Scan QR Code
Login System
Office Online
Online production system
Search
Reading Guide
Display Method:
,
Available online
, doi: 10.7541/2023.2022.0363
Abstract:
In order to investigate the growth and behavior of juvenile black rockfish (Sebastes schlegelii) under different flow velocities, four treatment groups were set up. The average water flows velocity of the four treatments was maintained at 0, 0.5, 1.5, and 2.5 BL/s, expressed as C, L, M, and H, respectively. The experiment lasted for 43 days and eight behavior indicators were analyzed. The results showed the following: (1) The final body lengths in M and L were significantly higher than those in the other two treatment groups (P<0.05); the final weight, specific growth rate and weight gain rate were significantly higher in treatment M than those in treatment C and H (P<0.05); the feed conversion ratio was significantly lower in treatment L than that in treatment H (P<0.05). (2) After 30 days of the experiment, the accumulated residence time of the outer-circle area was significantly lower in both the M and H treatment groups compared with C and L treatment groups (P<0.05); the accumulated residence time in the middle-circle area was significantly higher in M and L treatment groups (P<0.05); the accumulated residence time of inner-circle area in treatment H was significantly higher than that in other treatment groups (P<0.05); the maximum accelerations of M were significantly higher than those of C and L treatment (P<0.05), after 36 days of the experiment, the average velocity of the M treatment was significantly higher than that in the other treatment groups (P<0.05). In conclusion, moderate swimming training significantly improved the growth performance of juvenile black rockfish, and the optimal flow velocity occurred at 1.5 BL/s under the present experimental conditions. Flow velocity significantly influenced the behavioral characteristics of juvenile black rockfish. Behavioral characteristics, such as regional preference and activity status, could be used to assess the respond of juvenile black rockfish to various water flow velocities.
In order to investigate the growth and behavior of juvenile black rockfish (Sebastes schlegelii) under different flow velocities, four treatment groups were set up. The average water flows velocity of the four treatments was maintained at 0, 0.5, 1.5, and 2.5 BL/s, expressed as C, L, M, and H, respectively. The experiment lasted for 43 days and eight behavior indicators were analyzed. The results showed the following: (1) The final body lengths in M and L were significantly higher than those in the other two treatment groups (P<0.05); the final weight, specific growth rate and weight gain rate were significantly higher in treatment M than those in treatment C and H (P<0.05); the feed conversion ratio was significantly lower in treatment L than that in treatment H (P<0.05). (2) After 30 days of the experiment, the accumulated residence time of the outer-circle area was significantly lower in both the M and H treatment groups compared with C and L treatment groups (P<0.05); the accumulated residence time in the middle-circle area was significantly higher in M and L treatment groups (P<0.05); the accumulated residence time of inner-circle area in treatment H was significantly higher than that in other treatment groups (P<0.05); the maximum accelerations of M were significantly higher than those of C and L treatment (P<0.05), after 36 days of the experiment, the average velocity of the M treatment was significantly higher than that in the other treatment groups (P<0.05). In conclusion, moderate swimming training significantly improved the growth performance of juvenile black rockfish, and the optimal flow velocity occurred at 1.5 BL/s under the present experimental conditions. Flow velocity significantly influenced the behavioral characteristics of juvenile black rockfish. Behavioral characteristics, such as regional preference and activity status, could be used to assess the respond of juvenile black rockfish to various water flow velocities.
,
Available online
, doi: 10.7541/2023.2022.0344
Abstract:
In order to provide the basis data for further study of carbon and nitrogen utilization in integrated culture pond ecosystem, the growth characteristics, morphology and body composition changes of Hongkong oysters during off-site fattening were study. Hongkong oysters Crassostrea hongkongensis (2-year-old) with an initial weight of 68.00 g were obtained from Maowei Sea, Qinzhou, Guangxi, and were fattened on floating rafts for 44 days in a fish-shrimp polyculture pond in Huguang Town, Zhanjiang. The oyster samples were collected during fattening regularly, and the morphological indicators, growth indicators, gross composition of soft tissue, carbon and nitrogen stable isotope values (δ13C and δ15N) of oyster samples were determined, and the correlation of these indicators were analyzed. The results showed that, after 44 days of fattening, the shell height, soft tissue quality, meat yield and fat content of 2-year-old oysters were significantly increased (P<0.05), the protein and ash contents were significantly decreased (P<0.05), while the shell length, shell width, body mass and moisture content did no showed significant difference (P>0.05). The δ15N, δ13C of the soft tissue and shell δ13C values of oysters all decreased significantly (P<0.05), and the δ15N and δ13C values of the soft tissue were significantly different from the initial samples after 16 days of fattening (P<0.05), which indicating that oysters could quickly utilize the abundant food sources of fattening pond, and obtained rapid grow of soft tissues During the fattening process, the meat yield of oyster was significantly positively correlated with the mass of soft body (P<0.05), extremely significantly negatively correlated with shell δ13C, δ15N, δ13C, N% and C% of soft body (P<0.01), and had a extremely significant negative correlation with shell length, shell width, shell height and body mass (P<0.01). However, there was no significant correlation between the meat yield of oyster and the shell length, shell width, shell height and body mass (P>0.05). During the fattening process, C% of oyster shell was positively significant correlated with N% and C% of soft body (P<0.05), and extremely significant positive correlated with δ15N of soft body (P<0.01); while C% of soft body tissue was extremely significant negative correlated with meat yield (P<0.01), significantly positive correlated with shell C% and δ13C of soft body (P<0.05), extremely significant positive correlated with the soft body δ15N and the soft body N% (P<0.01). These correlations indicated that monitoring changes in these indicators can better determine whether fattening oysters are adapted to the fattening environment and have access to sufficient food for rapid growth. The rapid growth of oysters during the fattening process resulted in a significant decrease in the carbon content of oysters, which must be taken into account when calculating the carbon sequestration benefits of oysters. In addition, the results of this study show that the ash content and carbon and nitrogen stable isotope characteristics of Hongkong oyster are easily affected by short-term off-site fattening, this influence must be considered when using inorganic elements and stable isotopes traceability technology for geographical origin traceability of Hongkong oyster.
In order to provide the basis data for further study of carbon and nitrogen utilization in integrated culture pond ecosystem, the growth characteristics, morphology and body composition changes of Hongkong oysters during off-site fattening were study. Hongkong oysters Crassostrea hongkongensis (2-year-old) with an initial weight of 68.00 g were obtained from Maowei Sea, Qinzhou, Guangxi, and were fattened on floating rafts for 44 days in a fish-shrimp polyculture pond in Huguang Town, Zhanjiang. The oyster samples were collected during fattening regularly, and the morphological indicators, growth indicators, gross composition of soft tissue, carbon and nitrogen stable isotope values (δ13C and δ15N) of oyster samples were determined, and the correlation of these indicators were analyzed. The results showed that, after 44 days of fattening, the shell height, soft tissue quality, meat yield and fat content of 2-year-old oysters were significantly increased (P<0.05), the protein and ash contents were significantly decreased (P<0.05), while the shell length, shell width, body mass and moisture content did no showed significant difference (P>0.05). The δ15N, δ13C of the soft tissue and shell δ13C values of oysters all decreased significantly (P<0.05), and the δ15N and δ13C values of the soft tissue were significantly different from the initial samples after 16 days of fattening (P<0.05), which indicating that oysters could quickly utilize the abundant food sources of fattening pond, and obtained rapid grow of soft tissues During the fattening process, the meat yield of oyster was significantly positively correlated with the mass of soft body (P<0.05), extremely significantly negatively correlated with shell δ13C, δ15N, δ13C, N% and C% of soft body (P<0.01), and had a extremely significant negative correlation with shell length, shell width, shell height and body mass (P<0.01). However, there was no significant correlation between the meat yield of oyster and the shell length, shell width, shell height and body mass (P>0.05). During the fattening process, C% of oyster shell was positively significant correlated with N% and C% of soft body (P<0.05), and extremely significant positive correlated with δ15N of soft body (P<0.01); while C% of soft body tissue was extremely significant negative correlated with meat yield (P<0.01), significantly positive correlated with shell C% and δ13C of soft body (P<0.05), extremely significant positive correlated with the soft body δ15N and the soft body N% (P<0.01). These correlations indicated that monitoring changes in these indicators can better determine whether fattening oysters are adapted to the fattening environment and have access to sufficient food for rapid growth. The rapid growth of oysters during the fattening process resulted in a significant decrease in the carbon content of oysters, which must be taken into account when calculating the carbon sequestration benefits of oysters. In addition, the results of this study show that the ash content and carbon and nitrogen stable isotope characteristics of Hongkong oyster are easily affected by short-term off-site fattening, this influence must be considered when using inorganic elements and stable isotopes traceability technology for geographical origin traceability of Hongkong oyster.
,
Available online
, doi: 10.7541/2023.2022.0319
Abstract:
To understand the spatial and temporal dynamics of periphytic algae colony structure and its relationship with environmental factors in the lower reaches of Lhasa River in Tibet Autonomous Region, artificial matrix method was used to investigate the Periphytic algae community structure in the lower reaches of Lhasa River in February (dry season), June (normal season) and September (wet season). Results showed that 104species belonging to 53 genera and 7 phyla of periplexus were identified, 28species belonging to diatoms with dominance≥0.02, The first three dominant species were Synedra ulna, Diatom aelongatum and Fragilaria intermedia. The average annual biomass was 0.047 mg/cm2, and the highest was found in Qushui County (0.121 mg/cm2), followed by Nimajiangre Township (0.052 mg/cm2) and Lhasa City (0.04 mg/cm2), and the lowest was found in Mozhugongka County (0.015 mg/cm2). The spatial distribution of Periphytic algae biomass in the lower reaches of Lhasa River were Qushui County>Nimajiangre Township>Lhasa City>Alang Township>Zhaxue Township>Dazi County>Mozhugongka county. The temporal distribution of Periphytic algae abundance in the lower reaches of Lhasa River was as follows: normal season>wet season>dry season. The water quality assessment results showed that the water quality of the three sampling points in the upstream was slightly polluted to clean, and the water quality of the four sampling points in the downstream was slightly to moderately over polluted. The canonical correspondence analysis of periphyton community parameters and environmental parameters showed that most dominant species of periphyton were negatively correlated with water temperature, flow rate and pH, and positively correlated with total nitrogen, dissolved oxygen and electrical conductivity. The results of this survey provided the basic data for the conservation and scientific utilization of aquatic biodiversity in Lhasa River basin, Tibet Autonomous Region.
To understand the spatial and temporal dynamics of periphytic algae colony structure and its relationship with environmental factors in the lower reaches of Lhasa River in Tibet Autonomous Region, artificial matrix method was used to investigate the Periphytic algae community structure in the lower reaches of Lhasa River in February (dry season), June (normal season) and September (wet season). Results showed that 104species belonging to 53 genera and 7 phyla of periplexus were identified, 28species belonging to diatoms with dominance≥0.02, The first three dominant species were Synedra ulna, Diatom aelongatum and Fragilaria intermedia. The average annual biomass was 0.047 mg/cm2, and the highest was found in Qushui County (0.121 mg/cm2), followed by Nimajiangre Township (0.052 mg/cm2) and Lhasa City (0.04 mg/cm2), and the lowest was found in Mozhugongka County (0.015 mg/cm2). The spatial distribution of Periphytic algae biomass in the lower reaches of Lhasa River were Qushui County>Nimajiangre Township>Lhasa City>Alang Township>Zhaxue Township>Dazi County>Mozhugongka county. The temporal distribution of Periphytic algae abundance in the lower reaches of Lhasa River was as follows: normal season>wet season>dry season. The water quality assessment results showed that the water quality of the three sampling points in the upstream was slightly polluted to clean, and the water quality of the four sampling points in the downstream was slightly to moderately over polluted. The canonical correspondence analysis of periphyton community parameters and environmental parameters showed that most dominant species of periphyton were negatively correlated with water temperature, flow rate and pH, and positively correlated with total nitrogen, dissolved oxygen and electrical conductivity. The results of this survey provided the basic data for the conservation and scientific utilization of aquatic biodiversity in Lhasa River basin, Tibet Autonomous Region.
,
Available online
, doi: 10.7541/2023.2022.0317
Abstract:
Biodiversity serves as an important index in reflecting the impact of environmental changes on ecological communities. It is also essential in evaluating the health and integrity of ecosystems, providing insights into management and conservation initiatives. The river-lake complex ecosystem in the middle and lower Yangtze River are one of the most threatened areas subjected to anthropogenic activities. However, there is still a lack of research on taxonomic diversity and general understanding of fish community and diversity changes in the Poyang Lake over a long time span. Based on data derived from fish resources investigation in 9 regions of the Poyang Lake area in April and July 2010, August 2018 and May 2019, we analyzed the temporal changes of species diversity, functional diversity and taxonomic diversity of fish communities in the Poyang Lake as well as the relationship between biodiversity and environmental factors. The results showed that 74 and 93species of fish were collected in 2010 and 2018-2019, respectively. There were significant differences in community structure, with Coilia brachygnathus, Pseudobrama simoni, Carassius auratus, Pelteobaggrus nitidus and Cyprinus carpio contributed the most variance. There were also significant differences in environmental factors between different years and seasons (P<0.05). Although the species diversity and functional diversity in 2018-2019 were higher than those in 2010, the variations in functional diversity and taxonomic distinctness (Λ+) were insignificant, suggesting the taxonomic range has narrowed albeit the fish species has increased in the past decade. The randomization test of the average taxonomic distinctness index (Δ+) and the variation in taxonomic distinctness (Λ+) showed that the number of sampling localities below the 95% probability confidence funnel from 2018 to 2019 increased compared with 2010, indicating that the degree of interference in the Poyang Lake area increased. The fish biodiversity in the Poyang Lake area was significantly correlated with water temperature, chlorophyll and total suspended solids concentration (P<0.05). The biodiversity of fish community was positively correlated with water temperature. However, the average taxonomic distinctness index (Δ+) and the variation in taxonomic distinctness (Λ+) were negatively correlated with the chlorophyll and total suspended solids. The results showed that the number of fish species in the Poyang Lake has increased under the periodic fishing ban of the Yangtze River, breeding and releasing project and ecological regulations. However, the small-sized fishes were still the dominant species in fish communities in the Poyang Lake during the past decade. This could be attributed to over-exploitation. Besides, anthropogenic disturbance compromised habitat heterogeneity. In particular, regions that located far from the Yangtze mainstream like the Poyang county, Xinjian county and Yugan county were more impacted by human activities. In order to protect and restore fish diversity in the Poyang Lake as well as the flood plain habitats in the middle and lower reaches of the Yangtze River, we suggest to take a series of measures in complementary to the ten-year fishing ban, such as demolition of small hydro power plants, reduction of reclamation and restoration of natural habitats.
Biodiversity serves as an important index in reflecting the impact of environmental changes on ecological communities. It is also essential in evaluating the health and integrity of ecosystems, providing insights into management and conservation initiatives. The river-lake complex ecosystem in the middle and lower Yangtze River are one of the most threatened areas subjected to anthropogenic activities. However, there is still a lack of research on taxonomic diversity and general understanding of fish community and diversity changes in the Poyang Lake over a long time span. Based on data derived from fish resources investigation in 9 regions of the Poyang Lake area in April and July 2010, August 2018 and May 2019, we analyzed the temporal changes of species diversity, functional diversity and taxonomic diversity of fish communities in the Poyang Lake as well as the relationship between biodiversity and environmental factors. The results showed that 74 and 93species of fish were collected in 2010 and 2018-2019, respectively. There were significant differences in community structure, with Coilia brachygnathus, Pseudobrama simoni, Carassius auratus, Pelteobaggrus nitidus and Cyprinus carpio contributed the most variance. There were also significant differences in environmental factors between different years and seasons (P<0.05). Although the species diversity and functional diversity in 2018-2019 were higher than those in 2010, the variations in functional diversity and taxonomic distinctness (Λ+) were insignificant, suggesting the taxonomic range has narrowed albeit the fish species has increased in the past decade. The randomization test of the average taxonomic distinctness index (Δ+) and the variation in taxonomic distinctness (Λ+) showed that the number of sampling localities below the 95% probability confidence funnel from 2018 to 2019 increased compared with 2010, indicating that the degree of interference in the Poyang Lake area increased. The fish biodiversity in the Poyang Lake area was significantly correlated with water temperature, chlorophyll and total suspended solids concentration (P<0.05). The biodiversity of fish community was positively correlated with water temperature. However, the average taxonomic distinctness index (Δ+) and the variation in taxonomic distinctness (Λ+) were negatively correlated with the chlorophyll and total suspended solids. The results showed that the number of fish species in the Poyang Lake has increased under the periodic fishing ban of the Yangtze River, breeding and releasing project and ecological regulations. However, the small-sized fishes were still the dominant species in fish communities in the Poyang Lake during the past decade. This could be attributed to over-exploitation. Besides, anthropogenic disturbance compromised habitat heterogeneity. In particular, regions that located far from the Yangtze mainstream like the Poyang county, Xinjian county and Yugan county were more impacted by human activities. In order to protect and restore fish diversity in the Poyang Lake as well as the flood plain habitats in the middle and lower reaches of the Yangtze River, we suggest to take a series of measures in complementary to the ten-year fishing ban, such as demolition of small hydro power plants, reduction of reclamation and restoration of natural habitats.
,
Available online
, doi: 10.7541/2023.2022.0316
Abstract:
The family Lottiidae (Gray 1840), is one of the most primitive gastropods in existence, and the mitochondrial gene (mitogenome) have been used to analyze the phylogenetic relationship in Patellogastropoda, but the complete mitogenome of some species in Lottiidae have not been mentioned. In this study, we obtained the complete mitogenome of Lottia luchuana by next-generation sequencing technology, and analyzed the basic characteristics of its genome. It was found that it contains 38 genes, including 13 protein-coding genes (PCGs), two RNAs, 23 tRNAs, one more trnM than most Gastropoda species. The base content analysis showed that T base content was the highest at 32.34%, and C base content was the lowest at 14.99%. Gly, Phe, Ser2 and Val were the four most commonly used amino acids, UUA (Leu2), UUU (Phe), CCU (Pro) and AGA (Ser2) are the four most commonly used codons. We selected the mitogenomes of Lottiidae 13species for selection pressure analysis and found that all PCGs had a Ka/Ks ratio below 1 and were subjected to purification selection. In addition, a phylogenetic tree was constructed by combining the 13 PCGs of the mitogenomes of six subclass under Gastropoda, and it was found that Lottiidae is a monophyletic group, and has a relatively close relationship with Patellidae, but the results of this analysis are still affected by the attraction of long branches, so that the branch of Patellogastropoda is divided into two parts, but with the increase of species richness, it may gradually resist the attraction of long branches. A linear sequence comparison of the mitogenomes of all species of Patellogastropoda showed that Lottiidae showed the most extensive irregular rearrangement in Patellogastropoda, and also changed in the number of tRNAs. From the reconstructed chronological map of the divergence time of Patellogastropoda, it is concluded that the differentiation of limpet first occurred in the Jurassic period of the Mesozoic, and a large number of species diverged rapidly in the Cenozoic. These results will help people better understand the phylogenetic relationship between limpet, as well as the evolutionary relationship and evolutionary status of each subclass within the Gastropoda, provide more reference for species classification.
The family Lottiidae (Gray 1840), is one of the most primitive gastropods in existence, and the mitochondrial gene (mitogenome) have been used to analyze the phylogenetic relationship in Patellogastropoda, but the complete mitogenome of some species in Lottiidae have not been mentioned. In this study, we obtained the complete mitogenome of Lottia luchuana by next-generation sequencing technology, and analyzed the basic characteristics of its genome. It was found that it contains 38 genes, including 13 protein-coding genes (PCGs), two RNAs, 23 tRNAs, one more trnM than most Gastropoda species. The base content analysis showed that T base content was the highest at 32.34%, and C base content was the lowest at 14.99%. Gly, Phe, Ser2 and Val were the four most commonly used amino acids, UUA (Leu2), UUU (Phe), CCU (Pro) and AGA (Ser2) are the four most commonly used codons. We selected the mitogenomes of Lottiidae 13species for selection pressure analysis and found that all PCGs had a Ka/Ks ratio below 1 and were subjected to purification selection. In addition, a phylogenetic tree was constructed by combining the 13 PCGs of the mitogenomes of six subclass under Gastropoda, and it was found that Lottiidae is a monophyletic group, and has a relatively close relationship with Patellidae, but the results of this analysis are still affected by the attraction of long branches, so that the branch of Patellogastropoda is divided into two parts, but with the increase of species richness, it may gradually resist the attraction of long branches. A linear sequence comparison of the mitogenomes of all species of Patellogastropoda showed that Lottiidae showed the most extensive irregular rearrangement in Patellogastropoda, and also changed in the number of tRNAs. From the reconstructed chronological map of the divergence time of Patellogastropoda, it is concluded that the differentiation of limpet first occurred in the Jurassic period of the Mesozoic, and a large number of species diverged rapidly in the Cenozoic. These results will help people better understand the phylogenetic relationship between limpet, as well as the evolutionary relationship and evolutionary status of each subclass within the Gastropoda, provide more reference for species classification.
