively considering the environmental factors, biodiversity index, phytoplankton community structure and dominant species showed that the water quality of Heihe River is the best among the four river systems, the water quality of Bahe River and Fenghe River is in average level, and the water quality of Chanhe River is poor.
CHARACTERISTICS OF FISH COMMUNITY STRUCTURE IN CORAL REEFS ADJACENT TO YONGXING ISLAND OF XISHA ISLANDS
WANG Teng, LIU Yong, LI Chun-Hou, XIAO Ya-Yuan, LIN Lin, LI Chun-Ran, XIE Yu-Fang, WU Peng
 Available online  , doi: 10.7541/2023.2022.0008 doi: 10.7541/2023.2022.0008
[Abstract](1029) [FullText HTML] (1168) [PDF 883KB](9)
Abstract:
The coral reef ecosystem has extremely high biodiversity and are known as the “tropical rainforests in the ocean”. There are more than 6 million people engaged in coral reef fishing in the world, supporting 10% of the global fisheries catch. Coral reef fisheries are the main source of income and livelihoods for millions of people (especially in developing countries). At the same time, coral reef fisheries are also facing serious overfishing. Yongxing Island is a typical coral reef ecosystem coral island, and fishing was the only direct source of income for the original residents here. Relevant studies in recent years have shown that the fishery of Yongxing Island was overfishing. In order to better understand, protect and manage coral reef fishes in the waters adjacent to Yongxing Island of Xisha Islands, a survey was carried out on the shore catches on Yongxing Island from 2020 to 2021, and the composition of fish community structure and its changes and succession characteristics were analyzed. The results showed that: a total of 101 species of coral reef fish were found, belonging to 5 orders and 21 families. Perciformes accounted for 84.16% of the total species, and their biomass exceeded 90% of the total catch. At the family level, parrotfish have the largest number of species, reaching 21 species, with the biomass exceeds 45% of the total catch. Twenty-eight species fishes were the main fishing targets in this sea area, accounting for more than 80% of the total catch. The fishes in this sea area were overfished. First, the average weight of medium-sized and large-sized fishes in the main catch was too small, there were 9 species of large-sized fish, only 3 species had an average weight of more than 1000g, and the average weight of other species was less than 1000 g, there were 16 species of medium-sized fish, and only 4 species had an average weight of more than 500 g. Second, most of the largest fishes in this sea area had disappeared, the largest fishes that had appeared in this sea area in the past (such as Carcharhinus limbatus, Rhizoprionodon acutus, Rhynchobatus djiddensis, Cheilinus undulatus, Plectropomus leopardus, Bolbometopon muricatum, etc.) were not found in present research. Third, a large number of carnivorous fish had disappeared. Based on present research and the characteristics of coral reef fisheries, we had compared and analyzed the family-level fish with important edible economic value. These families were Muraenidae, Sphyraenidae, Carangidae, Lethrinidae, Caesionidae, Lutjanidae, Mullidae, Haemulidae, Serranidae, Scaridae, Siganidae, Kyphosidae. There were 28 species of herbivorous fishes in this survey and 32 species in the historical survey; 49 species of carnivorous fishes in this survey and 79 species in the historical survey. Fourth, the biomass of herbivorous fish exceeds that of carnivorous fish. Early studies of coral reef ecology (i.e. primitive coral reef ecosystem) showed that coral reef fishes were mainly carnivorous, and the biomass of carnivorous was 3-4 times that of herbivorous. The coral reef fishes in this sea area had succeeded to an ecosystem dominated by herbivorous fishes. The emergence of a large number of sea urchins indicated that this coral reef ecosystem was further declining and evolving to an ecosystem dominated by sea urchins. Therefore, it is urgent to protect coral reef fishes in the waters adjacent to Yongxing Island of Xisha Islands, and it is necessary to strictly control the fishing intensity in this water.
GENETIC MONITORING OF CHANGFENG SILVER CARP BASE ON MICROSATELLITE
LUO Xiang-Zhong, QIN Wei-Min, L IANG Hong-Wei, SHA Hang, ZOU Gui-Wei
 Available online  , doi: 10.7541/2022.2021.033 doi: 10.7541/2022.2021.033
[Abstract](1751) [FullText HTML] (826) [PDF 824KB](20)
Abstract:
Changfeng silver carp (Hypophthalmichthys molitrix) (CF) is a new variety obtained by artificially selective breeding in China. Genetic monitoring the germplasm resources of Changfeng silver carp play an important role in maintaining its excellent traits. 18 microsatellite markers were used to analyze the genetic diversity and genetic structure in Changfeng silver carp (CF) populations. The results showed that the genetic diversity of silver carp (L) was higher than that of CF. The average number of alleles (Na) from CF1 to CF3 of CF offspring decreased from 5.7222 to 5.0556, and the average effective allele (Ne) were from 3.2551 to 3.1461. The average observed heterozygosity (Ho), the average expected heterozygosity (He), and the polymorphic information content (PIC) ranged from 0.6975 to 0.5407, 0.6422 to 0.6235, and 0.5784 to 0.5609, respectively. The Fst among the progeny of L and CF ranged from 0.0160 to 0.0315, indicating that the population of L has been genetically differentiated with low degree of differentiation. These results showed that the genetic structure of CF1 to CF3 exhibit slightly declining genetic diversity after three successive generations, whereas the genetic diversity was still abundant. Our study provides a basis for maintaining the genetic diversity of Changfeng silver carp.

Journal Introduction

  • Establishment Time:1955  Monthly
  • Competent unit:Chinese Academy of Sciences
  • Host unit:Institute of Hydrobiology, Chinese Academy of Sciences ; Chinese Society for Oceanology and Limnology
  • Editor-in-Chief:YIN Zhan
  • ISSN 1000-3207
  • CN 42-1230/Q

Copy right © 2009 Editorial Office of Acta Hydrobiologica Sinica

Address:No. 7 Donghu South Road, Wuchang District, Wuhan, Hubei Province, China

Tel:027-68780701 E-mail:acta@ihb.ac.cn 

Supported byBeijing Renhe Information Technology Co. Ltd  Technical support:info@rhhz.net