,
Available online
, doi: 10.7541/2023.2022.0309
Abstract:
Diaptomidae is one of the most common seen freshwater copepod fauna, the taxonomic study of this taxon is the basic information for the theoretical study of systemic zoology. Five species of genus Mongolodiaptomus (Copepoda, Calanoida, Diaptomidae) were reported in China before. This research reported a new species of Mongolodiaptomus from Hainan Island, which is the first record of Mongolodiaptomus mekongensis Sanoamuang & Watiroyram, 2018 in China. Through scanning electronic and light microscopy, the morphological characteristics are described and illustrated in detail. In addition, 18S rDNA gene sequences were also obtained for the first time to investigate phylogenetic position of this species. Morphological characteristics of female species are described in detail as follows: posterolateral wings of fifth pedigerous segment were asymmetrical and right wing somewhat was larger than left. Left proximal part of genital somite broadly expanded and provided with laterally directed spine; Right proximal region of genital somite produced into posterolaterally directed, triangular process, tipped with variablespine, exceeded the middle of the genital somite. Morphological characteristics of male species are described in detail as follows: Right antennule transformed and geniculated, with 22segments and the antepenultimate with comb-like process; Intercoxal plate of right fifth leg produced into spine-like lobes on distal margin; The principal lateral spine on second exopodite of right fifth leg is obviously bent; The right caudal ramus has two ventral chitinous prominences, one strong spiniform process on prominence proximally and one semi-circular ridges located at the end. The molecular phylogenetic analysis showed that M. mekongensis is closed related with the genus Eudiaptomus and Neodiaptomus. This study provides detailed morphological characteristics and molecular data for M. mekongensis, laying the foundation for future research on this species and genus Mongolodiaptomus.
Diaptomidae is one of the most common seen freshwater copepod fauna, the taxonomic study of this taxon is the basic information for the theoretical study of systemic zoology. Five species of genus Mongolodiaptomus (Copepoda, Calanoida, Diaptomidae) were reported in China before. This research reported a new species of Mongolodiaptomus from Hainan Island, which is the first record of Mongolodiaptomus mekongensis Sanoamuang & Watiroyram, 2018 in China. Through scanning electronic and light microscopy, the morphological characteristics are described and illustrated in detail. In addition, 18S rDNA gene sequences were also obtained for the first time to investigate phylogenetic position of this species. Morphological characteristics of female species are described in detail as follows: posterolateral wings of fifth pedigerous segment were asymmetrical and right wing somewhat was larger than left. Left proximal part of genital somite broadly expanded and provided with laterally directed spine; Right proximal region of genital somite produced into posterolaterally directed, triangular process, tipped with variablespine, exceeded the middle of the genital somite. Morphological characteristics of male species are described in detail as follows: Right antennule transformed and geniculated, with 22segments and the antepenultimate with comb-like process; Intercoxal plate of right fifth leg produced into spine-like lobes on distal margin; The principal lateral spine on second exopodite of right fifth leg is obviously bent; The right caudal ramus has two ventral chitinous prominences, one strong spiniform process on prominence proximally and one semi-circular ridges located at the end. The molecular phylogenetic analysis showed that M. mekongensis is closed related with the genus Eudiaptomus and Neodiaptomus. This study provides detailed morphological characteristics and molecular data for M. mekongensis, laying the foundation for future research on this species and genus Mongolodiaptomus.
,
Available online
, doi: 10.7541/2023.2022.0285
Abstract:
Rice-crayfih-eel co-culture is a high benefit comprehensive culture model that integrating rice planting, crayfish and eel cultivation. However, study on the predatory relationship between eel and crayfish is lacking, which is one of the key issues related to the establishment of this model. This study explored the potential food organisms and food composition of eel in rice-crayfish fields and its predation selection for crayfish by investigating the resources of macroorganisms and benthos and analyzing the gastrointestinal contents of eel in rice crayfish fields; The results showed that the natural bait for rice field eels was abundant in the paddy field environment, a total of 16 genera of basic bait organisms were found. Crayfish was the most preferred prey for eel, followed by caridina, earthworms and aquatic oligochaetes. The percentage of crayfish in the food mass of rice field eels was highest from April to August, with a maximum of 93.90% in August, and a minimum of (76.85±20.66)% in April. When crayfish was the only food, the average daily predation of each large-size eel (≥200 g) was 1.63±0.065 g; when crayfish, caridina and earthworms were used as food, the rice field eels mainly fed on crayfish and did not feed on earthworms with the selection indices were 0.066, –0.266 and –1.000, respectively, When the live crayfish and feed (fresh surimi and crayfish artificial compound) were used as food, the rice field eels were mainly fed on feed but not on crayfish with the selection indices were –0.846 and 0.591, respectively. The results of this study provide a theoretical basis for the establishment of rice-crayfish-eel co-culture model and reasonable stocking of eel under this model.
Rice-crayfih-eel co-culture is a high benefit comprehensive culture model that integrating rice planting, crayfish and eel cultivation. However, study on the predatory relationship between eel and crayfish is lacking, which is one of the key issues related to the establishment of this model. This study explored the potential food organisms and food composition of eel in rice-crayfish fields and its predation selection for crayfish by investigating the resources of macroorganisms and benthos and analyzing the gastrointestinal contents of eel in rice crayfish fields; The results showed that the natural bait for rice field eels was abundant in the paddy field environment, a total of 16 genera of basic bait organisms were found. Crayfish was the most preferred prey for eel, followed by caridina, earthworms and aquatic oligochaetes. The percentage of crayfish in the food mass of rice field eels was highest from April to August, with a maximum of 93.90% in August, and a minimum of (76.85±20.66)% in April. When crayfish was the only food, the average daily predation of each large-size eel (≥200 g) was 1.63±0.065 g; when crayfish, caridina and earthworms were used as food, the rice field eels mainly fed on crayfish and did not feed on earthworms with the selection indices were 0.066, –0.266 and –1.000, respectively, When the live crayfish and feed (fresh surimi and crayfish artificial compound) were used as food, the rice field eels were mainly fed on feed but not on crayfish with the selection indices were –0.846 and 0.591, respectively. The results of this study provide a theoretical basis for the establishment of rice-crayfish-eel co-culture model and reasonable stocking of eel under this model.
,
Available online
, doi: 10.7541/2023.2022.0395
Abstract:
Intelectin is a novel glycan-binding lectin in the innate immune response of fish, which can bind bacterial surface carbohydrates to agglutinate bacteria. To study the role of intelectin in the innate immunity of Onychostoma macrolepis during bacterial infection, the Onychostoma macrolepis intelectin (OmITLN) was identified in liver transcriptome database and cloned. RT-qPCR was used to analyze the expression of OmITLN in different tissues and after Aeromonas hydrophila infection. OmITLN recombinant protein was successfully obtained by prokaryotic expressio and the binding ability of OmITLN to different bacteria was detected by ELISA and fluorescent labeling. The result showed that the sequence was 960 bp in full length, containing 945 bp open reading frame and encoding 315 amino acids. Protein functional domain analysis showed that OmITLN encoded an N-terminal fibrinogen associated domain (FReD) and a C-terminal Intelectin-specific domain. The homology comparison and the phylogenetic tree showed that the OmITLN protein had a higher homology with the other Cyprinidae, such as Ctenopharyngodon idella, Hypophthalmichthys nobilis, Megalobrama amblycephala and Carassius auratus. The qRT-PCR results indicated that OmITLN was expressed in the all examined tissues including liver, muscle, spleen, gonad, intestine, brain and gill in Onychostoma macrolepis, and it was expressed at the highest level in liver and spleen. Compared with the control group, OmITLN was significantly up-regulated and then down-regulated after stimulation with Aeromonas hydrophila. In the liver, the expression of OmITLN reached its maximum at 12hours post-infection (hpi) and was gradually down-regulated over time. In spleen, OmITLN was reached the highest value at 6hpi and then gradually returned to the initial level after 24hpi. OmITLN recombinant protein was successfully obtained and authenticated by SDS-PAGE and Western Blotting. OmITLN can agglutinated all tested bacteria, including three gram-positive bacteria (Escherichia coli, Vibrio parahaemolyticus and Aeromonas hydrophila) and three gram-negative bacteria (Streptococcus agalactiae, Bacillus cereus and Staphylococcus aureus) with Ca2+. OmITLN showed the best binding activity to D-lactose, followed by xylose, D-galactose and sucrose, with the lowest expression in D-glucose, but showed no binding activity to mycose, D-fructose and D-maltose. The binding activity of OmITLN to PGN which is gram-positive bacteria recognition structure was higher than LPS which is gram-negative bacteria recognition structure. As an important pattern recognition receptor, OmITLN is involved in the immune defense of Onychostoma macrolepis against bacteria.
Intelectin is a novel glycan-binding lectin in the innate immune response of fish, which can bind bacterial surface carbohydrates to agglutinate bacteria. To study the role of intelectin in the innate immunity of Onychostoma macrolepis during bacterial infection, the Onychostoma macrolepis intelectin (OmITLN) was identified in liver transcriptome database and cloned. RT-qPCR was used to analyze the expression of OmITLN in different tissues and after Aeromonas hydrophila infection. OmITLN recombinant protein was successfully obtained by prokaryotic expressio and the binding ability of OmITLN to different bacteria was detected by ELISA and fluorescent labeling. The result showed that the sequence was 960 bp in full length, containing 945 bp open reading frame and encoding 315 amino acids. Protein functional domain analysis showed that OmITLN encoded an N-terminal fibrinogen associated domain (FReD) and a C-terminal Intelectin-specific domain. The homology comparison and the phylogenetic tree showed that the OmITLN protein had a higher homology with the other Cyprinidae, such as Ctenopharyngodon idella, Hypophthalmichthys nobilis, Megalobrama amblycephala and Carassius auratus. The qRT-PCR results indicated that OmITLN was expressed in the all examined tissues including liver, muscle, spleen, gonad, intestine, brain and gill in Onychostoma macrolepis, and it was expressed at the highest level in liver and spleen. Compared with the control group, OmITLN was significantly up-regulated and then down-regulated after stimulation with Aeromonas hydrophila. In the liver, the expression of OmITLN reached its maximum at 12hours post-infection (hpi) and was gradually down-regulated over time. In spleen, OmITLN was reached the highest value at 6hpi and then gradually returned to the initial level after 24hpi. OmITLN recombinant protein was successfully obtained and authenticated by SDS-PAGE and Western Blotting. OmITLN can agglutinated all tested bacteria, including three gram-positive bacteria (Escherichia coli, Vibrio parahaemolyticus and Aeromonas hydrophila) and three gram-negative bacteria (Streptococcus agalactiae, Bacillus cereus and Staphylococcus aureus) with Ca2+. OmITLN showed the best binding activity to D-lactose, followed by xylose, D-galactose and sucrose, with the lowest expression in D-glucose, but showed no binding activity to mycose, D-fructose and D-maltose. The binding activity of OmITLN to PGN which is gram-positive bacteria recognition structure was higher than LPS which is gram-negative bacteria recognition structure. As an important pattern recognition receptor, OmITLN is involved in the immune defense of Onychostoma macrolepis against bacteria.
,
Available online
, doi: 10.7541/2023.2022.0022
Abstract:
β-defensin (BD) is a small cationic peptide rich in cysteine, which plays an important role in host defense and innate immunity. BDs exist widely in all kinds of organisms in nature, and were initially concerned and studied extensively due to its spectral antibacterial activity. With in-depth research, it has been found in recent years that BD not only has direct antiviral microbial activity, but also plays an important regulatory role in natural immunity. At present, there are few studies on the immunomodulatory function of fish defensin. The study on grass carp BD still remained in the analysis of antibacterial activity. In this study, the antibacterial function of grass carp β-defensin 1 (CiBD1) was verified, and its chemochemogenic activity and adjuvant effect on Aeromonas hydrophila inactivated vaccine were explored, which can provide new insights for the prevention and treatment of grass carp bacterial disease. Relevant experimental results are as follows: 1. CiBD1 is a class of cationic amphiphilic proteins with highly conserved three β-folded structures. Through Clustal Omega multi-sequence alignment and I-Tasser secondary structure prediction, it is found that CiBD1 is a kind of amphiphile cationic peptide rich in cysteine. Its structure is highly conserved in bony fishes. 2. CiBD1 is constitutively distributed in all tissues of grass carp and highly expressed in some mucosal tissues. In order to explore the physiological role of CiBD1, we studied the transcription level of CiBD1 gene in different tissues of grass carp under normal physiological conditions, and the results showed that skin and eye were the two tissues with the highest level of CiBD1 transcription before infection. The transcription level of CiBD1 in all tissues of grass carp infected with Aeromonas hydrophila at 72h was significantly different from that before infection, which showed that the transcription level of CiBD1 in tissues related to mucosal immunity, such as skin, eyes, swim bladder and hindgut, was significantly higher. 3. The recombinant CiBD1 protein was successfully expressed by the prokaryotic expression system of Escherichia coli, and the antibacterial activity of CiBD1 was verified in vitro. The prokaryotic expression vector pET-32a-CiBD1 was constructed and induced by IPTG. The recombinant CiBD1 protein was purified by Ni2+ affinity chromatography and digested by enterocyte kinase. The antibacterial activity of CiBD1 was verified by CFU plate method. It has significant inhibitory activity against gram-negative bacteria (G+) and Gram-positive bacteria (G-). 4. CiBD1has chemotactic activity of leukocytes in vitro, which can enhance the protective effect of Aeromonas hydrophila inactivated vaccine on grass carp, and has the potential to be used as an immune adjuvant. Chemotactic experiments showed that CiBD1had the best chemotactic activity on primary white blood cells of grass carp at 50 ng/mL. The immune adjuvant effect of CiBD1 recombinant protein on Aeromonas hydrophila inactivated vaccine was investigated by individual experiment. The mortality rate of the group with CiBD1 adjuvant was significantly lower than that of the group with vaccine alone, and the levels of IgM and MHC Ⅱ transcription and the contents of complement 3 (C3) and lysozyme in serum were significantly higher than those of the control group.In conclusion, CiBD1 is a class of highly conserved small molecule cationic antimicrobial peptide. CiBD1 is distributed in various tissues of grass carp in a constituent form and is highly expressed in some mucosal tissues. When the body is stimulated by pathogens or environmental stimuli, CiBD1 transcription level expression in some tissues in close contact with the peripheral environment is more significant. CiBD1 recombinant protein not only had certain killing activity against bacteria in vitro, but also showed strong chemotactic activity against lymphocyte and myeloid cells of grass carp. CiBD1 can improve the protection rate and disease resistance of Aeromonas hydrophila inactivated vaccine, and has a good immune adjuvant effect. This study indicated that CiBD1 recombinant protein plays an important role in bacterial anti-infection immunity and has a certain application prospect in aquaculture.
β-defensin (BD) is a small cationic peptide rich in cysteine, which plays an important role in host defense and innate immunity. BDs exist widely in all kinds of organisms in nature, and were initially concerned and studied extensively due to its spectral antibacterial activity. With in-depth research, it has been found in recent years that BD not only has direct antiviral microbial activity, but also plays an important regulatory role in natural immunity. At present, there are few studies on the immunomodulatory function of fish defensin. The study on grass carp BD still remained in the analysis of antibacterial activity. In this study, the antibacterial function of grass carp β-defensin 1 (CiBD1) was verified, and its chemochemogenic activity and adjuvant effect on Aeromonas hydrophila inactivated vaccine were explored, which can provide new insights for the prevention and treatment of grass carp bacterial disease. Relevant experimental results are as follows: 1. CiBD1 is a class of cationic amphiphilic proteins with highly conserved three β-folded structures. Through Clustal Omega multi-sequence alignment and I-Tasser secondary structure prediction, it is found that CiBD1 is a kind of amphiphile cationic peptide rich in cysteine. Its structure is highly conserved in bony fishes. 2. CiBD1 is constitutively distributed in all tissues of grass carp and highly expressed in some mucosal tissues. In order to explore the physiological role of CiBD1, we studied the transcription level of CiBD1 gene in different tissues of grass carp under normal physiological conditions, and the results showed that skin and eye were the two tissues with the highest level of CiBD1 transcription before infection. The transcription level of CiBD1 in all tissues of grass carp infected with Aeromonas hydrophila at 72h was significantly different from that before infection, which showed that the transcription level of CiBD1 in tissues related to mucosal immunity, such as skin, eyes, swim bladder and hindgut, was significantly higher. 3. The recombinant CiBD1 protein was successfully expressed by the prokaryotic expression system of Escherichia coli, and the antibacterial activity of CiBD1 was verified in vitro. The prokaryotic expression vector pET-32a-CiBD1 was constructed and induced by IPTG. The recombinant CiBD1 protein was purified by Ni2+ affinity chromatography and digested by enterocyte kinase. The antibacterial activity of CiBD1 was verified by CFU plate method. It has significant inhibitory activity against gram-negative bacteria (G+) and Gram-positive bacteria (G-). 4. CiBD1has chemotactic activity of leukocytes in vitro, which can enhance the protective effect of Aeromonas hydrophila inactivated vaccine on grass carp, and has the potential to be used as an immune adjuvant. Chemotactic experiments showed that CiBD1had the best chemotactic activity on primary white blood cells of grass carp at 50 ng/mL. The immune adjuvant effect of CiBD1 recombinant protein on Aeromonas hydrophila inactivated vaccine was investigated by individual experiment. The mortality rate of the group with CiBD1 adjuvant was significantly lower than that of the group with vaccine alone, and the levels of IgM and MHC Ⅱ transcription and the contents of complement 3 (C3) and lysozyme in serum were significantly higher than those of the control group.In conclusion, CiBD1 is a class of highly conserved small molecule cationic antimicrobial peptide. CiBD1 is distributed in various tissues of grass carp in a constituent form and is highly expressed in some mucosal tissues. When the body is stimulated by pathogens or environmental stimuli, CiBD1 transcription level expression in some tissues in close contact with the peripheral environment is more significant. CiBD1 recombinant protein not only had certain killing activity against bacteria in vitro, but also showed strong chemotactic activity against lymphocyte and myeloid cells of grass carp. CiBD1 can improve the protection rate and disease resistance of Aeromonas hydrophila inactivated vaccine, and has a good immune adjuvant effect. This study indicated that CiBD1 recombinant protein plays an important role in bacterial anti-infection immunity and has a certain application prospect in aquaculture.
,
Available online
, doi: 10.7541/2023.2022.0051
Abstract:
The Asian giant soft-shelled turtles (Pelochelys cantorii) belong to Testudines, Trionychidae, and Pelochelys. As one of the largest aquatic turtles in China, it is also an important indicator species for the health of the river ecosystem in the Pearl River Basin and even the southern part of China. Because of the long history of P. cantorii, it is of great scientific value of environmental changes and biological evolution. P. cantorii was widely distributed in Southeast Asia of China in history. However, due to unfair trade, excessive harvesting and killing of turtles and water conservancy projects, the population of P. cantorii has been greatly reduced. Currently, P. cantorii have become an extremely endangered species. There are only 13 P. cantorii in captivity in China, which have been listed as national first-class protected animals and taken seriously by scientific researchers. With the success of artificial domestication and breeding in recent 3 years, the genetic information of the preserved population is still unknown. In this paper, we use transcriptome data design trinucleotide repeat and repeat four nucleotides microsatellite primers 30000 on, the choice of 230 pairs of primer synthesis, received 10 after two screening amplification with high efficiency and high specificity of microsatellite marker, and build 2 multiple PCR system. Genotypes and genetic diversity of 56 soft-shelled islet were detected by ABI3130 genetic analyzer and PopGene3.2 and CERVUS software. The results showed that the average number of alleles was 2.3 and the average content of polymorphic information was 0.3829. The average observed and expected heterozygosity were 0.6305 and 0.4767, respectively. Paternity analysis of 56 progenies showed that the cumulative exclusion probabilities of 10 microsatellite loci were 73.14% (NE-1P), 90.98% (NE-2P) and 98% (NE-3p), which can meet the needs of paternity testing, respectively, and the four parents showed differences in reproductive selection. The analysis of the technology can help identify the captive population of genetic information, assist researchers to family management of groups. And more importantly, in the process of F3 generations of breeding in the future, the technology can be regarded as parental choice of technical means, to get healthier, higher genetic diversity, and their offspring, for the entire group of proliferation and endangered wild work to lay a solid foundation.
The Asian giant soft-shelled turtles (Pelochelys cantorii) belong to Testudines, Trionychidae, and Pelochelys. As one of the largest aquatic turtles in China, it is also an important indicator species for the health of the river ecosystem in the Pearl River Basin and even the southern part of China. Because of the long history of P. cantorii, it is of great scientific value of environmental changes and biological evolution. P. cantorii was widely distributed in Southeast Asia of China in history. However, due to unfair trade, excessive harvesting and killing of turtles and water conservancy projects, the population of P. cantorii has been greatly reduced. Currently, P. cantorii have become an extremely endangered species. There are only 13 P. cantorii in captivity in China, which have been listed as national first-class protected animals and taken seriously by scientific researchers. With the success of artificial domestication and breeding in recent 3 years, the genetic information of the preserved population is still unknown. In this paper, we use transcriptome data design trinucleotide repeat and repeat four nucleotides microsatellite primers 30000 on, the choice of 230 pairs of primer synthesis, received 10 after two screening amplification with high efficiency and high specificity of microsatellite marker, and build 2 multiple PCR system. Genotypes and genetic diversity of 56 soft-shelled islet were detected by ABI3130 genetic analyzer and PopGene3.2 and CERVUS software. The results showed that the average number of alleles was 2.3 and the average content of polymorphic information was 0.3829. The average observed and expected heterozygosity were 0.6305 and 0.4767, respectively. Paternity analysis of 56 progenies showed that the cumulative exclusion probabilities of 10 microsatellite loci were 73.14% (NE-1P), 90.98% (NE-2P) and 98% (NE-3p), which can meet the needs of paternity testing, respectively, and the four parents showed differences in reproductive selection. The analysis of the technology can help identify the captive population of genetic information, assist researchers to family management of groups. And more importantly, in the process of F3 generations of breeding in the future, the technology can be regarded as parental choice of technical means, to get healthier, higher genetic diversity, and their offspring, for the entire group of proliferation and endangered wild work to lay a solid foundation.
,
Available online
, doi: 10.7541/2023.2022.0113
Abstract:
The shortage of female has impeded the development of aquaculture industry of yellow catfish (Tachysurus fulvidraco) in China in recent years. Therefore, large-scale production system of all-female is urgently needed. To produce an all-female population in large-scale of yellow catfish, 12—65 days post-hatching larvae were treated with the combination of three male-promoting factors, 17 α-Methyltestosterone (MT, 5 mg/kg), Letrozole (LZ, 300 mg/kg), and high temperature (33.5℃). XX pseudo-males were mated with normal XX females and large-scale production of all-female population was conducted. Results showed that the combination of MT, LZ, and high temperature-induced masculinization of XX individuals, and the completely sex-reversed XX males displayed a similar percentage of motile sperm with XY males. Histological observation found that there are a large number of spermatids in the testis of XX males, indicating normal reproductive ability. Subsequently, we mate XX males and XX females, produced 570000 genotypic XX larvae, and successfully reared them to large fingerlings in a pond. The results indicated that 2.8% and 12.0% XX individuals reversed to XX males which is probably due to the high temperature during the critical time of sex differentiation in the rearing pond. The ovary developed very well for the rest of XX females and can be used as female parents in the coming spawning season. The current work successfully conducted large-scale production of the all-female population in yellow catfish, and the results will provide an important foundation for the large-scale production system of the all-female population, and important safeguard for female selection in genetic breeding of new varieties.
The shortage of female has impeded the development of aquaculture industry of yellow catfish (Tachysurus fulvidraco) in China in recent years. Therefore, large-scale production system of all-female is urgently needed. To produce an all-female population in large-scale of yellow catfish, 12—65 days post-hatching larvae were treated with the combination of three male-promoting factors, 17 α-Methyltestosterone (MT, 5 mg/kg), Letrozole (LZ, 300 mg/kg), and high temperature (33.5℃). XX pseudo-males were mated with normal XX females and large-scale production of all-female population was conducted. Results showed that the combination of MT, LZ, and high temperature-induced masculinization of XX individuals, and the completely sex-reversed XX males displayed a similar percentage of motile sperm with XY males. Histological observation found that there are a large number of spermatids in the testis of XX males, indicating normal reproductive ability. Subsequently, we mate XX males and XX females, produced 570000 genotypic XX larvae, and successfully reared them to large fingerlings in a pond. The results indicated that 2.8% and 12.0% XX individuals reversed to XX males which is probably due to the high temperature during the critical time of sex differentiation in the rearing pond. The ovary developed very well for the rest of XX females and can be used as female parents in the coming spawning season. The current work successfully conducted large-scale production of the all-female population in yellow catfish, and the results will provide an important foundation for the large-scale production system of the all-female population, and important safeguard for female selection in genetic breeding of new varieties.
,
Available online
, doi: 10.7541/2023.2022.0042
Abstract:
Cyanobacterial harmful algal blooms are a global environmental problem. Microcystis, which can produce microcystin, is one of the most pervasive bloomforming cyanobacteria in freshwater ecosystems. Blooms of Microcystis have adverse effects on lake ecology, and may effect human health, so it is important to control Microcystis blooms. In order to investigate the inhibitory effect of green algae on Microcystis aeruginosa based on allelopathy among different algae strains, we screened potential green algae to control M. aeruginosa blooms. One strain which has allelochemicals production properties was screened from 34 strains of green algae. The results showed that the spent medium of Scenedesmus sp. FACHB-1229 had the highest inhibition rate, for M. aeruginosa FACHB-3550 was 53.95% and for FACHB-905 was 48.85%, respectively. And an analysis result of gas chromatography mass spectrometry (GC-MS) indicated that 1,2-Benzenedicarboxylic acid, bis(2-methoxyethyl) ester might be the allelochemical substances. In addition, we also measured growth rates, high ammonia nitrogen tolerance and photosynthetic oxygen evolution rates of the strain. The results indicated that Scenedesmus sp. FACHB-1229 had high specific growth rate of (0.38±0.06)/d. It also had the highest photosynthetic oxygen evolution rates of (229.91±10.49) μmol O2/(mg Chl.a·h). And the ammonia nitrogen tolerance of Scenedesmus sp. FACHB-1229 was significantly higher than other strains, its growth rate was (0.30±0.08)/d when the ammonia nitrogen concentration reached up to 1888.60 mg/L. Moreover, the proportion of FACHB-1229 was consistently increased when co-cultured with FACHB-3550. In summary, FACHB-1229 has the superiority in interspecies competition with M. aeruginosa, its spent medium can inhibit the growth of M. aeruginosa, and it also has high ammonia nitrogen tolerance and photosynthetic oxygen evolution rate. Therefore, this study has provided the theory and application basis in prevention and control of cyanobacterial blooms using interspecific competition among algae. FACHB-1229 has the potential to control harmful algae through biological methods, it can grow rapidly in aquaculture pond or other polluted water bodies with high ammonia nitrogen concentration, while it can inhibit M. aeruginosa through allelopathy and provide dissolved oxygen at the same time.
Cyanobacterial harmful algal blooms are a global environmental problem. Microcystis, which can produce microcystin, is one of the most pervasive bloomforming cyanobacteria in freshwater ecosystems. Blooms of Microcystis have adverse effects on lake ecology, and may effect human health, so it is important to control Microcystis blooms. In order to investigate the inhibitory effect of green algae on Microcystis aeruginosa based on allelopathy among different algae strains, we screened potential green algae to control M. aeruginosa blooms. One strain which has allelochemicals production properties was screened from 34 strains of green algae. The results showed that the spent medium of Scenedesmus sp. FACHB-1229 had the highest inhibition rate, for M. aeruginosa FACHB-3550 was 53.95% and for FACHB-905 was 48.85%, respectively. And an analysis result of gas chromatography mass spectrometry (GC-MS) indicated that 1,2-Benzenedicarboxylic acid, bis(2-methoxyethyl) ester might be the allelochemical substances. In addition, we also measured growth rates, high ammonia nitrogen tolerance and photosynthetic oxygen evolution rates of the strain. The results indicated that Scenedesmus sp. FACHB-1229 had high specific growth rate of (0.38±0.06)/d. It also had the highest photosynthetic oxygen evolution rates of (229.91±10.49) μmol O2/(mg Chl.a·h). And the ammonia nitrogen tolerance of Scenedesmus sp. FACHB-1229 was significantly higher than other strains, its growth rate was (0.30±0.08)/d when the ammonia nitrogen concentration reached up to 1888.60 mg/L. Moreover, the proportion of FACHB-1229 was consistently increased when co-cultured with FACHB-3550. In summary, FACHB-1229 has the superiority in interspecies competition with M. aeruginosa, its spent medium can inhibit the growth of M. aeruginosa, and it also has high ammonia nitrogen tolerance and photosynthetic oxygen evolution rate. Therefore, this study has provided the theory and application basis in prevention and control of cyanobacterial blooms using interspecific competition among algae. FACHB-1229 has the potential to control harmful algae through biological methods, it can grow rapidly in aquaculture pond or other polluted water bodies with high ammonia nitrogen concentration, while it can inhibit M. aeruginosa through allelopathy and provide dissolved oxygen at the same time.
,
Available online
, doi: 10.7541/2023.2022.0288
Abstract:
In order to provide a scientific basis for the large-scale application of rice-fish coculture technology, the study quantitatively analyzed the rice yield effects of rice-fish coculture in the world. 102 groups of rice yield data from published related literatures were sorted (up to December 31, 2021). Using the meta-analysis method, the comprehensive effect of rice-fish coculture on rice yield was clarified. The effects among different time, regions, field conditions, rice varieties, management methods of fertilizer, pesticide, fry stocking and feeding on rice yield were further quantified. Compared with rice monoculture, rice-fish coculture significantly increased rice yield, with an average increase rate of 17.2% (95% CI: 9.4%—25.6%). The analysis results were reliable. The results of subgroup analysis showed that there was significant difference in yield effect between different regions and climates, no significant difference between different yield estimation methods, and the yield effect was higher in foreign and tropical climate region. The yield increase rate of rice-fish coculture was relatively higher in the experimental fields where experiment was conducted after 2011, field ditch was arranged on one side (L1) and rice variety was Japonica. The yield effects of rice-fish coculture among different management methods of fertilizer and pesticide were significantly different, it was higher when fertilization times was three, fertilization pattern was single top fertilizer (TF), fertilization variety was organic and inorganic fertilizer (OIF) and pesticide was applied. On the premise of guaranteeing the yield increase effect, the application amount of fertilizer and pesticide could be appropriately reduced. Applying organic fertilizer (OF) and no pesticide could obtain dual benefits of economy and environment. The yield effects of rice-fish coculture were significantly different among fry stocking days, aquaculture models, fry densities and feeding strategies. When fish of single variety (MC) was stocked 21 to 25 days after rice transplanting without feed and the size, density and biomass were controlled within 40 g/tail, 1 tail/m2 and 30 g/m2, the rice-fish coculture had better yield increase effect. Rice-fish coculture can significantly increase rice yield, which is a feasible way to effectively utilize rice field resources.
In order to provide a scientific basis for the large-scale application of rice-fish coculture technology, the study quantitatively analyzed the rice yield effects of rice-fish coculture in the world. 102 groups of rice yield data from published related literatures were sorted (up to December 31, 2021). Using the meta-analysis method, the comprehensive effect of rice-fish coculture on rice yield was clarified. The effects among different time, regions, field conditions, rice varieties, management methods of fertilizer, pesticide, fry stocking and feeding on rice yield were further quantified. Compared with rice monoculture, rice-fish coculture significantly increased rice yield, with an average increase rate of 17.2% (95% CI: 9.4%—25.6%). The analysis results were reliable. The results of subgroup analysis showed that there was significant difference in yield effect between different regions and climates, no significant difference between different yield estimation methods, and the yield effect was higher in foreign and tropical climate region. The yield increase rate of rice-fish coculture was relatively higher in the experimental fields where experiment was conducted after 2011, field ditch was arranged on one side (L1) and rice variety was Japonica. The yield effects of rice-fish coculture among different management methods of fertilizer and pesticide were significantly different, it was higher when fertilization times was three, fertilization pattern was single top fertilizer (TF), fertilization variety was organic and inorganic fertilizer (OIF) and pesticide was applied. On the premise of guaranteeing the yield increase effect, the application amount of fertilizer and pesticide could be appropriately reduced. Applying organic fertilizer (OF) and no pesticide could obtain dual benefits of economy and environment. The yield effects of rice-fish coculture were significantly different among fry stocking days, aquaculture models, fry densities and feeding strategies. When fish of single variety (MC) was stocked 21 to 25 days after rice transplanting without feed and the size, density and biomass were controlled within 40 g/tail, 1 tail/m2 and 30 g/m2, the rice-fish coculture had better yield increase effect. Rice-fish coculture can significantly increase rice yield, which is a feasible way to effectively utilize rice field resources.
,
Available online
, doi: 10.7541/2022.2021.0307
Abstract:
Macroalgae farming is an essential part of offshore carbon sink. Large-scale macroalgae farming promotes the absorption of atmospheric CO2 by the ocean. As the primary producer of marine ecosystems, macroalgae can convert Dissolved Inorganic Carbon (DIC) into Organic Carbon (OC) through photosynthesis. Macroalgae can also release 20%—30% of photosynthesis products into seawater in the form of Dissolved Organic Carbon (DOC). According to estimates, the total amount of DOC released by macroalgae farming in China is about 822000 to 915000 tons, which can be transformed into 600000 tons of Recalcitrant Dissolved Organic Carbon (RDOC) every year through the action of Marine Microbial Carbon Pump (MCP). Therefore, seaweed culture plays a vital role in fisheries carbon sink. However, the synergistic effect of light and nutrients on DOC release by algae is still controversial. There are currently two hypotheses. One is the “overflow” hypothesis. Fogg believed that DOC release from algae was positively correlated with light intensity, which promoted the release of high molecular weight storage products. In Cherrier’s laboratory and field studies, the DOC release rate of planktonic algae was positively correlated with light intensity. After studying multiple experimental data on benthic algae, Barrón also found that the net DOC flux of benthic algae was positively correlated with light intensity. These reports show a significant correlation between light intensity and DOC release rate. Another hypothesis is “diffusion”. Bjornsen believes that the release rate of DOC from algae has nothing to do with light, but is closely related to the nutrient concentration. Nutrients promote the release of dissolved low molecules substances in algae. In Marañón’s algae culture experiment, there was no correlation between DOC release and light intensity. In the cross-experiment of light and nutrients carried out by Mueller, the correlation between DOC release of coral symbiotic algae and light disappeared when nutrients were added. The above studies show that light and nutrients are two critical environmental factors that regulate the release of DOC from algae. Saccharina japonica is the most important cluturing spcecies in China. According to statistics from the Food and Agriculture Organization of the United Nations (FAO), China had contributed 18% of the global S. japonica production in 2017.This study used juveniles of S. japonica as the research material and set up indoor crossover experiments based on the two factors of light and nutrient concentration. To explore the synergistic effect of light and nutrients on DOC release from macroalgae, we set up four experimental groups of natural sea water+50% sea surface light intensity, natural sea water+100% sea surface light intensity, and nutrient-enriched sea water+50% sea surface light intensity, nutrient-enriched sea water+100% sea surface light intensity, each group set up five parallel samples. Based on the above experimental conditions, the juveniles of S. japonica were cultured in a light incubator for 8h, and the water temperature was kept at (14±0.5)℃ during culture. The study found that under natural seawater conditions, the DOC rate of juveniles of S. japonica under 50% and 100% sea surface light intensity was (11.67±3.07) μmol/(g·h) and (22.65±4.58) μmol/(g·h), respectively. With the increase of light intensity, the DOC release rate was significantly improved (P＜0.05), a substantial increased in the net oxygen release rate (P＜0.05), and the difference of light spectrum slope was significant (P＜0.05). Under the condition of nutrient-enriched seawater, the DOC release rate of juveniles of S. japonica under 50% and 100% sea surface light intensity was (30.88±7.96) μmol/(g·h) and (39.03±14.78) μmol/(g·h). With the increase of light intensity, the DOC release rate was not significant improved (P＞0.05), the net oxygen release rate was significantly increased by 79.24% (P＜0.05), and there was no significant difference in light spectrum slope (P＞0.05).The results showed that under oligotrophic conditions (natural seawater), the DOC release rate of juveniles of S. japonica was positively correlated with the light intensity, indicating a “spillover” mechanism. Under eutrophic conditions (enriched seawater), the DOC release rate of juveniles of S. japonica was not related to the light intensity, which showed a “Diffusion” mechanism. The release of DOC from juveniles of S. japonica is regulated by two mechanisms, “spillover” and “diffusion”, which mechanism was dominant depends on the nutrient concentration.
Macroalgae farming is an essential part of offshore carbon sink. Large-scale macroalgae farming promotes the absorption of atmospheric CO2 by the ocean. As the primary producer of marine ecosystems, macroalgae can convert Dissolved Inorganic Carbon (DIC) into Organic Carbon (OC) through photosynthesis. Macroalgae can also release 20%—30% of photosynthesis products into seawater in the form of Dissolved Organic Carbon (DOC). According to estimates, the total amount of DOC released by macroalgae farming in China is about 822000 to 915000 tons, which can be transformed into 600000 tons of Recalcitrant Dissolved Organic Carbon (RDOC) every year through the action of Marine Microbial Carbon Pump (MCP). Therefore, seaweed culture plays a vital role in fisheries carbon sink. However, the synergistic effect of light and nutrients on DOC release by algae is still controversial. There are currently two hypotheses. One is the “overflow” hypothesis. Fogg believed that DOC release from algae was positively correlated with light intensity, which promoted the release of high molecular weight storage products. In Cherrier’s laboratory and field studies, the DOC release rate of planktonic algae was positively correlated with light intensity. After studying multiple experimental data on benthic algae, Barrón also found that the net DOC flux of benthic algae was positively correlated with light intensity. These reports show a significant correlation between light intensity and DOC release rate. Another hypothesis is “diffusion”. Bjornsen believes that the release rate of DOC from algae has nothing to do with light, but is closely related to the nutrient concentration. Nutrients promote the release of dissolved low molecules substances in algae. In Marañón’s algae culture experiment, there was no correlation between DOC release and light intensity. In the cross-experiment of light and nutrients carried out by Mueller, the correlation between DOC release of coral symbiotic algae and light disappeared when nutrients were added. The above studies show that light and nutrients are two critical environmental factors that regulate the release of DOC from algae. Saccharina japonica is the most important cluturing spcecies in China. According to statistics from the Food and Agriculture Organization of the United Nations (FAO), China had contributed 18% of the global S. japonica production in 2017.This study used juveniles of S. japonica as the research material and set up indoor crossover experiments based on the two factors of light and nutrient concentration. To explore the synergistic effect of light and nutrients on DOC release from macroalgae, we set up four experimental groups of natural sea water+50% sea surface light intensity, natural sea water+100% sea surface light intensity, and nutrient-enriched sea water+50% sea surface light intensity, nutrient-enriched sea water+100% sea surface light intensity, each group set up five parallel samples. Based on the above experimental conditions, the juveniles of S. japonica were cultured in a light incubator for 8h, and the water temperature was kept at (14±0.5)℃ during culture. The study found that under natural seawater conditions, the DOC rate of juveniles of S. japonica under 50% and 100% sea surface light intensity was (11.67±3.07) μmol/(g·h) and (22.65±4.58) μmol/(g·h), respectively. With the increase of light intensity, the DOC release rate was significantly improved (P＜0.05), a substantial increased in the net oxygen release rate (P＜0.05), and the difference of light spectrum slope was significant (P＜0.05). Under the condition of nutrient-enriched seawater, the DOC release rate of juveniles of S. japonica under 50% and 100% sea surface light intensity was (30.88±7.96) μmol/(g·h) and (39.03±14.78) μmol/(g·h). With the increase of light intensity, the DOC release rate was not significant improved (P＞0.05), the net oxygen release rate was significantly increased by 79.24% (P＜0.05), and there was no significant difference in light spectrum slope (P＞0.05).The results showed that under oligotrophic conditions (natural seawater), the DOC release rate of juveniles of S. japonica was positively correlated with the light intensity, indicating a “spillover” mechanism. Under eutrophic conditions (enriched seawater), the DOC release rate of juveniles of S. japonica was not related to the light intensity, which showed a “Diffusion” mechanism. The release of DOC from juveniles of S. japonica is regulated by two mechanisms, “spillover” and “diffusion”, which mechanism was dominant depends on the nutrient concentration.
,
Available online
, doi: 10.7541/2022.2021.0392
Abstract:
The genus Mytilus is not only of significant economic importance in aquaculture around the world but also shows strong tolerance to a wide range of environmental factors and is, therefore, used as a pollution indicator in coastal waters. Due to their filter-feeding habit, Mytilus accumulate large numbers of bacteria from the water. However, Mytilus appear less affected or unharmed by the syndromes and infectious agents that distress other bivalves. The immunity of Mytilus has received increased attention in the last decade, resulting in a valuable increase in the availability of its molecular components for controlling invasive microbes. In which, Mytilus antimicrobial peptides have strong molecular diversity, and therefor become the important object of antimicrobial peptide research. In this study, two novel antimicrobial peptides, myticalin and mytimacin, were identified from the transcriptomic data of M. coruscus hemocytes. However, the molecular features and the immune mechanism of these mussel defensins are unknown. For understanding the relationship of structure-function of myticalin and mytimacin, the two peptides were synthesized by a solid phase polypeptides chemical synthesis technology, and the functions of these two peptides were studied in vivo, including antimicrobial activities against various bacteria and fungus and erythrotoxicity against sheep red blood cell. Further, the mechanism of these two peptides inhibiting microbes were observed using scanning electron microscope. For exploring the immune responses of these two peptides against various bacteria and fungus, the mussel was induced by Staphylococcus aureus, Vibrio alginolyticus and Candida albicans, respectively, and the relative expression level of myticalin and mytimacin were calculated by real-time fluorescent quantitative PCR. The results indicated that, mytimacin of M. coruscus has classical features similar to those of other Mytilus antimicrobial peptides, containing cysteine and disulfide bonds, and thus forming a cysteine stabled α/β structure. While the myticalin is an antimicrobial peptide without cysteine and disulfide bonds, and forms a structure dominated by random coil. Similar changes of surface structure of tested microbes were observed under SEM for both myticalin and mytimacin, in which, agglutination of S. aureus and flake bulge of V. alginolyticus were presented under both myticalin and mytimacin treatment. In addition, holes can be observed for C. albicans after incubation with mytimacin, while no morphological alteration can be observed for C. albicans after incubation with myticalin. Both myticalin and mytimacin showed no erythrotoxicity for sheep red bloods. Moreover, the dynamic changes in the expression level of two peptides after microbial induction were examined, and the results showed a marked increase in relative expression level observed in vivo for both myticalin and mytimacin genes after microbial challenge relative to the respective controls. We noticed that challenges with Gram-positive S. aureus resulted in general up-regulation of myticalin gene expression with more than 7-fold change from 1h to 12h post-induction, indicating a high sensitivity of myticalin to Gram-positive bacteria. Similarly, mytimacin also showed a significant up-relation after S. aureus induction, with a significant up-regulation of gene expression with a more than 2.8-fold change from 2h to 8h post-induction. However, Gram-negative V. alginolyticus only induced a slight up-relation for the expression level of both myticalin and mytimacin genes, with less than 4-fold change and only two time points (2h and 4h for myticalin, and 4h and 8h for mytimacin). These results indicated that both myticalin and mytimacin were relatively insensitive to Gram-negative strains. Interestingly, mytimacin also showed a relative sensitivity to C. albicans, with the high up-regulation can be observed during 2h to 8h post-induction with an up-regulation of more than 3-fold change. Considering that myticalin and mytimacin showed differing sensitivities to different microbes, we might thus speculate that Mytilus would adopt a friendlier attitude towards Gram-negative bacteria, and the weaker mussel AMP response to Gram-negative bacteria may be related to the greater abundance of Gram-negative bacteria in the marine environment. If the mussel responded to all Gram-negative stimuli with high intensity, they could be in danger of high inflammatory stress. In addition, these observations strongly suggested the existence of different recognition mechanisms or signal transduction pathways in mussels for the expression of myticalin and mytimacin. These results provided basis for understanding the molecule mechanism of Mytilus immunology, and the function of novel Mytilus antimicrobial peptides, and thusly provided basis for the molecular resource development of mussel antimicrobial peptides.
The genus Mytilus is not only of significant economic importance in aquaculture around the world but also shows strong tolerance to a wide range of environmental factors and is, therefore, used as a pollution indicator in coastal waters. Due to their filter-feeding habit, Mytilus accumulate large numbers of bacteria from the water. However, Mytilus appear less affected or unharmed by the syndromes and infectious agents that distress other bivalves. The immunity of Mytilus has received increased attention in the last decade, resulting in a valuable increase in the availability of its molecular components for controlling invasive microbes. In which, Mytilus antimicrobial peptides have strong molecular diversity, and therefor become the important object of antimicrobial peptide research. In this study, two novel antimicrobial peptides, myticalin and mytimacin, were identified from the transcriptomic data of M. coruscus hemocytes. However, the molecular features and the immune mechanism of these mussel defensins are unknown. For understanding the relationship of structure-function of myticalin and mytimacin, the two peptides were synthesized by a solid phase polypeptides chemical synthesis technology, and the functions of these two peptides were studied in vivo, including antimicrobial activities against various bacteria and fungus and erythrotoxicity against sheep red blood cell. Further, the mechanism of these two peptides inhibiting microbes were observed using scanning electron microscope. For exploring the immune responses of these two peptides against various bacteria and fungus, the mussel was induced by Staphylococcus aureus, Vibrio alginolyticus and Candida albicans, respectively, and the relative expression level of myticalin and mytimacin were calculated by real-time fluorescent quantitative PCR. The results indicated that, mytimacin of M. coruscus has classical features similar to those of other Mytilus antimicrobial peptides, containing cysteine and disulfide bonds, and thus forming a cysteine stabled α/β structure. While the myticalin is an antimicrobial peptide without cysteine and disulfide bonds, and forms a structure dominated by random coil. Similar changes of surface structure of tested microbes were observed under SEM for both myticalin and mytimacin, in which, agglutination of S. aureus and flake bulge of V. alginolyticus were presented under both myticalin and mytimacin treatment. In addition, holes can be observed for C. albicans after incubation with mytimacin, while no morphological alteration can be observed for C. albicans after incubation with myticalin. Both myticalin and mytimacin showed no erythrotoxicity for sheep red bloods. Moreover, the dynamic changes in the expression level of two peptides after microbial induction were examined, and the results showed a marked increase in relative expression level observed in vivo for both myticalin and mytimacin genes after microbial challenge relative to the respective controls. We noticed that challenges with Gram-positive S. aureus resulted in general up-regulation of myticalin gene expression with more than 7-fold change from 1h to 12h post-induction, indicating a high sensitivity of myticalin to Gram-positive bacteria. Similarly, mytimacin also showed a significant up-relation after S. aureus induction, with a significant up-regulation of gene expression with a more than 2.8-fold change from 2h to 8h post-induction. However, Gram-negative V. alginolyticus only induced a slight up-relation for the expression level of both myticalin and mytimacin genes, with less than 4-fold change and only two time points (2h and 4h for myticalin, and 4h and 8h for mytimacin). These results indicated that both myticalin and mytimacin were relatively insensitive to Gram-negative strains. Interestingly, mytimacin also showed a relative sensitivity to C. albicans, with the high up-regulation can be observed during 2h to 8h post-induction with an up-regulation of more than 3-fold change. Considering that myticalin and mytimacin showed differing sensitivities to different microbes, we might thus speculate that Mytilus would adopt a friendlier attitude towards Gram-negative bacteria, and the weaker mussel AMP response to Gram-negative bacteria may be related to the greater abundance of Gram-negative bacteria in the marine environment. If the mussel responded to all Gram-negative stimuli with high intensity, they could be in danger of high inflammatory stress. In addition, these observations strongly suggested the existence of different recognition mechanisms or signal transduction pathways in mussels for the expression of myticalin and mytimacin. These results provided basis for understanding the molecule mechanism of Mytilus immunology, and the function of novel Mytilus antimicrobial peptides, and thusly provided basis for the molecular resource development of mussel antimicrobial peptides.
,
Available online
, doi: 10.7541/2022.2021.0286
Abstract:
Penaeus monodon (African group) is a new cultured prawn species, which has good development prospects. At present, aquaculture diseases are seriously affecting the health of prawn farming. Based on physiological characteristics of intestinal bacteria in P. monodon, the experimental study was carried out to provide new treatments for acute hepatopancreas necrosis syndrome (AHPND). The dominant intestinal strains in healthy P. monodon were isolated and purified. Using pathogenic Vibrio harveyi as indicator bacteria, antagonistic bacteria were screened from the strains by the Oxford cup method. To identify these antagonistic bacteria, high-throughput sequencing technology was used as the main method. Biolog microbe identification system was also used to identify the strains. These two methods were supplemented by biochemical characteristic tests. To evaluate the safety of antagonistic strains, the drug susceptibility test was carried out in the study. The basic drug resistance information of intestinal bacteria was obtained by this test. According to the drug resistance information, antagonistic strains with high drug sensitivity were selected. The growth curve of the hypersensitive antagonistic strain was plotted to show its growth characteristics. The activity of extracellular enzymes of potential probiotics was calculated. As a result, sixteen dominant indigenous strains were isolated from the intestinal tract of P. monodon. The three antagonistic strains which were named as P.m-1, P.m-9, P.m-13. P.m-1, P.m-9 and P.m-13 were identified as Bacillus subtilis, Enterococcus faecium and Vibrio alginolyticus, respectively. The results of drug sensitivity tests showed that they were not intestinal drug-resistant bacteria, and P.m-1 was highly sensitive to drugs. P.m-1 entered the exponential growth stage from the 2nd hour, and reached the growth peak at the 10th hour. The maximum concentration of P.m-1 was 1.14×109 cfu/mL, which indicated that P.m-1 had the strong vitality. After protease activity determination, P.m-1 was considered as a strain that had the strong protease production capacity, which could provide a basis for digestion or purification of the environment. P.m-1 has the potential to become probiotics, which could contribute to the prevention and treatment of acute hepatopancreas necrosis syndrome. The experiment would provide the theoretical basis for functional feed additives from the perspective of intestinal microecology.
Penaeus monodon (African group) is a new cultured prawn species, which has good development prospects. At present, aquaculture diseases are seriously affecting the health of prawn farming. Based on physiological characteristics of intestinal bacteria in P. monodon, the experimental study was carried out to provide new treatments for acute hepatopancreas necrosis syndrome (AHPND). The dominant intestinal strains in healthy P. monodon were isolated and purified. Using pathogenic Vibrio harveyi as indicator bacteria, antagonistic bacteria were screened from the strains by the Oxford cup method. To identify these antagonistic bacteria, high-throughput sequencing technology was used as the main method. Biolog microbe identification system was also used to identify the strains. These two methods were supplemented by biochemical characteristic tests. To evaluate the safety of antagonistic strains, the drug susceptibility test was carried out in the study. The basic drug resistance information of intestinal bacteria was obtained by this test. According to the drug resistance information, antagonistic strains with high drug sensitivity were selected. The growth curve of the hypersensitive antagonistic strain was plotted to show its growth characteristics. The activity of extracellular enzymes of potential probiotics was calculated. As a result, sixteen dominant indigenous strains were isolated from the intestinal tract of P. monodon. The three antagonistic strains which were named as P.m-1, P.m-9, P.m-13. P.m-1, P.m-9 and P.m-13 were identified as Bacillus subtilis, Enterococcus faecium and Vibrio alginolyticus, respectively. The results of drug sensitivity tests showed that they were not intestinal drug-resistant bacteria, and P.m-1 was highly sensitive to drugs. P.m-1 entered the exponential growth stage from the 2nd hour, and reached the growth peak at the 10th hour. The maximum concentration of P.m-1 was 1.14×109 cfu/mL, which indicated that P.m-1 had the strong vitality. After protease activity determination, P.m-1 was considered as a strain that had the strong protease production capacity, which could provide a basis for digestion or purification of the environment. P.m-1 has the potential to become probiotics, which could contribute to the prevention and treatment of acute hepatopancreas necrosis syndrome. The experiment would provide the theoretical basis for functional feed additives from the perspective of intestinal microecology.
,
Available online
, doi: 10.7541/2022.2021.0388
Abstract:
In order to investigate the immune response mechanism of large yellow croaker (Larimichthys crocea) against Vibrio alginolyticus infection, the transcriptome changes in head kidney 24h after infection were analyzed by high-throughput sequencing and bioinformatic analysis. A total of 1 903 differentially expressed genes (DEGs) were obtained, of which 641 were up-regulated and 1262 were down-regulated. After Gene Ontology (GO) and Kyoto encyclopedia of genes and genomes (KEGG) enrichment analysis, the results showed that some innate immune-related genes, including complement (C1qbp, C1QL2 and C7), heat shock protein (hspd1, hspa4, hspa5 and hspa9), antimicrobial peptide (Hepcidin-1), C-type lectin receptor (Clec4e and MR1), hexokinase (hex1), arginase (Arg-II), and Tu translation elongation factor (TUFM) were significantly up-regulated. While many adaptive immune-related genes, including T and B cell proliferation and differentiation (FcR5 and CCL17), T cell regulatory factors (TCRα, TCRβ, CD3ε, CD3γδ, CD3ζ, ZAP-70 and ITK), and antigen recognition factors of Immunoglobulin (Ighv 5A, Ighv 914 and Ighv XIG14) were significantly down-regulated. Besides, GO terms related to aerobic metabolism, like Hemoglobin complex, Oxygen binding and Oxygen carrier activity also got significant enrichment, of which all DEGs were down-regulated in infection group. The results indicated that in the early stage of V. alginolyticus infection, the innate immunity of large yellow croaker was activated, while the adaptive immunity was inhibited. Since the late activation of adaptive immunity, in early stage of bacterial infection, the blocking of TCR signal pathway, and the inhibition of proliferation and differentiation of specific immonocytes might save enough energy for innate immunity, which was beneficial to the immune response of fish against bacterial infection. Our results also showed that after V. alginolyticus infection, oxygen transfer ability of large yellow croaker was decreased, which might be related to the hemolytic activity of the bacterium.
In order to investigate the immune response mechanism of large yellow croaker (Larimichthys crocea) against Vibrio alginolyticus infection, the transcriptome changes in head kidney 24h after infection were analyzed by high-throughput sequencing and bioinformatic analysis. A total of 1 903 differentially expressed genes (DEGs) were obtained, of which 641 were up-regulated and 1262 were down-regulated. After Gene Ontology (GO) and Kyoto encyclopedia of genes and genomes (KEGG) enrichment analysis, the results showed that some innate immune-related genes, including complement (C1qbp, C1QL2 and C7), heat shock protein (hspd1, hspa4, hspa5 and hspa9), antimicrobial peptide (Hepcidin-1), C-type lectin receptor (Clec4e and MR1), hexokinase (hex1), arginase (Arg-II), and Tu translation elongation factor (TUFM) were significantly up-regulated. While many adaptive immune-related genes, including T and B cell proliferation and differentiation (FcR5 and CCL17), T cell regulatory factors (TCRα, TCRβ, CD3ε, CD3γδ, CD3ζ, ZAP-70 and ITK), and antigen recognition factors of Immunoglobulin (Ighv 5A, Ighv 914 and Ighv XIG14) were significantly down-regulated. Besides, GO terms related to aerobic metabolism, like Hemoglobin complex, Oxygen binding and Oxygen carrier activity also got significant enrichment, of which all DEGs were down-regulated in infection group. The results indicated that in the early stage of V. alginolyticus infection, the innate immunity of large yellow croaker was activated, while the adaptive immunity was inhibited. Since the late activation of adaptive immunity, in early stage of bacterial infection, the blocking of TCR signal pathway, and the inhibition of proliferation and differentiation of specific immonocytes might save enough energy for innate immunity, which was beneficial to the immune response of fish against bacterial infection. Our results also showed that after V. alginolyticus infection, oxygen transfer ability of large yellow croaker was decreased, which might be related to the hemolytic activity of the bacterium.
,
Available online
, doi: 10.7541/2022.2021.0354
Abstract:
Interleukin (IL) 10 is synthesised and secreted mainly by type 2 innate lymphoid cells (ILC2) and T helper 2 cells (Th2) and regulates the growth, proliferation and differentiation of immune cells such as T cells, B cells, monocytes/macrophages and dendritic cells. It plays an important role in regulating immune response and maintaining immune homeostasis by synergizing with other cytokines. In this study, a plasmid pET-21d-CiIL-10 was constructed for expression of the recombinant protein in the Escherichia coli (E. coli) Rosetta (DE3) cells. After induction with IPTG, the recombinant protein of grass carp (Ctenopharyngodon idella, Ci) IL-10 was found in the inclusion bodies. After denaturation with 6M guanidine hydrochloride and refolding, the CiIL-10 protein was purified by size exclusion chromatography and analyzed by SDS-PAGE. The results showed that a single band of the CiIL-10 protein was visualized, confirming that the protein was pure. The recombinant CiIL-10 protein was then used to immunize mice to generate monoclonal antibodies. Four monoclonal antibodies were obtained, among which two could recognize the CiIL-10 protein expressed in the HEK293 cells. One monoclonal antibody was selected for purification and further analyzed by confocal microscopy and flow cytometry. It was shown that the CiIL-10 monoclonal antibody could react with the recombinant CiIL-10 protein expressed in the E. coli cells and HEK293 cells. In addition, confocal microscopic analysis revealed that the monoclonal antibody could detect the native CiIL-10 protein in the grass carp ovary (GCO) cells treated with PBS, lipopolysaccharide (LPS) or CiIL-1β for 36h. Interestingly, compared to the control group (PBS), the numbers of CiIL-10 producing cells remained largely unchanged after stimulation with LPS or CiIL-1β. In summary, high purity of the recombinant CiIL-10 protein was obtained from the E. coli cells and the CiIL-10 monoclonal antibody generated is highly specific. It is expected that the CiIL-10 monoclonal antibody will have great potential to be used in detection of IL-10 in grass carp by Western blotting, enzyme linked immunosorbent assay (ELISA), flow cytometry and confocal microscopy.
Interleukin (IL) 10 is synthesised and secreted mainly by type 2 innate lymphoid cells (ILC2) and T helper 2 cells (Th2) and regulates the growth, proliferation and differentiation of immune cells such as T cells, B cells, monocytes/macrophages and dendritic cells. It plays an important role in regulating immune response and maintaining immune homeostasis by synergizing with other cytokines. In this study, a plasmid pET-21d-CiIL-10 was constructed for expression of the recombinant protein in the Escherichia coli (E. coli) Rosetta (DE3) cells. After induction with IPTG, the recombinant protein of grass carp (Ctenopharyngodon idella, Ci) IL-10 was found in the inclusion bodies. After denaturation with 6M guanidine hydrochloride and refolding, the CiIL-10 protein was purified by size exclusion chromatography and analyzed by SDS-PAGE. The results showed that a single band of the CiIL-10 protein was visualized, confirming that the protein was pure. The recombinant CiIL-10 protein was then used to immunize mice to generate monoclonal antibodies. Four monoclonal antibodies were obtained, among which two could recognize the CiIL-10 protein expressed in the HEK293 cells. One monoclonal antibody was selected for purification and further analyzed by confocal microscopy and flow cytometry. It was shown that the CiIL-10 monoclonal antibody could react with the recombinant CiIL-10 protein expressed in the E. coli cells and HEK293 cells. In addition, confocal microscopic analysis revealed that the monoclonal antibody could detect the native CiIL-10 protein in the grass carp ovary (GCO) cells treated with PBS, lipopolysaccharide (LPS) or CiIL-1β for 36h. Interestingly, compared to the control group (PBS), the numbers of CiIL-10 producing cells remained largely unchanged after stimulation with LPS or CiIL-1β. In summary, high purity of the recombinant CiIL-10 protein was obtained from the E. coli cells and the CiIL-10 monoclonal antibody generated is highly specific. It is expected that the CiIL-10 monoclonal antibody will have great potential to be used in detection of IL-10 in grass carp by Western blotting, enzyme linked immunosorbent assay (ELISA), flow cytometry and confocal microscopy.
,
Available online
, doi: 10.7541/2023.2022.0198
Abstract:
Chinese giant salamander (Andrias davidianus) is a national second-class key protected species. Wild giant salamanders mostly inhabit in mountain streams. They are widely distributed in Qinling Mountains of Shaanxi Province, China. There are three species of giant salamander namely Chinese giant salamander (A. davidianus), American giant salamander (Cryptobranchus alleganiensis) and Japanese giant salamander (A. japonicus). The septicemia of giant salamander caused by Aeromonas hydrophila is one of the common diseases. A. hydrophila is a common aquatic bacterium, which exists in natural water, but usually does not cause diseases. Only when the immunity of aquatic animals decreases, it is possible to infect the body through the digestive tract or skin wounds. Therefore, if it can enhance the activity of immune cells and immune molecules and improve its autoimmunity, it can effectively block the infection pathway of A. hydrophila and reduce the incidence of sepsis. Most of the used methods of Chinese herbal medicine in aquaculture are direct feeding of crude drugs, and there is no extraction and concentration of immunoactive components. Reports from the poultry industry believe that licorice has immunomodulatory effect on the body, but there is no report on the effect of licorice on the anti-disease ability of amphibian giant salamander. This study carried out this exploration after targeted extraction of the effective components of licorice.The effect of licorice on the anti-A. hydrophila infection of giant salamander was studied by feeding licorice extract to giant salamander. The results showed that from day 28 after continuous feeding, the serum lysozyme activity in the drug group increased firstly and then decreased, showing a parabolic trend. The maximum value was (158.4±34.7) U/mL in the low-dose group on day 42 and (178.3±28.8) U/mL in the high-dose group on day 35, both of which were significantly higher than those in the control group in the same period (P<0.05). The phagocytic activity of renal macrophages in the drug group was significantly higher than that in the control group at the last two sampling periods, i.e. 42d and 56d (P<0.05). The maximum values of low dose group and high dose group appeared at 42 days, which were (59.4±8.5)% and (58.4±5.2)% respectively. Compared with the same period, the leukocyte volume of the drug group was higher than that of the control group. Among them, the leukocyte specific volume of the high-dose group was (5.8±1.7)%, the low-dose group was (5.5±0.8)%, and the high-dose group was (5.9±1.7)%, which were significantly higher than those of the control group at the same time (P<0.05). There was no significant difference in spleen organ coefficient between the drug group and the control group. After the last sampling (56d), the mortality of the control group was 90%, and that of the low-dose group and the high-dose group were 60%, which were lower than that of the control group, while the immune protection rate of the drug group was 33.3%, which was also higher than that of the control group. The results showed that feeding licorice extract could improve the resistance of giant salamander to A. hydrophila to a certain extent.Chinese herbal medicine can indirectly affect the synthesis of protein by affecting the self replication of bacterial DNA and inhibiting its reproduction and growth, and finally inhibit the growth of bacteria. In terms of nonspecific immune defense function of the body, lysozyme, leukocytes and macrophages are extremely important immune molecules and immune cells. They can kill and effectively protect the body by dissolving or swallowing foreign pathogens. In this experiment, licorice improved the survival rate of giant salamander infected by A. hydrophila. At the same time, the activity of serum lysozyme, the number of leukocytes and the phagocytic activity of macrophages increased. Is there a correlation between them? Is the improvement of the survival rate of giant salamander caused by the improvement of these indicators, or is it caused by the fact that Chinese herbal medicine affects the synthesis of bacterial DNA and thus the synthesis of bacterial protein? Further research is needed.
Chinese giant salamander (Andrias davidianus) is a national second-class key protected species. Wild giant salamanders mostly inhabit in mountain streams. They are widely distributed in Qinling Mountains of Shaanxi Province, China. There are three species of giant salamander namely Chinese giant salamander (A. davidianus), American giant salamander (Cryptobranchus alleganiensis) and Japanese giant salamander (A. japonicus). The septicemia of giant salamander caused by Aeromonas hydrophila is one of the common diseases. A. hydrophila is a common aquatic bacterium, which exists in natural water, but usually does not cause diseases. Only when the immunity of aquatic animals decreases, it is possible to infect the body through the digestive tract or skin wounds. Therefore, if it can enhance the activity of immune cells and immune molecules and improve its autoimmunity, it can effectively block the infection pathway of A. hydrophila and reduce the incidence of sepsis. Most of the used methods of Chinese herbal medicine in aquaculture are direct feeding of crude drugs, and there is no extraction and concentration of immunoactive components. Reports from the poultry industry believe that licorice has immunomodulatory effect on the body, but there is no report on the effect of licorice on the anti-disease ability of amphibian giant salamander. This study carried out this exploration after targeted extraction of the effective components of licorice.The effect of licorice on the anti-A. hydrophila infection of giant salamander was studied by feeding licorice extract to giant salamander. The results showed that from day 28 after continuous feeding, the serum lysozyme activity in the drug group increased firstly and then decreased, showing a parabolic trend. The maximum value was (158.4±34.7) U/mL in the low-dose group on day 42 and (178.3±28.8) U/mL in the high-dose group on day 35, both of which were significantly higher than those in the control group in the same period (P<0.05). The phagocytic activity of renal macrophages in the drug group was significantly higher than that in the control group at the last two sampling periods, i.e. 42d and 56d (P<0.05). The maximum values of low dose group and high dose group appeared at 42 days, which were (59.4±8.5)% and (58.4±5.2)% respectively. Compared with the same period, the leukocyte volume of the drug group was higher than that of the control group. Among them, the leukocyte specific volume of the high-dose group was (5.8±1.7)%, the low-dose group was (5.5±0.8)%, and the high-dose group was (5.9±1.7)%, which were significantly higher than those of the control group at the same time (P<0.05). There was no significant difference in spleen organ coefficient between the drug group and the control group. After the last sampling (56d), the mortality of the control group was 90%, and that of the low-dose group and the high-dose group were 60%, which were lower than that of the control group, while the immune protection rate of the drug group was 33.3%, which was also higher than that of the control group. The results showed that feeding licorice extract could improve the resistance of giant salamander to A. hydrophila to a certain extent.Chinese herbal medicine can indirectly affect the synthesis of protein by affecting the self replication of bacterial DNA and inhibiting its reproduction and growth, and finally inhibit the growth of bacteria. In terms of nonspecific immune defense function of the body, lysozyme, leukocytes and macrophages are extremely important immune molecules and immune cells. They can kill and effectively protect the body by dissolving or swallowing foreign pathogens. In this experiment, licorice improved the survival rate of giant salamander infected by A. hydrophila. At the same time, the activity of serum lysozyme, the number of leukocytes and the phagocytic activity of macrophages increased. Is there a correlation between them? Is the improvement of the survival rate of giant salamander caused by the improvement of these indicators, or is it caused by the fact that Chinese herbal medicine affects the synthesis of bacterial DNA and thus the synthesis of bacterial protein? Further research is needed.
,
Available online
, doi: 10.7541/2022.2021.0335
Abstract:
Largemouth bass (Micropterus salmoides) has been widely cultured in many countries and has become an important freshwater product in Chinese aquaculture. In recent years, germplasm degradation and disease resistance are caused by inbreeding and intensive breeding. In order to control and cure diseases caused by microorganisms, antibiotics are widely used. However, the overuse of antibiotics caused the problem of antimicrobial resistance and food safety. β-defensin is an important natural immune factor, and it has efficient and broad-spectrum antimicrobial activity which plays an extremely important role in host defense system. In this study, we focused on expressing recombinant protein of β-defensin of Micropterus salmoides (MSBdefe) by baculovirus expression vector system, and preliminarily evaluated its bacteriostatic effect. First, we characterized MSBdefe and our results showed that it shared the highest amino acid sequence identity (98.14%) with Dicentrarchus labrax. Multiple sequence alignments showed that MSBdefe has six highly conserved cysteine residues which is similar to β-defensin in other species. We synthesized MSBdefe gene with codons optimized for inset cells expression. With the insect codon optimization synthesis of MSBdefe gene, it was recombined into baculovirus shuttle vector pYBDM-IM plasmid by double restriction enzyme digestion and ligationlinking methods. The recombinant plasmid MSBdefe-pYBDM-IM was transformed into the competent cell MultiBac/rSW106/asd-/inv+. We screened bacterial colonies using blue/white screening with X-Gal and IPTG and Gm/Kan/Dap/TeT/Spe antibiotics occurred by identifying a white spot and confirmed positive colonies by PCR. The positive recombinant strain MSBdefe-pYBDM-IM-AM was directly used to infect Sf9 cells. Red fluorescence was observed under fluorescence microscope for 72h after infection which confirmed successful production of to obtain recombinant baculovirus AV-MSBdefe. The high titer of AV-MSBdefe was obtained in the supernatant by through multiple rounds of infection. SDS-PAGE and Western-Blot confirmed presence of a 12.2 kD recombinant MSBdefe protein were used to detect the protein expression of Sf9 cells infected with AV-MSBdefe, and the protein with molecular weight of 12.2 kD was obtained. The recombinant protein was purified through Ni-chelating affinity chromatography. The concentration Concentration of purified protein was detected by BCA protein concentration method. Spread plate count method was used to detect the bacteriostatic activity of recombinant protein against Aeromonas hydrophila, which is the most common pathogen in freshwater fish. The results showed that when the final concentration of recombinant protein MSBdefe was 30 μg/mL, the bacteriostatic efficiency was 83.00%, and when the concentration was 15 and 7.5 μg/mL, the bacteriostatic efficiencies were 54.33% and 33.67%, respectively.β-defensin has broad application prospects. However, it is challenging to produce it through genetic engineering approach. Although the β-defensin has been successfully expressed in the prokaryotic cell system, recombinant β-defensin produced this way is not biologically active because of lacking of post-translational modification in prokaryotic cells. Eukaryotic yeast expression system offers high protein yield, lesser expression time, post translational modifications and requires simple media. But there are still limitations in the yeast expression system such as the secretion efficiency of this system is low and the excessive glycosylation problems. Baculovirus expression system is mainly used to express recombinant proteins in insect cells. As the insect cells carry out posttranslational processing of proteins similar to that of mammalian cells, the protein can be expressed and fold correctly, and are close to natural products in terms of biological activity, antigenicity and immunity. Moreover, due to the presence of polyhedron strong promoter Polh and P10, high level of recombinant protein expression can be obtained. The recombinant protein system in this study is based on Zero-background Tn7-mediated transposition in Escherichia coli. One advantage of baculovirus system is that recombinant bacmid DNA can be transfected into insect cells or injected directly into the instar larvae for virus production and protein expression. Thus, the system provides a way of efficient generation of recombinant baculovirus and a more convenient method of expressing recombinant protein in insect cell and larvae.In conclusion, the baculovirus system vector of MSBdefe was constructed, and recombinant MSBdefe was successfully expressed and purified. The recombinant MSBdefe protein had an obvious antibacterial effect on Aeromonas hydrophila. The results of this study lay a foundation for the large-scale production of fish β-defensin using insect bioreactors. Our results also show that MSBdefe is a good candidate for natural antibacterial agents that can replace or partially replace antibiotics.
Largemouth bass (Micropterus salmoides) has been widely cultured in many countries and has become an important freshwater product in Chinese aquaculture. In recent years, germplasm degradation and disease resistance are caused by inbreeding and intensive breeding. In order to control and cure diseases caused by microorganisms, antibiotics are widely used. However, the overuse of antibiotics caused the problem of antimicrobial resistance and food safety. β-defensin is an important natural immune factor, and it has efficient and broad-spectrum antimicrobial activity which plays an extremely important role in host defense system. In this study, we focused on expressing recombinant protein of β-defensin of Micropterus salmoides (MSBdefe) by baculovirus expression vector system, and preliminarily evaluated its bacteriostatic effect. First, we characterized MSBdefe and our results showed that it shared the highest amino acid sequence identity (98.14%) with Dicentrarchus labrax. Multiple sequence alignments showed that MSBdefe has six highly conserved cysteine residues which is similar to β-defensin in other species. We synthesized MSBdefe gene with codons optimized for inset cells expression. With the insect codon optimization synthesis of MSBdefe gene, it was recombined into baculovirus shuttle vector pYBDM-IM plasmid by double restriction enzyme digestion and ligationlinking methods. The recombinant plasmid MSBdefe-pYBDM-IM was transformed into the competent cell MultiBac/rSW106/asd-/inv+. We screened bacterial colonies using blue/white screening with X-Gal and IPTG and Gm/Kan/Dap/TeT/Spe antibiotics occurred by identifying a white spot and confirmed positive colonies by PCR. The positive recombinant strain MSBdefe-pYBDM-IM-AM was directly used to infect Sf9 cells. Red fluorescence was observed under fluorescence microscope for 72h after infection which confirmed successful production of to obtain recombinant baculovirus AV-MSBdefe. The high titer of AV-MSBdefe was obtained in the supernatant by through multiple rounds of infection. SDS-PAGE and Western-Blot confirmed presence of a 12.2 kD recombinant MSBdefe protein were used to detect the protein expression of Sf9 cells infected with AV-MSBdefe, and the protein with molecular weight of 12.2 kD was obtained. The recombinant protein was purified through Ni-chelating affinity chromatography. The concentration Concentration of purified protein was detected by BCA protein concentration method. Spread plate count method was used to detect the bacteriostatic activity of recombinant protein against Aeromonas hydrophila, which is the most common pathogen in freshwater fish. The results showed that when the final concentration of recombinant protein MSBdefe was 30 μg/mL, the bacteriostatic efficiency was 83.00%, and when the concentration was 15 and 7.5 μg/mL, the bacteriostatic efficiencies were 54.33% and 33.67%, respectively.β-defensin has broad application prospects. However, it is challenging to produce it through genetic engineering approach. Although the β-defensin has been successfully expressed in the prokaryotic cell system, recombinant β-defensin produced this way is not biologically active because of lacking of post-translational modification in prokaryotic cells. Eukaryotic yeast expression system offers high protein yield, lesser expression time, post translational modifications and requires simple media. But there are still limitations in the yeast expression system such as the secretion efficiency of this system is low and the excessive glycosylation problems. Baculovirus expression system is mainly used to express recombinant proteins in insect cells. As the insect cells carry out posttranslational processing of proteins similar to that of mammalian cells, the protein can be expressed and fold correctly, and are close to natural products in terms of biological activity, antigenicity and immunity. Moreover, due to the presence of polyhedron strong promoter Polh and P10, high level of recombinant protein expression can be obtained. The recombinant protein system in this study is based on Zero-background Tn7-mediated transposition in Escherichia coli. One advantage of baculovirus system is that recombinant bacmid DNA can be transfected into insect cells or injected directly into the instar larvae for virus production and protein expression. Thus, the system provides a way of efficient generation of recombinant baculovirus and a more convenient method of expressing recombinant protein in insect cell and larvae.In conclusion, the baculovirus system vector of MSBdefe was constructed, and recombinant MSBdefe was successfully expressed and purified. The recombinant MSBdefe protein had an obvious antibacterial effect on Aeromonas hydrophila. The results of this study lay a foundation for the large-scale production of fish β-defensin using insect bioreactors. Our results also show that MSBdefe is a good candidate for natural antibacterial agents that can replace or partially replace antibiotics.
,
Available online
, doi: 10.7541/2021.2021.039
Abstract:
Periphyton algae are one of the main groups of organisms in the aquatic ecosystem. They are self-sustaining and can store solar energy by converting it into chemical energy through photosynthesis, as well as generate and release oxygen to promote the material circulation, energy flow and information transfer of the aquatic ecosystem. Periphyton algae are rich in species, attached growth, short life cycle, sensitive to changes in the water environment, and can absorb pollutants in water bodies and purify water quality. They are the beginning of the food chain in the water ecosystem and an important indicator species for water quality monitoring, and often used to the health evaluation of aquatic ecosystems. The Yarlung Zangbo River Basin has high average altitude, low water temperature, and strong ultraviolet radiation, which is the most important natural aquatic ecosystem in Tibet Autonomous Region. It can adjust the climate characteristics of Tibet Autonomous Region and has special geomorphological and ecological conditions that many low altitude rivers do not have, the ecological environment is very sensitive and fragile, and it is highly susceptible to events such as global climate change and human disturbance. Ensuring its water environment has a high health status is an important foundation for protecting green mountains and rivers. In order to assess the health status of the water ecosystem, 26 sampling points were set up on the main stream and four major tributaries of the Yarlung Zangbo River Basin from 2013 to 2014. The environmental data and the periphyton algae community were collected, and the periphytic index of biological integrity (P-IBI) were constructed. A total of 7 phyla, 10 classes, 23 orders, 34 families and 70 genera (species) of periphyton were identified, most of which were Bacillariophyta (35.71%), Chlorophyta (32.86%) and Cyanophyta (20.00%), and the dominant species of periphyton algae were the Bacillariophyta belonging to Bacillariophyta-chlorophyta-cyanophyta type of water. The species richness and total abundance of periphyton algae in the mainstream were slightly lower than those of the tributaries of the Yarlung Zangbo River Basin. The Shannon-Wiener diversity index varied from 4.84 to 9.41, and the Pielou evenness index varied from 2.41 to 4.80, indicating that the investigated water area was light pollution-clean water. The biodiversity characteristics and the P-IBI evaluation system of periphyton algae in the Yarlung Zangbo River Basin indicated that the water ecosystems in the upper, lower reaches of the main stream and four major tributaries were better than those in the middle reaches of the main stream of the Yarlung Zangbo River Basin. These results provide a basis for studying feeding habits and mechanisms of Tibet indigenous fishes to ensure the safety of water ecology and to realize the sustainable development of resources and environmental protection.
Periphyton algae are one of the main groups of organisms in the aquatic ecosystem. They are self-sustaining and can store solar energy by converting it into chemical energy through photosynthesis, as well as generate and release oxygen to promote the material circulation, energy flow and information transfer of the aquatic ecosystem. Periphyton algae are rich in species, attached growth, short life cycle, sensitive to changes in the water environment, and can absorb pollutants in water bodies and purify water quality. They are the beginning of the food chain in the water ecosystem and an important indicator species for water quality monitoring, and often used to the health evaluation of aquatic ecosystems. The Yarlung Zangbo River Basin has high average altitude, low water temperature, and strong ultraviolet radiation, which is the most important natural aquatic ecosystem in Tibet Autonomous Region. It can adjust the climate characteristics of Tibet Autonomous Region and has special geomorphological and ecological conditions that many low altitude rivers do not have, the ecological environment is very sensitive and fragile, and it is highly susceptible to events such as global climate change and human disturbance. Ensuring its water environment has a high health status is an important foundation for protecting green mountains and rivers. In order to assess the health status of the water ecosystem, 26 sampling points were set up on the main stream and four major tributaries of the Yarlung Zangbo River Basin from 2013 to 2014. The environmental data and the periphyton algae community were collected, and the periphytic index of biological integrity (P-IBI) were constructed. A total of 7 phyla, 10 classes, 23 orders, 34 families and 70 genera (species) of periphyton were identified, most of which were Bacillariophyta (35.71%), Chlorophyta (32.86%) and Cyanophyta (20.00%), and the dominant species of periphyton algae were the Bacillariophyta belonging to Bacillariophyta-chlorophyta-cyanophyta type of water. The species richness and total abundance of periphyton algae in the mainstream were slightly lower than those of the tributaries of the Yarlung Zangbo River Basin. The Shannon-Wiener diversity index varied from 4.84 to 9.41, and the Pielou evenness index varied from 2.41 to 4.80, indicating that the investigated water area was light pollution-clean water. The biodiversity characteristics and the P-IBI evaluation system of periphyton algae in the Yarlung Zangbo River Basin indicated that the water ecosystems in the upper, lower reaches of the main stream and four major tributaries were better than those in the middle reaches of the main stream of the Yarlung Zangbo River Basin. These results provide a basis for studying feeding habits and mechanisms of Tibet indigenous fishes to ensure the safety of water ecology and to realize the sustainable development of resources and environmental protection.
,
Available online
, doi: 10.7541/2023.2022.0235
Abstract:
Qinghai Lake is the largest saltwater inland lake in China, and its watershed contains a variety of water bodies with different functions. However, differences in microbial community structure and diversity among different water bodies in the Qinghai Lake basin are still lacking in research. This study compares the microbial community structure of Qinghai Lake with that of the lakeside inundation zone. Using 16S rRNA high-throughput sequencing technology, we investigated the similarities and differences in microbial community composition of water bodies under different environmental conditions. The results showed that the highest relative abundance at the taxonomic level in the main lake and the submerged area of Qinghai Lake were Proteobacteria (44.8%), Bacteroidetes (25.9±7.8)%, Cyanobacteria (13.6±5.4)%, Actinobacteria (7.54±9)% and Tenericutes (3.32±2)%. The structure of microbial diversity in the main lake of Qinghai Lake did not differ significantly between sites, but differed significantly from the submerged area. The overall microbial diversity was significantly higher in the submerged area than in the main lake. Some of the microbial taxonomic genera showed significant differences in distribution between the two lakes, suggesting adaptations of these bacteria to environmental characteristics. The widespread distribution of Nodosilinea algae in the main lake of Qinghai Lake may play an important role in the carbon cycling process of alkaline lakes in the plateau. The results of the analysis of water chemistry indicators showed that the main chemical indicators affecting the microbiological differences between the two types of water bodies were pH, total phosphorus and water temperature. This study has important implications for gaining insights into how the environment shapes the microbial community structure of brackish water bodies.
Qinghai Lake is the largest saltwater inland lake in China, and its watershed contains a variety of water bodies with different functions. However, differences in microbial community structure and diversity among different water bodies in the Qinghai Lake basin are still lacking in research. This study compares the microbial community structure of Qinghai Lake with that of the lakeside inundation zone. Using 16S rRNA high-throughput sequencing technology, we investigated the similarities and differences in microbial community composition of water bodies under different environmental conditions. The results showed that the highest relative abundance at the taxonomic level in the main lake and the submerged area of Qinghai Lake were Proteobacteria (44.8%), Bacteroidetes (25.9±7.8)%, Cyanobacteria (13.6±5.4)%, Actinobacteria (7.54±9)% and Tenericutes (3.32±2)%. The structure of microbial diversity in the main lake of Qinghai Lake did not differ significantly between sites, but differed significantly from the submerged area. The overall microbial diversity was significantly higher in the submerged area than in the main lake. Some of the microbial taxonomic genera showed significant differences in distribution between the two lakes, suggesting adaptations of these bacteria to environmental characteristics. The widespread distribution of Nodosilinea algae in the main lake of Qinghai Lake may play an important role in the carbon cycling process of alkaline lakes in the plateau. The results of the analysis of water chemistry indicators showed that the main chemical indicators affecting the microbiological differences between the two types of water bodies were pH, total phosphorus and water temperature. This study has important implications for gaining insights into how the environment shapes the microbial community structure of brackish water bodies.
,
Available online
, doi: 10.7541/2022.2021.0289
Abstract:
Qinghai Lake is located at the northeastern edge of the Tibetan Plateau and has important ecological values. Although the intensity of human activities in the catchment is low and there is relatively weak pollution, the water quality of Qinghai Lake has worsened significantly in recent years compared to the 1950s and 1960s. In recent years, some lakeshore areas of Qinghai Lake have experienced a proliferation of Cladophora. It is also accompanied by a continuous rise in the water level of Qinghai Lake since 2004. The large amount of newly lakeshore zone formed by the rising water level may be accompanied by soil nutrient release. However, there is a lack of specific knowledge about what specific differences exist between the water environment conditions in the newly lakeshore zone and the main area of Qinghai Lake, as well as the spatial and temporal patterns of water quality in the lakeshore zone area. Based on the field monitoring data of the lakeshore zone and the main lake area in different seasons, this study compares the differences between the water environment characteristics of the newly lakeshore zone and the main lake area after the rising water level of Qinghai Lake, and analyzes the causes and potential impacts. It could lay the foundation for further establishing the correlation between the outbreak of Cladophora and the rising water level process of Qinghai Lake. In this study, water samples were collected in the lakeshore zone and the main lake area of Qinghai Lake in June and August 2020, respectively. Water environmental indicators such as water temperature (WT), conductivity (EC), pH, dissolved oxygen concentration (DO), dissolved oxygen saturation (DO%), turbidity (Turb), total phosphorus (TP), dissolved reactive phosphorus (SRP), total nitrogen (TN), nitrate nitrogen (NO3-N), ammonia nitrogen (NH3-N), nitrite nitrogen (NO2-N), dissolved inorganic nitrogen (DIN), and CODMn were obtained by field measurements and laboratory analysis. In the main lake area of Qinghai Lake, pH ranged from 9.05—9.20, DO ranged from 6.78—8.30 mg/L, DO% ranged from 99.5%—111.4%, WT ranged from 9.3—16.9℃, EC ranged from 15.82—17.77 ms/cm, and turbidity ranged from 1.48 —4.94 NTU, TP ranged from 0.009—0.136 mg/L, SRP ranged from 0.001—0.024 mg/L, TN was at 1 mg/L level, NO3-N ranged from 0.09—0.25 mg/L, NH3-N ranged from 0.10—1.10 mg/L, NO2-N was between undetected to 0.0048 mg/L, DIN was between 0.20—1.27 mg/L, CODMn was between 1.75—4.79 mg/L; While in the lakeshore zone, pH ranged from 8.76—9.46, DO ranged from 1.14—11.25 mg/L, DO% ranged from 15.7%—190.6%, WT ranged from 8.5—22.0°C, EC ranged from 0.85—18.82 ms/cm, and turbidity ranged from 2.09—196.00 NTU, TP was between 0.014—0.462 mg/L, SRP was between 0.002—0.044 mg/L, TN was at the level of 1.4 mg/L, NO3-N was between 0.09—0.91 mg/L, NH3-N was between 0.13—1.23 mg/L, NO2-N was between undetected to 0.0099 mg/L, DIN was between 0.31—2.14 mg /L, CODMn was between 1.78—48.67 mg/L. Based on the significance of the spatial and temporal differences of the indicators between the main lake area and the lakeshore zone, water environment indicators involved in this study can be divided into four categories: there were no significant spatial and temporal differences in pH, TN and DO%; there were significant seasonal differences in WT, DO, SRP, DIN, NH3-N, NO3-N, and NO2-N, but no significant spatial differences; there were significant spatial differences in turbidity and CODMn, and the spatial differences were the same in different seasons; there were also significant spatial differences in TP and EC, but the spatial differences were different in different seasons. Except for NO2-N, the maximum values of coefficients of variation of water environment indicators were found in the lakeshore zone. Most indicators had higher coefficients of variation in August. The results of the principal component analysis suggested that the differences between different types of lakeshore zones might also be enhancing or weakening the influence of lakeshore zones on water environment indicators. The PCA plot shows that the distribution of sample sites in the lakeshore zone of Qinghai Lake disperse along different principal component axes in different seasons. Therefore, the dispersion could be the cause or the result of the outbreak of the algal bloom in the lakeside zone of Qinghai Lake. The results of this study suggest that the water environment characteristics in some lakeshore zone areas of Qinghai Lake are favorable for the growth of Cladophora, which may be partly responsible for the outbreak of Cladophora. The continued impact of the new lakeshore zone formed by the rising water level on the Tibetan Plateau lakes represented by Qinghai Lake needs further attention in subsequent studies.
Qinghai Lake is located at the northeastern edge of the Tibetan Plateau and has important ecological values. Although the intensity of human activities in the catchment is low and there is relatively weak pollution, the water quality of Qinghai Lake has worsened significantly in recent years compared to the 1950s and 1960s. In recent years, some lakeshore areas of Qinghai Lake have experienced a proliferation of Cladophora. It is also accompanied by a continuous rise in the water level of Qinghai Lake since 2004. The large amount of newly lakeshore zone formed by the rising water level may be accompanied by soil nutrient release. However, there is a lack of specific knowledge about what specific differences exist between the water environment conditions in the newly lakeshore zone and the main area of Qinghai Lake, as well as the spatial and temporal patterns of water quality in the lakeshore zone area. Based on the field monitoring data of the lakeshore zone and the main lake area in different seasons, this study compares the differences between the water environment characteristics of the newly lakeshore zone and the main lake area after the rising water level of Qinghai Lake, and analyzes the causes and potential impacts. It could lay the foundation for further establishing the correlation between the outbreak of Cladophora and the rising water level process of Qinghai Lake. In this study, water samples were collected in the lakeshore zone and the main lake area of Qinghai Lake in June and August 2020, respectively. Water environmental indicators such as water temperature (WT), conductivity (EC), pH, dissolved oxygen concentration (DO), dissolved oxygen saturation (DO%), turbidity (Turb), total phosphorus (TP), dissolved reactive phosphorus (SRP), total nitrogen (TN), nitrate nitrogen (NO3-N), ammonia nitrogen (NH3-N), nitrite nitrogen (NO2-N), dissolved inorganic nitrogen (DIN), and CODMn were obtained by field measurements and laboratory analysis. In the main lake area of Qinghai Lake, pH ranged from 9.05—9.20, DO ranged from 6.78—8.30 mg/L, DO% ranged from 99.5%—111.4%, WT ranged from 9.3—16.9℃, EC ranged from 15.82—17.77 ms/cm, and turbidity ranged from 1.48 —4.94 NTU, TP ranged from 0.009—0.136 mg/L, SRP ranged from 0.001—0.024 mg/L, TN was at 1 mg/L level, NO3-N ranged from 0.09—0.25 mg/L, NH3-N ranged from 0.10—1.10 mg/L, NO2-N was between undetected to 0.0048 mg/L, DIN was between 0.20—1.27 mg/L, CODMn was between 1.75—4.79 mg/L; While in the lakeshore zone, pH ranged from 8.76—9.46, DO ranged from 1.14—11.25 mg/L, DO% ranged from 15.7%—190.6%, WT ranged from 8.5—22.0°C, EC ranged from 0.85—18.82 ms/cm, and turbidity ranged from 2.09—196.00 NTU, TP was between 0.014—0.462 mg/L, SRP was between 0.002—0.044 mg/L, TN was at the level of 1.4 mg/L, NO3-N was between 0.09—0.91 mg/L, NH3-N was between 0.13—1.23 mg/L, NO2-N was between undetected to 0.0099 mg/L, DIN was between 0.31—2.14 mg /L, CODMn was between 1.78—48.67 mg/L. Based on the significance of the spatial and temporal differences of the indicators between the main lake area and the lakeshore zone, water environment indicators involved in this study can be divided into four categories: there were no significant spatial and temporal differences in pH, TN and DO%; there were significant seasonal differences in WT, DO, SRP, DIN, NH3-N, NO3-N, and NO2-N, but no significant spatial differences; there were significant spatial differences in turbidity and CODMn, and the spatial differences were the same in different seasons; there were also significant spatial differences in TP and EC, but the spatial differences were different in different seasons. Except for NO2-N, the maximum values of coefficients of variation of water environment indicators were found in the lakeshore zone. Most indicators had higher coefficients of variation in August. The results of the principal component analysis suggested that the differences between different types of lakeshore zones might also be enhancing or weakening the influence of lakeshore zones on water environment indicators. The PCA plot shows that the distribution of sample sites in the lakeshore zone of Qinghai Lake disperse along different principal component axes in different seasons. Therefore, the dispersion could be the cause or the result of the outbreak of the algal bloom in the lakeside zone of Qinghai Lake. The results of this study suggest that the water environment characteristics in some lakeshore zone areas of Qinghai Lake are favorable for the growth of Cladophora, which may be partly responsible for the outbreak of Cladophora. The continued impact of the new lakeshore zone formed by the rising water level on the Tibetan Plateau lakes represented by Qinghai Lake needs further attention in subsequent studies.
,
Available online
, doi: 10.7541/2023.2022.0014
Abstract:
Natural wetlands in the Qinghai-Tibet Plateau have many important ecological functions, among which water purification is one of the important functions. However, its high altitude, hypoxia and other special natural environment and human activities may affect water quality and water purification capacity of plateau wetlands. In this study, in order to reveal water environment characteristics and the water purification capacities of plateau natural wetlands under different pollution sources, water samples were collected in Lhalu Wetland and associated channels and Chabalang Wetland in August 2020 (summer) and April 2021 (spring), and then analyzed for total nitrogen (TN), ammonia nitrogen (NH3-N), nitrate nitrogen (NO3-N), total phosphorus (TP), dissolved reactive phosphorus (SRP), and permanganate index (CODMn). The results showed that TN and NO3-N concentrations in water were lower in summer than those in spring, but TP, SRP and CODMn were generally higher than those in spring. The channels connected with Lhalu Wetland were polluted by human activities in Lhasa city. The water quality in the channels was poor, especially near the Lhalu Wetland inlet and downstream channel. Lhalu Wetland effectively removed the pollutants from the upstream channels. The influent quality of Chabalang Wetland was mainly affected by CODMn, which might be related to non-point source pollution from surrounding agricultural activities. The effluent quality also improved owing to purification of Chabalang Wetland.The removal effect of pollutants from influent water varied in different seasons. In summer, the maximum removal rates of TN, NH3-N, NO3-N, TP, and SRP were 75.0%, 65.2%, 89.5%, 82.2%, and 35.3%, respectively. The removal rates of TN, NH3-N, NO3-N, TP, and SRP in Chabalang Wetland were 60.7%, 73.5%, 12.7%, 35.9%, and 5.0%, respectively. No removal effect on CODMn was observed in the two wetlands in summer. In spring, the maximum removal rates of TN, NH3-N, NO3-N, TP, SRP, and CODMn were 35.2%, 65.9%, 56.8%, 59.5%, 62.3%, and 17.9%, respectively. The water purification effect of Chabalang Wetland was poor, and the removal rates of TN, NH3-N, NO3-N, TP, SRP, and CODMn were 2.2%, 10.2%, 11.3%, 11.3%, 9.0%, and 26.0%, respectively. The purification effects in the Lhalu Wetland and Chabalang Wetland on the pollutants were different. Lhalu Wetland had a higher removal rate of nitrogen and phosphorus pollutants, and the removal effect in summer was generally better than that in spring. As for CODMn, its removal rates in the two wetlands were low in spring, while no purification effect of CODMn was found in summer.Plateau wetlands play an important role on removing pollutants from surrounding human activities. Water quality, water level, season, wetland vegetation, wetland structure, and hydrodynamic characteristics may affect the water purification capacity of plateau wetland. Rich aquatic plant communities, low water temperature, different hydrological conditions and other factors may weaken the purification effect of pollutants in plateau wetlands. Therefore, it is necessary to regulate the inflow of wetland reasonably in order to give full play to the water purification function of plateau natural wetland.
Natural wetlands in the Qinghai-Tibet Plateau have many important ecological functions, among which water purification is one of the important functions. However, its high altitude, hypoxia and other special natural environment and human activities may affect water quality and water purification capacity of plateau wetlands. In this study, in order to reveal water environment characteristics and the water purification capacities of plateau natural wetlands under different pollution sources, water samples were collected in Lhalu Wetland and associated channels and Chabalang Wetland in August 2020 (summer) and April 2021 (spring), and then analyzed for total nitrogen (TN), ammonia nitrogen (NH3-N), nitrate nitrogen (NO3-N), total phosphorus (TP), dissolved reactive phosphorus (SRP), and permanganate index (CODMn). The results showed that TN and NO3-N concentrations in water were lower in summer than those in spring, but TP, SRP and CODMn were generally higher than those in spring. The channels connected with Lhalu Wetland were polluted by human activities in Lhasa city. The water quality in the channels was poor, especially near the Lhalu Wetland inlet and downstream channel. Lhalu Wetland effectively removed the pollutants from the upstream channels. The influent quality of Chabalang Wetland was mainly affected by CODMn, which might be related to non-point source pollution from surrounding agricultural activities. The effluent quality also improved owing to purification of Chabalang Wetland.The removal effect of pollutants from influent water varied in different seasons. In summer, the maximum removal rates of TN, NH3-N, NO3-N, TP, and SRP were 75.0%, 65.2%, 89.5%, 82.2%, and 35.3%, respectively. The removal rates of TN, NH3-N, NO3-N, TP, and SRP in Chabalang Wetland were 60.7%, 73.5%, 12.7%, 35.9%, and 5.0%, respectively. No removal effect on CODMn was observed in the two wetlands in summer. In spring, the maximum removal rates of TN, NH3-N, NO3-N, TP, SRP, and CODMn were 35.2%, 65.9%, 56.8%, 59.5%, 62.3%, and 17.9%, respectively. The water purification effect of Chabalang Wetland was poor, and the removal rates of TN, NH3-N, NO3-N, TP, SRP, and CODMn were 2.2%, 10.2%, 11.3%, 11.3%, 9.0%, and 26.0%, respectively. The purification effects in the Lhalu Wetland and Chabalang Wetland on the pollutants were different. Lhalu Wetland had a higher removal rate of nitrogen and phosphorus pollutants, and the removal effect in summer was generally better than that in spring. As for CODMn, its removal rates in the two wetlands were low in spring, while no purification effect of CODMn was found in summer.Plateau wetlands play an important role on removing pollutants from surrounding human activities. Water quality, water level, season, wetland vegetation, wetland structure, and hydrodynamic characteristics may affect the water purification capacity of plateau wetland. Rich aquatic plant communities, low water temperature, different hydrological conditions and other factors may weaken the purification effect of pollutants in plateau wetlands. Therefore, it is necessary to regulate the inflow of wetland reasonably in order to give full play to the water purification function of plateau natural wetland.
,
Available online
, doi: 10.7541/2023.2022.0243
Abstract:
The present study collected samples of Pseudorasbora parva from the Lhalu Wetland and Chabalang Wetland in Tibet Autonomous Region in 2019—2021 and analyzed the life-history traits of the two populations. By comparing with populations from Nanjing in lower reaches of the Yangtze River and other low-elevation regions in the native range, we aimed to reveal its adaptation of life-history traits in the plateau. The results showed that the ages of P. parva in the Lhalu Wetland and Chabalang Wetland ranged from one to four years, with the dominant ages of one year and two years. The ages of P. parva in Nanjing ranged from one to five years, with the dominant ages of three years and four years. The relationships between body length (L) and body weight (W) were W♂ =0.021 L2.966(r2=0.982) and W♀ =0.014 L3.224(r2=0.986) in the Lhalu population, W♂=0.011 L3.282(r2=0.990) and W♀=0.014 L3.123(r2=0.989) in the Chabalang population, and W♂=0.014 L3.146(r2=0.939) and W♀=0.028 L2.763(r2=0.894) in the Nanjing population. The relationships between body length and scale radius (R) were L♀=21.676 R+7.766 (r2=0.886) and L♂=29.184 R0.792(r2=0.886) in the Lhalu population, L♀=16.946 R+15.048(r2=0.857) and L♂=18.290 R+13.157(r2=0.858) in the Chabalang population, and L♀=33.710 R0.607(r2=0.686) and L♂=16.194 R+20.485(r2=0.800) in the Nanjing population. The values of absolute fecundity and egg diameter were (926±476) and (0.92±0.10) mm in the Lhalu population, 364 and 0.97 mm in one female sample from the Chabalang population, and (1220±704) and (1.00±0.13) mm in the Nanjing population. Compared with native populations, the Lhalu and Chabalang populations possessed a lower age structure, lower values of average body length, smaller sizes and slower growth rates at each age group, and lower values of absolute fecundity and egg diameter. The cold condition may be the main factor resulting in changes in these life-history traits (e.g. slow growth and low fecundity) of P. parva in Tibet.
The present study collected samples of Pseudorasbora parva from the Lhalu Wetland and Chabalang Wetland in Tibet Autonomous Region in 2019—2021 and analyzed the life-history traits of the two populations. By comparing with populations from Nanjing in lower reaches of the Yangtze River and other low-elevation regions in the native range, we aimed to reveal its adaptation of life-history traits in the plateau. The results showed that the ages of P. parva in the Lhalu Wetland and Chabalang Wetland ranged from one to four years, with the dominant ages of one year and two years. The ages of P. parva in Nanjing ranged from one to five years, with the dominant ages of three years and four years. The relationships between body length (L) and body weight (W) were W♂ =0.021 L2.966(r2=0.982) and W♀ =0.014 L3.224(r2=0.986) in the Lhalu population, W♂=0.011 L3.282(r2=0.990) and W♀=0.014 L3.123(r2=0.989) in the Chabalang population, and W♂=0.014 L3.146(r2=0.939) and W♀=0.028 L2.763(r2=0.894) in the Nanjing population. The relationships between body length and scale radius (R) were L♀=21.676 R+7.766 (r2=0.886) and L♂=29.184 R0.792(r2=0.886) in the Lhalu population, L♀=16.946 R+15.048(r2=0.857) and L♂=18.290 R+13.157(r2=0.858) in the Chabalang population, and L♀=33.710 R0.607(r2=0.686) and L♂=16.194 R+20.485(r2=0.800) in the Nanjing population. The values of absolute fecundity and egg diameter were (926±476) and (0.92±0.10) mm in the Lhalu population, 364 and 0.97 mm in one female sample from the Chabalang population, and (1220±704) and (1.00±0.13) mm in the Nanjing population. Compared with native populations, the Lhalu and Chabalang populations possessed a lower age structure, lower values of average body length, smaller sizes and slower growth rates at each age group, and lower values of absolute fecundity and egg diameter. The cold condition may be the main factor resulting in changes in these life-history traits (e.g. slow growth and low fecundity) of P. parva in Tibet.
,
Available online
, doi: 10.7541/2022.2021.060
Abstract:
Estimating age structure of fish populations and growth of individuals are fundamental to assessing fish population dynamics and formulation of effective fisheries management. Obtaining accurate age information is the first step for precise understanding of these metrics. As one of the dominant species in the lower reaches of the Yarlung Zangbo River, however, little is known about the age estimations of Schizothorax curvilabiatus. 928 specimens of S. curvilabiatus were collected from December 2015 to November 2016 in the Motuo reach. Otoliths, vertebrae and opercular bones were examined to assess the suitability of the three calcified structures for age estimation. The results showed that otoliths were more suitable than vertebrae and opercular bones for age estimation of S. curvilabiatus. The standard length (SL) of S. curvilabiatus ranged from 48 to 508 mm, weight (W) ranged from 1.8 to 1898.9 g. The range of estimated age was 2—23 years for males, 2—43 years for females, and 1—4 years for those of undetermined sex. S. curvilabiatus populations in the Motuo reach were dominated by the specimens of 3—5 years. The intercept of length-weight relationship showed no difference between sexes and the function was described as W=2.279×10–5 SL 2.931. The von Bertalanffy function was used to model the observed length-at-age data as Lt=590.2 [1–e–0.096(t–0.282)],Wt=3016.8 [1–e–0.096(t–0.282)]2.931 for females, and Lt=575.3 [1–e –0.090(t+0.011)], Wt=2798.9 [1–e –0.090(t+0.011)]2.931 for males. The inflexion point for the growth of females and males were 11.5 and 11.9 years, respectively. Accordingly, reasonable conservation measures, such as controlling fishing, habitat protection and strengthening artificial breeding, are needed to maintain the fish stock for future generations due to the increasing anthropogenic activities in the lower Yarlung Zangbo River.
Estimating age structure of fish populations and growth of individuals are fundamental to assessing fish population dynamics and formulation of effective fisheries management. Obtaining accurate age information is the first step for precise understanding of these metrics. As one of the dominant species in the lower reaches of the Yarlung Zangbo River, however, little is known about the age estimations of Schizothorax curvilabiatus. 928 specimens of S. curvilabiatus were collected from December 2015 to November 2016 in the Motuo reach. Otoliths, vertebrae and opercular bones were examined to assess the suitability of the three calcified structures for age estimation. The results showed that otoliths were more suitable than vertebrae and opercular bones for age estimation of S. curvilabiatus. The standard length (SL) of S. curvilabiatus ranged from 48 to 508 mm, weight (W) ranged from 1.8 to 1898.9 g. The range of estimated age was 2—23 years for males, 2—43 years for females, and 1—4 years for those of undetermined sex. S. curvilabiatus populations in the Motuo reach were dominated by the specimens of 3—5 years. The intercept of length-weight relationship showed no difference between sexes and the function was described as W=2.279×10–5 SL 2.931. The von Bertalanffy function was used to model the observed length-at-age data as Lt=590.2 [1–e–0.096(t–0.282)],Wt=3016.8 [1–e–0.096(t–0.282)]2.931 for females, and Lt=575.3 [1–e –0.090(t+0.011)], Wt=2798.9 [1–e –0.090(t+0.011)]2.931 for males. The inflexion point for the growth of females and males were 11.5 and 11.9 years, respectively. Accordingly, reasonable conservation measures, such as controlling fishing, habitat protection and strengthening artificial breeding, are needed to maintain the fish stock for future generations due to the increasing anthropogenic activities in the lower Yarlung Zangbo River.
,
Available online
, doi: 10.7541/2023.2022.0337
Abstract:
Wetlands have many ecological functions, such as water conservation, flood control and species diversity conservation. With the rapid development of the local society and economy, the wetland ecosystem in Tibet Autonomous Region is under the influence of human activities. We used a combination of gill nets and plastic cages to conduct fish surveys in Lhalu and Chabalang wetlands from 2019 to 2021. We collected 10 non-native fishes belonging to 4 orders, 5 families, including Carassius auratus, Pseudorasbora parva, Cyprinus carpio, Tinca tinca, Abbottina rivularis, Misgurnus anguillicaudatus, Paramisgurnus dabryanus, Silurus asotus, Micropercops swinhonis and Oryzias sinensis. The nonnative species were mainly composed of fishes with small sizes (e.g. C. auratus and P. parva), and accounted for 94.86% and 70.71% of total catches by the individual and weight, respectively. Based on the index of relative importance (IRI), C. auratus, P. parva, P. dabryanus and C. carpio were non-native fish dominant species in Lhalu Wetland, and C. auratus, P. parva and M. swinhonis were non-native fish dominant species in Chabalang Wetland. The richness, abundance, biomass and functional diversity index of non-native fishes were higher than those of native fishes in both Lhalu Wetland and Chabalang Wetland. Combined with historical data, 12 non-native fish species have been recorded in Lhalu Wetland and Chabalang Wetland, including 6 species at high risk of invasion. Meanwhile, the number of non-native fish species has increased from 2 to 10, and T. tinca and O. sinensis were firstly collected from natural waters in Tibet Autonomous Region and Chabalang Wetland, respectively. In addition, non-native fish species in the two wetlands were all common economic fish and attached fish in the market in Lhasa City, which were released into the natural waters by humans. At present, the natural populations of C. auratus, P. dabryanus and P. parva have been established. The scientific management of fish releases and long-term monitoring of non-native fishes should be urgently carried out to prevent the invasion of non-native fish species and protect the biodiversity in plateau wetlands.
Wetlands have many ecological functions, such as water conservation, flood control and species diversity conservation. With the rapid development of the local society and economy, the wetland ecosystem in Tibet Autonomous Region is under the influence of human activities. We used a combination of gill nets and plastic cages to conduct fish surveys in Lhalu and Chabalang wetlands from 2019 to 2021. We collected 10 non-native fishes belonging to 4 orders, 5 families, including Carassius auratus, Pseudorasbora parva, Cyprinus carpio, Tinca tinca, Abbottina rivularis, Misgurnus anguillicaudatus, Paramisgurnus dabryanus, Silurus asotus, Micropercops swinhonis and Oryzias sinensis. The nonnative species were mainly composed of fishes with small sizes (e.g. C. auratus and P. parva), and accounted for 94.86% and 70.71% of total catches by the individual and weight, respectively. Based on the index of relative importance (IRI), C. auratus, P. parva, P. dabryanus and C. carpio were non-native fish dominant species in Lhalu Wetland, and C. auratus, P. parva and M. swinhonis were non-native fish dominant species in Chabalang Wetland. The richness, abundance, biomass and functional diversity index of non-native fishes were higher than those of native fishes in both Lhalu Wetland and Chabalang Wetland. Combined with historical data, 12 non-native fish species have been recorded in Lhalu Wetland and Chabalang Wetland, including 6 species at high risk of invasion. Meanwhile, the number of non-native fish species has increased from 2 to 10, and T. tinca and O. sinensis were firstly collected from natural waters in Tibet Autonomous Region and Chabalang Wetland, respectively. In addition, non-native fish species in the two wetlands were all common economic fish and attached fish in the market in Lhasa City, which were released into the natural waters by humans. At present, the natural populations of C. auratus, P. dabryanus and P. parva have been established. The scientific management of fish releases and long-term monitoring of non-native fishes should be urgently carried out to prevent the invasion of non-native fish species and protect the biodiversity in plateau wetlands.
,
Available online
, doi: 10.7541/2023.2022.0312
Abstract:
The stability of karst carbon sink is the research fronts in Earth Sciences. Rivers are the key sites for the migration and transformation of karst carbon sink, where the sediment acts as an important component of the aquatic carbon pool and accumulates a large amount of organic carbon. Therefore, uncovering the physicochemical properties of river sediments is crucial to understand the carbon cycle in karst aquatic ecosystem. Here, we took the Zhaidi River which fed by the Haiyang-Zhaidi underground river system as the object, the physicochemical properties and sources of organic carbon were analyzed through the field surveys and indoor chemical analysis. Our aim was to elaborate the influence of karst aquatic environment and submerged macrophytes on the sediments. The results showed that: (1) The spatial heterogeneity of sediments was remarkable, and the sediments were mainly composed of 0.075—2 mm sandy particles with pH ranging from 8.23 to 8.88, TOC of 1.2—9.5 g/kg, TN of 289—1241 mg/kg, TP of 497—743 mg/kg,\begin{document}${\rm{NH}}^+_4 $\end{document} ![]()
![]()
\begin{document}${\rm{NO}}^-_3 $\end{document} ![]()
![]()
The stability of karst carbon sink is the research fronts in Earth Sciences. Rivers are the key sites for the migration and transformation of karst carbon sink, where the sediment acts as an important component of the aquatic carbon pool and accumulates a large amount of organic carbon. Therefore, uncovering the physicochemical properties of river sediments is crucial to understand the carbon cycle in karst aquatic ecosystem. Here, we took the Zhaidi River which fed by the Haiyang-Zhaidi underground river system as the object, the physicochemical properties and sources of organic carbon were analyzed through the field surveys and indoor chemical analysis. Our aim was to elaborate the influence of karst aquatic environment and submerged macrophytes on the sediments. The results showed that: (1) The spatial heterogeneity of sediments was remarkable, and the sediments were mainly composed of 0.075—2 mm sandy particles with pH ranging from 8.23 to 8.88, TOC of 1.2—9.5 g/kg, TN of 289—1241 mg/kg, TP of 497—743 mg/kg,
,
Available online
, doi: 10.7541/2023.2021.085
Abstract:
To explore the physiological response of Qinghai Lake naked carp (Gymnocypris przewalskii) telencephalon cells to hypoxia, the carp with body weight (97.68±0.12) g and body length (24.11±0.12) cm were challenged with hypoxia stress [dissolved oxygen content of (0.7±0.1) mg/L] and normoxia [dissolved oxygen content of (8.4±0.1) mg/L] for 24h to measure mitochondrial ultrastructure, membrane potential, antioxidant enzyme activities, telencephalon cells apoptosis, apoptotic-related genes (Caspase 3, Bax, Bcl-2) and hypoxia-induced response-related gene (Hif-2α, EGLN1). The results showed that: (1) nerve cells mitochondria swelled and their cristae dissolved during hypoxia stress, the mitochondrial membrane potential increased significantly at 8h and then significantly decreased at 24h, indicating the destroyed mitochondria of telencephalon cells with the increased hypoxia time. (2) hypoxia enhanced cell apoptosis and the expression levels of Caspase 3, Hif-2α, Bax and Bcl-2 genes in telencephalon cells, and significantly decreased the ratio of Bcl-2/Bax and the expression of EGLN1. (3) the increased content of hydrogen peroxide (H2O2) in telencephalon cells only happened at 8h. Hypoxia significantly induced the activity of superoxide dismutase (SOD), the content of malondialdehyde (MDA) and the total antioxidant capacity (T-AOC) only at 24h. Furthermore, there was no significant difference in glutathione peroxidase (GPX) between the groups. These results suggest that hypoxia stress mediates the permeability of mitochondrial membrane and the expression of Caspase 3, Bax and Bcl-2 genes via ROS production in telencephalon cells to induce telencephalon cells apoptosis, which might be balanced by increasing the activities of T-AOC and SOD and the expression levels of Hif-2α and decreasing the expression levels of EGLN1.
To explore the physiological response of Qinghai Lake naked carp (Gymnocypris przewalskii) telencephalon cells to hypoxia, the carp with body weight (97.68±0.12) g and body length (24.11±0.12) cm were challenged with hypoxia stress [dissolved oxygen content of (0.7±0.1) mg/L] and normoxia [dissolved oxygen content of (8.4±0.1) mg/L] for 24h to measure mitochondrial ultrastructure, membrane potential, antioxidant enzyme activities, telencephalon cells apoptosis, apoptotic-related genes (Caspase 3, Bax, Bcl-2) and hypoxia-induced response-related gene (Hif-2α, EGLN1). The results showed that: (1) nerve cells mitochondria swelled and their cristae dissolved during hypoxia stress, the mitochondrial membrane potential increased significantly at 8h and then significantly decreased at 24h, indicating the destroyed mitochondria of telencephalon cells with the increased hypoxia time. (2) hypoxia enhanced cell apoptosis and the expression levels of Caspase 3, Hif-2α, Bax and Bcl-2 genes in telencephalon cells, and significantly decreased the ratio of Bcl-2/Bax and the expression of EGLN1. (3) the increased content of hydrogen peroxide (H2O2) in telencephalon cells only happened at 8h. Hypoxia significantly induced the activity of superoxide dismutase (SOD), the content of malondialdehyde (MDA) and the total antioxidant capacity (T-AOC) only at 24h. Furthermore, there was no significant difference in glutathione peroxidase (GPX) between the groups. These results suggest that hypoxia stress mediates the permeability of mitochondrial membrane and the expression of Caspase 3, Bax and Bcl-2 genes via ROS production in telencephalon cells to induce telencephalon cells apoptosis, which might be balanced by increasing the activities of T-AOC and SOD and the expression levels of Hif-2α and decreasing the expression levels of EGLN1.
,
Available online
, doi: 10.7541/2023.2022.0261
Abstract:
In order to explore the genetic diversity of the selective breeding population of Chinese mitten crab (Eriocheir sinensis), 20 microsatellite markers were used to analyze the genetic diversity of 3 consecutive generations of strain A and strain B of“Changdang Lake 1” Chinese mitten crab. The results are presented in the following, a total of 551 alleles were detected from 20 microsatellite markers for 6 populations. The average number of alleles (Na) were 27.55, the average number of effective alleles (Ne) was 13.61, the average observed heterozygosity (Ho) was 0.72, the average expected heterozygosity (He) was 0.90, the average Shannon information index (I) was 2.73, and the average polymorphic information content (PIC) was 0.89. In the process of breeding, PIC of strain A and strain B had a downward trend, and He and Ho of each population maintained a high level. The effective population size (Ne) in G1 and G2 of strain A were 72.7 and 111.8, and the Ne in G1 and G2 of strain B were 67.7 and 115.8, maintaining a high level. The Hardy-Weinber balance test showed that 72.5% of the data deviated from Hardy-Weinber balance, indicating that the genetic structure of the breeding population was relatively unstable. The genetic distance between G0 and G1 of strain A was 0.2455, and it increased to 0.2607 between G1 and G2. The genetic distance between G0 and G1 of strain B was 0.1736, and it increased to 0.1751 between G1 and G2. The genetic differentiation coefficients (Fst) ranged from 0.0026 to 0.0125, indicating that the genetic differentiations among populations was light. The results of molecular variance analysis (AMOVA) analysis showed that only 0.87% of the variation originated from different populations of “Changdang Lake 1”, while 99.13% variation occurred among individuals within the population. In conclusion, the genetic diversity and the effective population size were maintained high in each population of “Changdang Lake 1” Chinese mitten crab, but the genetic structure was unstable, so enough breeding parents and genetic diversity should be maintained to prevent inbreeding depression in the future breeding of “Changdang Lake 1”. This study may provide practical reference for the breeding of new strain of Chinese mitten crab, and accumulate data onto the continuous breeding and promotion of “Changdang Lake 1”.
In order to explore the genetic diversity of the selective breeding population of Chinese mitten crab (Eriocheir sinensis), 20 microsatellite markers were used to analyze the genetic diversity of 3 consecutive generations of strain A and strain B of“Changdang Lake 1” Chinese mitten crab. The results are presented in the following, a total of 551 alleles were detected from 20 microsatellite markers for 6 populations. The average number of alleles (Na) were 27.55, the average number of effective alleles (Ne) was 13.61, the average observed heterozygosity (Ho) was 0.72, the average expected heterozygosity (He) was 0.90, the average Shannon information index (I) was 2.73, and the average polymorphic information content (PIC) was 0.89. In the process of breeding, PIC of strain A and strain B had a downward trend, and He and Ho of each population maintained a high level. The effective population size (Ne) in G1 and G2 of strain A were 72.7 and 111.8, and the Ne in G1 and G2 of strain B were 67.7 and 115.8, maintaining a high level. The Hardy-Weinber balance test showed that 72.5% of the data deviated from Hardy-Weinber balance, indicating that the genetic structure of the breeding population was relatively unstable. The genetic distance between G0 and G1 of strain A was 0.2455, and it increased to 0.2607 between G1 and G2. The genetic distance between G0 and G1 of strain B was 0.1736, and it increased to 0.1751 between G1 and G2. The genetic differentiation coefficients (Fst) ranged from 0.0026 to 0.0125, indicating that the genetic differentiations among populations was light. The results of molecular variance analysis (AMOVA) analysis showed that only 0.87% of the variation originated from different populations of “Changdang Lake 1”, while 99.13% variation occurred among individuals within the population. In conclusion, the genetic diversity and the effective population size were maintained high in each population of “Changdang Lake 1” Chinese mitten crab, but the genetic structure was unstable, so enough breeding parents and genetic diversity should be maintained to prevent inbreeding depression in the future breeding of “Changdang Lake 1”. This study may provide practical reference for the breeding of new strain of Chinese mitten crab, and accumulate data onto the continuous breeding and promotion of “Changdang Lake 1”.
,
Available online
, doi: 10.7541/2023.2022.0377
Abstract:
To explore the effects and mechanisms of different wetland plants on nitrogen removal and electricity generation performance of CW-MFC coupling system, three groups of CW-MFC pilot systems were constructed with Reed, Lythrum Salicaria, and Canna Indica, respectively, which were recorded as CM-R, CM-L, and CM-C. The results revealed that: ① the output voltage and power density of CW-MFC coupling system were CM-L>CM-C>CM-R; ② the NH4+-N and TN removal rates of CM-R coupling system (76.8±9.9%; 54.2±8.2%) were higher than that of CM-L system (61.2±8.0%; 43.1±6.5%), which were higher than that of CM-C system (58.9±9.5%; 42.0±9.8%), P<0.01; ③ the overall growth rate of plants was CM-R> CM-C>CM-L, and the MDA content was highest in the leaves of Lythrum Salicaria (CM-L), indicating that the degree of its damage may be higher; ④ Geobacter, as a typical electrogenesis genus, had a high abundance (4.45% to 7.64%) in all three coupling systems, and its abundance was consistent with the change trend of output voltage and power density, whereas the relative abundance of Acinetobacter and Flavobacterium in CM-R was 21.10% and 14.37%, significantly higher than that of the other two systems (CM-L: 0.33% and 0.10%; CM-C: 0.75% and 0.07%), which was the most dominant genus of denitrification bacteria in CM-R; ⑤ combined with the FACOPTAX predictions, a total of 47 functional groups including chemoheterotrophy, aerobic chemoheterotrophy, iron respiration, nitrate reduction and nitrogen respiration were detected, and the results also showed that the functional groups of the CM-R were quite different from the other two systems, among which the functional groups of chemoheterotrophy and aerobic chemoheterotrophy accounted for a relatively high proportion in CM-R. The results will help to strengthen plant understanding of the effects of electrogenesis and denitrification performance on the CW-MFC coupling system.
To explore the effects and mechanisms of different wetland plants on nitrogen removal and electricity generation performance of CW-MFC coupling system, three groups of CW-MFC pilot systems were constructed with Reed, Lythrum Salicaria, and Canna Indica, respectively, which were recorded as CM-R, CM-L, and CM-C. The results revealed that: ① the output voltage and power density of CW-MFC coupling system were CM-L>CM-C>CM-R; ② the NH4+-N and TN removal rates of CM-R coupling system (76.8±9.9%; 54.2±8.2%) were higher than that of CM-L system (61.2±8.0%; 43.1±6.5%), which were higher than that of CM-C system (58.9±9.5%; 42.0±9.8%), P<0.01; ③ the overall growth rate of plants was CM-R> CM-C>CM-L, and the MDA content was highest in the leaves of Lythrum Salicaria (CM-L), indicating that the degree of its damage may be higher; ④ Geobacter, as a typical electrogenesis genus, had a high abundance (4.45% to 7.64%) in all three coupling systems, and its abundance was consistent with the change trend of output voltage and power density, whereas the relative abundance of Acinetobacter and Flavobacterium in CM-R was 21.10% and 14.37%, significantly higher than that of the other two systems (CM-L: 0.33% and 0.10%; CM-C: 0.75% and 0.07%), which was the most dominant genus of denitrification bacteria in CM-R; ⑤ combined with the FACOPTAX predictions, a total of 47 functional groups including chemoheterotrophy, aerobic chemoheterotrophy, iron respiration, nitrate reduction and nitrogen respiration were detected, and the results also showed that the functional groups of the CM-R were quite different from the other two systems, among which the functional groups of chemoheterotrophy and aerobic chemoheterotrophy accounted for a relatively high proportion in CM-R. The results will help to strengthen plant understanding of the effects of electrogenesis and denitrification performance on the CW-MFC coupling system.
,
Available online
, doi: 10.7541/2023.2022.0329
Abstract:
Mariculture conservation is an important initiative to complement the life history of Chinese sturgeon (Acipenser sinensis) and implement land-sea relay conservation. In order to investigate the potential bait resources of Chinese sturgeon in offshore marine pastures and the ability of marine enclosures, this study conducted an annual survey of the Bailong island marine ranch off the coast of Wenzhou, Zhejiang Province, and assessed the amount of benthic and lower-middle biological resources in the marine ranch. Through the analysis of the feeding and growth status of the Chinese sturgeon and the contents of the digestive tract, the types of food that the Chinese sturgeon can eat in the marine pasture were obtained and verified, and the maximum resource carrying capacity of the Chinese sturgeon was estimated. The results showed that a total of 47species of prey organisms were collected from the Bailong island marine ranch, belonging to 5 phyla and 8 classes, including 38species of benthic animals and 9species of lower-middle organisms. According to historical literature data, all of them could be eaten by Chinese sturgeon; According to the analysis of the contents of the digestive tract, the stocked Chinese sturgeon was adapted to the marine ranch and feed on their own. It is verified that it has ingested a total of 16species of prey organisms collected from 4 phyla and 5 classes. The food composition was arranged according to the relative importance index (IRI): Crustacea (mainly shrimp and crabs)>Gastropoda>Fish>Pleurobranchia>Polychaete, and the feeding preference was arranged according to the size of the feeding selection coefficient: Crustacea>Belly Foot class>Petalbranch class>Polychaete>Fish. The annual maximum sustainable yield of potential bait resources of Chinese sturgeon in Bailong island marine ranch is about 811.389 kg, which can be used for 69 Chinese sturgeon juveniles to grow to sexual maturity. The results of this study indicate that the offshore fenced marine ranch is a potential model for marine conservation of Chinese sturgeon. In the next step, it is necessary to further study how to improve the scale and effect of marine fence conservation under the mode of artificial supplementation of natural bait, so as to provide basic data for the formation of Chinese sturgeon land-sea relay conservation.
Mariculture conservation is an important initiative to complement the life history of Chinese sturgeon (Acipenser sinensis) and implement land-sea relay conservation. In order to investigate the potential bait resources of Chinese sturgeon in offshore marine pastures and the ability of marine enclosures, this study conducted an annual survey of the Bailong island marine ranch off the coast of Wenzhou, Zhejiang Province, and assessed the amount of benthic and lower-middle biological resources in the marine ranch. Through the analysis of the feeding and growth status of the Chinese sturgeon and the contents of the digestive tract, the types of food that the Chinese sturgeon can eat in the marine pasture were obtained and verified, and the maximum resource carrying capacity of the Chinese sturgeon was estimated. The results showed that a total of 47species of prey organisms were collected from the Bailong island marine ranch, belonging to 5 phyla and 8 classes, including 38species of benthic animals and 9species of lower-middle organisms. According to historical literature data, all of them could be eaten by Chinese sturgeon; According to the analysis of the contents of the digestive tract, the stocked Chinese sturgeon was adapted to the marine ranch and feed on their own. It is verified that it has ingested a total of 16species of prey organisms collected from 4 phyla and 5 classes. The food composition was arranged according to the relative importance index (IRI): Crustacea (mainly shrimp and crabs)>Gastropoda>Fish>Pleurobranchia>Polychaete, and the feeding preference was arranged according to the size of the feeding selection coefficient: Crustacea>Belly Foot class>Petalbranch class>Polychaete>Fish. The annual maximum sustainable yield of potential bait resources of Chinese sturgeon in Bailong island marine ranch is about 811.389 kg, which can be used for 69 Chinese sturgeon juveniles to grow to sexual maturity. The results of this study indicate that the offshore fenced marine ranch is a potential model for marine conservation of Chinese sturgeon. In the next step, it is necessary to further study how to improve the scale and effect of marine fence conservation under the mode of artificial supplementation of natural bait, so as to provide basic data for the formation of Chinese sturgeon land-sea relay conservation.
,
Available online
, doi: 10.7541/2022.2021.0400
Abstract:
The purpose of this study was to investigate the effects of cottonseed protein concentrate (CPC) instead of soybean meal on the growth performance, health status and flesh quality of grass carp (Ctenopharyngodon idella). Six isonitrogenous (crude protein: 29%) and isolipidic (crude lipid: 5%) diets were designed. CPC was used to replace 0 (C0), 15% (C15), 30% (C30), 45% (C45), 75% (C75) and 100% (C100) soybean meal in grass carp diets. The grass carp [initial weight of (502.46±0.40) g] were fed in pond cages for 90 days. The results showed that: (1) In terms of growth performance, there was no significant difference in specific growth rate (SGR) and feed conversion ratio (FCR) among groups (P>0.05). The viscerosomatic index (VSI) of grass carp in C45 group was significantly higher than that in C0 group (P<0.05). (2) In terms of health status, the albumin and globulin ratio (A/G) of serum in C100 group was significantly lower than that in C0 group (P<0.05), and the activity of serum superoxide dismutase (SOD) in C15 group was significantly higher than that in C0 group (P<0.05); There were no pathological changes in liver and muscle tissue of grass carp in each group. (3) In terms of flesh quality, compared with C0 group, the crude protein content of grass carp muscle in C75 group and the isoleucine content of C30 group increased significantly (P<0.05), the muscle springiness and adhesiveness of grass carp in C30, C45 and C100 groups increased significantly (P<0.05), and the sarcomere length of grass carp muscle in C75 and C100 groups increased significantly (P<0.05). The results show that CPC can completely replace soybean meal in grass carp diets, improve its immunity and flesh quality.
The purpose of this study was to investigate the effects of cottonseed protein concentrate (CPC) instead of soybean meal on the growth performance, health status and flesh quality of grass carp (Ctenopharyngodon idella). Six isonitrogenous (crude protein: 29%) and isolipidic (crude lipid: 5%) diets were designed. CPC was used to replace 0 (C0), 15% (C15), 30% (C30), 45% (C45), 75% (C75) and 100% (C100) soybean meal in grass carp diets. The grass carp [initial weight of (502.46±0.40) g] were fed in pond cages for 90 days. The results showed that: (1) In terms of growth performance, there was no significant difference in specific growth rate (SGR) and feed conversion ratio (FCR) among groups (P>0.05). The viscerosomatic index (VSI) of grass carp in C45 group was significantly higher than that in C0 group (P<0.05). (2) In terms of health status, the albumin and globulin ratio (A/G) of serum in C100 group was significantly lower than that in C0 group (P<0.05), and the activity of serum superoxide dismutase (SOD) in C15 group was significantly higher than that in C0 group (P<0.05); There were no pathological changes in liver and muscle tissue of grass carp in each group. (3) In terms of flesh quality, compared with C0 group, the crude protein content of grass carp muscle in C75 group and the isoleucine content of C30 group increased significantly (P<0.05), the muscle springiness and adhesiveness of grass carp in C30, C45 and C100 groups increased significantly (P<0.05), and the sarcomere length of grass carp muscle in C75 and C100 groups increased significantly (P<0.05). The results show that CPC can completely replace soybean meal in grass carp diets, improve its immunity and flesh quality.
,
Available online
, doi: 10.7541/2022.2021.0407
Abstract:
Enteromorpha prolifera is a common large-scale alga, which can make filaments grow vertically in the pond in a short time (1—2 weeks). It is a common enemy organism in filter feeding shellfish culture ponds. Once it breaks out, it will not only affect the growth of cultured varieties, but also cause biological diseases and even endanger the survival of cultured varieties, resulting in economic losses. This paper attempts to make use of the habit of Siganus guttatus feeding on Enteromorpha prolifera, and compare Enteromorpha prolifera as a natural bait with artificial feed. In order to study the structure of digestive tract flora, digestive enzyme and nonspecific immune enzyme activity of juvenile Siganus guttatus were fed with artificial feed and Enteromorpha prolifera respectively. High-throughput sequencing technology combined with biochemical analysis methods were used to systematically analyze and compare the composition and distribution of microflora in the stomach, pyloric caecum and intestine of juvenile Siganus guttatus, and to compare the influence on growth performance and digestive enzyme activity of the juvenile Siganus guttatus with the two diets. Biochemical analysis showed that although the growth performance of juvenile Siganus guttatus fed with Enteromorpha prolifera was lower than that of the artificial feed group, its amylase activity was higher than that of the artificial feed group. The juvenile Siganus guttatus had good feeding and digestive ability to Enteromorpha prolifera, which was enough to meet the growth needs of Siganus guttatus. The activities of alkaline phosphatase and superoxide dismutase in the digestive tract of Enteromorpha prolifera group were significantly higher than those in the artificial diet group, showing higher immune and antioxidant capacity. High throughput sequencing results showed that bacterial diversity shows an upward trend with the extension of the digestive tract. The dominant bacteria in the digestive tract were Proteobacteria, Firmicutes and Bacteroidetes. The composition of bacteria in the digestive tract of Siganus guttatus was greatly affected by the diet. The results can provide data support for the bait research of Siganus guttatus. At the same time, it shows that the feeding of Siganus guttatus on Enteromorpha prolifera has a good feasibility basis and significant ecological value, which is worthy of in-depth research and promotion.
Enteromorpha prolifera is a common large-scale alga, which can make filaments grow vertically in the pond in a short time (1—2 weeks). It is a common enemy organism in filter feeding shellfish culture ponds. Once it breaks out, it will not only affect the growth of cultured varieties, but also cause biological diseases and even endanger the survival of cultured varieties, resulting in economic losses. This paper attempts to make use of the habit of Siganus guttatus feeding on Enteromorpha prolifera, and compare Enteromorpha prolifera as a natural bait with artificial feed. In order to study the structure of digestive tract flora, digestive enzyme and nonspecific immune enzyme activity of juvenile Siganus guttatus were fed with artificial feed and Enteromorpha prolifera respectively. High-throughput sequencing technology combined with biochemical analysis methods were used to systematically analyze and compare the composition and distribution of microflora in the stomach, pyloric caecum and intestine of juvenile Siganus guttatus, and to compare the influence on growth performance and digestive enzyme activity of the juvenile Siganus guttatus with the two diets. Biochemical analysis showed that although the growth performance of juvenile Siganus guttatus fed with Enteromorpha prolifera was lower than that of the artificial feed group, its amylase activity was higher than that of the artificial feed group. The juvenile Siganus guttatus had good feeding and digestive ability to Enteromorpha prolifera, which was enough to meet the growth needs of Siganus guttatus. The activities of alkaline phosphatase and superoxide dismutase in the digestive tract of Enteromorpha prolifera group were significantly higher than those in the artificial diet group, showing higher immune and antioxidant capacity. High throughput sequencing results showed that bacterial diversity shows an upward trend with the extension of the digestive tract. The dominant bacteria in the digestive tract were Proteobacteria, Firmicutes and Bacteroidetes. The composition of bacteria in the digestive tract of Siganus guttatus was greatly affected by the diet. The results can provide data support for the bait research of Siganus guttatus. At the same time, it shows that the feeding of Siganus guttatus on Enteromorpha prolifera has a good feasibility basis and significant ecological value, which is worthy of in-depth research and promotion.
,
Available online
, doi: 10.7541/2022.2021.0364
Abstract:
The spatio-temporal ecological niche characteristics and influencing factors of major nekton species was determined by the relative importance, aggregation intensity, niche width, niche overlap and redundancy analysis based on data from four voyage fixed bottom trawl surveys in October 2019 (autumn), December 2019 (winter), April 2020 (spring) and August 2021 (summer). The results of the study showed that: (1) 214species of nekton were identified in the surveyed sea area, with 18 dominant species. There is an obvious seasonal turnover of dominant species, with higher aggregation intensity of dominant species in summer and lower in spring. (2) In the temporal dimension, Metapenaeposis barbata had the largest ecotone width (0.99); The niche overlap of seven groups was equal to 1.00; In the spatial dimension, the niche width of Trachurus japonicus was the largest (2.57); The spatial niche overlap value of major nekton species exceeding 0.6 accounted for 71.3%; In the spatio-temporal dimension, Trachurus japonicus had the largest niche width (2.45) and Leiognathus ruconius Hamilton had the largest spatio-temporal niche overlap width (0.94) with Thrissa kammalensis Bleeker. (3) The redundancy analysis showed that bottom temperature and bottom salinity were the key factors affecting the spatio-temporal niche characteristics of the major nekton species in Minnan fishing ground.
The spatio-temporal ecological niche characteristics and influencing factors of major nekton species was determined by the relative importance, aggregation intensity, niche width, niche overlap and redundancy analysis based on data from four voyage fixed bottom trawl surveys in October 2019 (autumn), December 2019 (winter), April 2020 (spring) and August 2021 (summer). The results of the study showed that: (1) 214species of nekton were identified in the surveyed sea area, with 18 dominant species. There is an obvious seasonal turnover of dominant species, with higher aggregation intensity of dominant species in summer and lower in spring. (2) In the temporal dimension, Metapenaeposis barbata had the largest ecotone width (0.99); The niche overlap of seven groups was equal to 1.00; In the spatial dimension, the niche width of Trachurus japonicus was the largest (2.57); The spatial niche overlap value of major nekton species exceeding 0.6 accounted for 71.3%; In the spatio-temporal dimension, Trachurus japonicus had the largest niche width (2.45) and Leiognathus ruconius Hamilton had the largest spatio-temporal niche overlap width (0.94) with Thrissa kammalensis Bleeker. (3) The redundancy analysis showed that bottom temperature and bottom salinity were the key factors affecting the spatio-temporal niche characteristics of the major nekton species in Minnan fishing ground.
,
Available online
, doi: 10.7541/2023.2022.0348
Abstract:
Procambarus clarkii, commonly known as "crayfish" or "freshwater crayfish", is one of the most important freshwater aquaculture species in Chinese mainland. Recently, the aquaculture area and production of the crayfish in Chinese mainland have been continuously increased. However, the stress response caused by various factors, such as climate change, transportation and environmental change has led to more and more serious problems, including explosive disease and even death during culturing the crayfish, which not only decreased the crayfish product quality, but also resulted in serious damage to the crayfish breeding industry. In this study, we first treated the crayfish by transportation and temperature stresses to select the stronger stress resistant (SSR) and the weaker stress resistant (WSR) crayfishes. Then we dissected the hepatopancreas of SSR and WSR crayfishes to compare the metabolomics by Liquid Chromotography-Mass Spectrometry/Mass Spectrometry (LC-MS/MS). A total of 10292 ions were detected, from which 464 metabolites were identified to be significant different between SSR and WSR (fold change>1.2, P<0.05, and VIP>1.0). Among them, 227 metabolites were down-regulated and 237 metabolites were up-regulated in SSR relative to WSR. KEGG analysis showed that these differential metabolites were mainly enriched in amino acid metabolic pathways, including histidine metabolism, taurine and hypotaurine metabolism, lysine degradation, valine, leucine and isoleucine biosynthesis, and glutathione metabolism. They also enriched in ascorbate and aldarate metabolism, carbohydrate metabolic pathways (pentose and glucuronate interconversions), fatty acid metabolic pathways (unsaturated fatty acid biosynthesis), etc. These results indicate that there are a wide range of metabolic responses in response to transportation and temperature stress, and some metabolites related to antioxidative stress and enhancing immunity, such as γ-L-Glutamyl-L-cysteine, taurine, and oleic acid, may play an important role in the stress resistance in P. clarkii. This study can not only provide new insights for studying mechanisms of animal stress resistance, but also have important value in developing strategies to cope with the stress response and in breeding new aquaculture strains with strong stress resistance.
Procambarus clarkii, commonly known as "crayfish" or "freshwater crayfish", is one of the most important freshwater aquaculture species in Chinese mainland. Recently, the aquaculture area and production of the crayfish in Chinese mainland have been continuously increased. However, the stress response caused by various factors, such as climate change, transportation and environmental change has led to more and more serious problems, including explosive disease and even death during culturing the crayfish, which not only decreased the crayfish product quality, but also resulted in serious damage to the crayfish breeding industry. In this study, we first treated the crayfish by transportation and temperature stresses to select the stronger stress resistant (SSR) and the weaker stress resistant (WSR) crayfishes. Then we dissected the hepatopancreas of SSR and WSR crayfishes to compare the metabolomics by Liquid Chromotography-Mass Spectrometry/Mass Spectrometry (LC-MS/MS). A total of 10292 ions were detected, from which 464 metabolites were identified to be significant different between SSR and WSR (fold change>1.2, P<0.05, and VIP>1.0). Among them, 227 metabolites were down-regulated and 237 metabolites were up-regulated in SSR relative to WSR. KEGG analysis showed that these differential metabolites were mainly enriched in amino acid metabolic pathways, including histidine metabolism, taurine and hypotaurine metabolism, lysine degradation, valine, leucine and isoleucine biosynthesis, and glutathione metabolism. They also enriched in ascorbate and aldarate metabolism, carbohydrate metabolic pathways (pentose and glucuronate interconversions), fatty acid metabolic pathways (unsaturated fatty acid biosynthesis), etc. These results indicate that there are a wide range of metabolic responses in response to transportation and temperature stress, and some metabolites related to antioxidative stress and enhancing immunity, such as γ-L-Glutamyl-L-cysteine, taurine, and oleic acid, may play an important role in the stress resistance in P. clarkii. This study can not only provide new insights for studying mechanisms of animal stress resistance, but also have important value in developing strategies to cope with the stress response and in breeding new aquaculture strains with strong stress resistance.
,
Available online
, doi: 10.7541/2023.2022.0353
Abstract:
Swamp eel (Monopterus albus) is one of the most important cultured fresh water species with high economic value in China. However, the present compound diets could not meet the growth and gonad development of swamp eel broodstocks, which hampered the large-scaled aquaculture of this species. Therefore, the reproduction improvement of swamp eels by optimization of the compound diet formulation, is on the urgent need. Antarctic krill meal is rich in sustainable resources and has the same nutritional level as fish meal, which meets the requirements of a new type of animal protein source for feed. Reports showed that Antarctic krill meal inclusion improved the growth and reproduction of several aquatic animals. In this study, two-winter-age female Monopterus albus with an initial body weight of 36.41±3.62 g was adopted. Antarctic krill meal was included to replace 0, 20%, 40%, 60%, 80%, and 100% fish meal to make 6 groups of iso-nitrogenous and iso-energetic diets. After 12 weeks of culture, the growth performance, body composition, hepatic anti-oxidant capacity and non-specific immunity, and fecundity of six groups of experimental eels were determined. The results showed that the weight gain rate (WGR) and specific growth rate (SGR) of eels had no significant differences in 20% replacement group and the control group (P>0.05). However, the further increase of Antarctic krill meal substitution (>40%) led to the growth performance reduction. In muscle, crude protein concentration was higher in 20% substitution group than the other experimental groups; no significant differences were observed in the crude lipid and ash concentrations among different groups in muscle of swamp eels (P>0.05). In ovary, the nutrient composition had no significant difference between groups of 20% substitution group and the control group (P>0.05). However, concentrations of crude protein and crude lipid decreased significantly while the moisture concentration increased gradually by Antarctic krill meal substitution from 60% to 100%. The further detection of the anti-oxidant capacity of liver revealed that superoxide dismutase (SOD) activity decreased gradually albeit with the increase of malondialdehyde (MDA) concentration in groups of Antarctic krill meal substitution higher than 40%. The catalase (CAT) activity in 100% substitution group was lower than the other five groups. The following non-specific immunity evaluation of liver suggested that no significant differences were observed between 20% substitution group and the control group in parameters of alkaline phosphatase (AKP), complement 4 (C4), and immunoglobulin M (IgM) (P>0.05). When the Antarctic krill meal substitution level were 60% or higher, the AKP activity showed the increased trend, while concentrations of C4 and IgM decreased instead. Lastly, fecundity of swamp eels in all groups were examined. The 20% Antarctic krill meal substitution did not influence fecundity parameters including gonadosomatic index (GSI), absolute fecundity, relative fecundity and serum estradiol concentration (P>0.05) in swamp eels. GSI in 80% and 100% groups were lower than that of 40% and 60% groups. From 60% to 100% substitution groups, the absolute fecundity, relative fecundity and estradiol concentrations decreased gradually with the increase of Antarctic krill meal inclusion. However, egg diameters increased gradually with the increase of krill meal inclusions, but significant differences were only found from 100% group to groups of 0 and 20% (P<0.05). From the above results, it showed that the growth performance, ovarian nutrient composition, hepatic anti-oxidant capacity and non-specific immunity, and fecundity will not be influenced when 20% fish meal were replaced by Antarctic krill meal in diets of female swamp eels. Higher substitutions of Antarctic krill meal will intensify the adverse effect on this fish species. Therefore, the substitution of Antarctic krill meal of fish meal should not exceed 20% in formulated diets of female Monopterus albus.
Swamp eel (Monopterus albus) is one of the most important cultured fresh water species with high economic value in China. However, the present compound diets could not meet the growth and gonad development of swamp eel broodstocks, which hampered the large-scaled aquaculture of this species. Therefore, the reproduction improvement of swamp eels by optimization of the compound diet formulation, is on the urgent need. Antarctic krill meal is rich in sustainable resources and has the same nutritional level as fish meal, which meets the requirements of a new type of animal protein source for feed. Reports showed that Antarctic krill meal inclusion improved the growth and reproduction of several aquatic animals. In this study, two-winter-age female Monopterus albus with an initial body weight of 36.41±3.62 g was adopted. Antarctic krill meal was included to replace 0, 20%, 40%, 60%, 80%, and 100% fish meal to make 6 groups of iso-nitrogenous and iso-energetic diets. After 12 weeks of culture, the growth performance, body composition, hepatic anti-oxidant capacity and non-specific immunity, and fecundity of six groups of experimental eels were determined. The results showed that the weight gain rate (WGR) and specific growth rate (SGR) of eels had no significant differences in 20% replacement group and the control group (P>0.05). However, the further increase of Antarctic krill meal substitution (>40%) led to the growth performance reduction. In muscle, crude protein concentration was higher in 20% substitution group than the other experimental groups; no significant differences were observed in the crude lipid and ash concentrations among different groups in muscle of swamp eels (P>0.05). In ovary, the nutrient composition had no significant difference between groups of 20% substitution group and the control group (P>0.05). However, concentrations of crude protein and crude lipid decreased significantly while the moisture concentration increased gradually by Antarctic krill meal substitution from 60% to 100%. The further detection of the anti-oxidant capacity of liver revealed that superoxide dismutase (SOD) activity decreased gradually albeit with the increase of malondialdehyde (MDA) concentration in groups of Antarctic krill meal substitution higher than 40%. The catalase (CAT) activity in 100% substitution group was lower than the other five groups. The following non-specific immunity evaluation of liver suggested that no significant differences were observed between 20% substitution group and the control group in parameters of alkaline phosphatase (AKP), complement 4 (C4), and immunoglobulin M (IgM) (P>0.05). When the Antarctic krill meal substitution level were 60% or higher, the AKP activity showed the increased trend, while concentrations of C4 and IgM decreased instead. Lastly, fecundity of swamp eels in all groups were examined. The 20% Antarctic krill meal substitution did not influence fecundity parameters including gonadosomatic index (GSI), absolute fecundity, relative fecundity and serum estradiol concentration (P>0.05) in swamp eels. GSI in 80% and 100% groups were lower than that of 40% and 60% groups. From 60% to 100% substitution groups, the absolute fecundity, relative fecundity and estradiol concentrations decreased gradually with the increase of Antarctic krill meal inclusion. However, egg diameters increased gradually with the increase of krill meal inclusions, but significant differences were only found from 100% group to groups of 0 and 20% (P<0.05). From the above results, it showed that the growth performance, ovarian nutrient composition, hepatic anti-oxidant capacity and non-specific immunity, and fecundity will not be influenced when 20% fish meal were replaced by Antarctic krill meal in diets of female swamp eels. Higher substitutions of Antarctic krill meal will intensify the adverse effect on this fish species. Therefore, the substitution of Antarctic krill meal of fish meal should not exceed 20% in formulated diets of female Monopterus albus.
,
Available online
, doi: 10.7541/2023.2022.0286
Abstract:
Hypothalamus are the important endocrine organs, which play key roles in regulating body growth, reproduction and hormone activity in other endocrine glands and organs. Estrogen, an important sex steroid hormone, is mainly synthesized and secreted in the gonads. It could regulate the reproduction and growth related genes expression in hypothalamus through feedback, and then participate in the regulation of corresponding physiological activities. Spotted scat (Scatophagus argus) is a good model to investigate the sexual growth dimorphism with a faster growth in females than males. The effect of 17β-estradiol (E2) injection in vivo on genes expression in hypothalamus of XY male spotted scat and the differences in genes expression between XY males and XX females remain unclear. In order to explore gene expression difference between XY male and XX female spotted scat hypothalamus and effect of in vivo injection in XY males, transcriptome analysis of hypothalamus were carried out, including sequencing data quality control, gene function annotation, differentially expressed gene (DEGs) screening and identification and pathway enrichment analysis, then real-time quantitative PCR (qPCR) was performed to detect genes expression. A total of 275833710 clean reads were sequenced in this study, and the Q30 and GC value were more than 95% and 48%, respectively. In Ctrl-XX-H vs Ctrl-XY-H group, 91 DEGs were screened and identified successfully, including 36 up-regulated and 55 down-regulated genes. In Ctrl-XX-H vs E2 -XY-H group, 28 DEGs were screened and identified, including 11 up-regulated and 17 down-regulated genes. GO and KEGG pathway analysis showed that DEGs was significantly enriched in biological processes such as cells, single cell, membrane, membrane components, and signal pathways such as ubiquinone and other terpene quinone biosynthesis, steroid hormone biosynthesis. By transcriptome and qPCR analyses, the expression of nrip1b, prl, hspa8b, snx21, cep63, ccna1, hsp90aa1.1, slc1a5, zar1, slc25a1b and loc124068175, were significantly different between XX and XY spotted scat, while the reproductive axis genes (sbGnRH, sGnRH and cGnRH) and growth axis genes (ghrh, sst1, sst3, sst5 and sst6) expression showed no significant differences. In XY male fish, six hours after E2 injection, the expression of cdc42ep1a, cyp19a1b, greb1, kank1a, snx21, and tmem30c in hypothalamus were significantly up-regulated, while prl expression was significantly down-regulated. Above results suggest that E2 might regulate some reproduction related genes expression in hypothalamus through feedback effects, which plays the critical roles in gametogenesis and reproduction regulation.
Hypothalamus are the important endocrine organs, which play key roles in regulating body growth, reproduction and hormone activity in other endocrine glands and organs. Estrogen, an important sex steroid hormone, is mainly synthesized and secreted in the gonads. It could regulate the reproduction and growth related genes expression in hypothalamus through feedback, and then participate in the regulation of corresponding physiological activities. Spotted scat (Scatophagus argus) is a good model to investigate the sexual growth dimorphism with a faster growth in females than males. The effect of 17β-estradiol (E2) injection in vivo on genes expression in hypothalamus of XY male spotted scat and the differences in genes expression between XY males and XX females remain unclear. In order to explore gene expression difference between XY male and XX female spotted scat hypothalamus and effect of in vivo injection in XY males, transcriptome analysis of hypothalamus were carried out, including sequencing data quality control, gene function annotation, differentially expressed gene (DEGs) screening and identification and pathway enrichment analysis, then real-time quantitative PCR (qPCR) was performed to detect genes expression. A total of 275833710 clean reads were sequenced in this study, and the Q30 and GC value were more than 95% and 48%, respectively. In Ctrl-XX-H vs Ctrl-XY-H group, 91 DEGs were screened and identified successfully, including 36 up-regulated and 55 down-regulated genes. In Ctrl-XX-H vs E2 -XY-H group, 28 DEGs were screened and identified, including 11 up-regulated and 17 down-regulated genes. GO and KEGG pathway analysis showed that DEGs was significantly enriched in biological processes such as cells, single cell, membrane, membrane components, and signal pathways such as ubiquinone and other terpene quinone biosynthesis, steroid hormone biosynthesis. By transcriptome and qPCR analyses, the expression of nrip1b, prl, hspa8b, snx21, cep63, ccna1, hsp90aa1.1, slc1a5, zar1, slc25a1b and loc124068175, were significantly different between XX and XY spotted scat, while the reproductive axis genes (sbGnRH, sGnRH and cGnRH) and growth axis genes (ghrh, sst1, sst3, sst5 and sst6) expression showed no significant differences. In XY male fish, six hours after E2 injection, the expression of cdc42ep1a, cyp19a1b, greb1, kank1a, snx21, and tmem30c in hypothalamus were significantly up-regulated, while prl expression was significantly down-regulated. Above results suggest that E2 might regulate some reproduction related genes expression in hypothalamus through feedback effects, which plays the critical roles in gametogenesis and reproduction regulation.
,
Available online
, doi: 10.7541/2022.2021.0190
Abstract:
Scientific management and properly utilization of sediment is of significance for healthy aquaculture and resource utilization in long-term culture ponds. Rotation of pond culture and cultivation appropriately is an effective way, which can reuse the nutrients in sediments and improve the sediment environment. Nine ponds with the same basic conditions were suspended aquaculture activities and used for the experiment of rice substrate improvement. Empty pond was used as the control (CK), and two treatments were set: planting rice without field drying (T1) planting rice with field drying group (T2). The main chemical properties and abundance of ammoxidation archaea in the sediments during rice growth were determined, and the community diversity and structure difference of AOA in rice after harvest were determined. The results showed that, compared with CK, the TN, TP and OM in sediments of T1 (or T2) decreased significantly by 26.58% (31.04%), 58.84% (58.38%) and 11.17% (16.11%) respectively. Compared with T1 and T2, it was concluded that the degradation of TP and OM in sediment was accelerated by solarization. The nitrification intensity and the abundance of AOA in the sediments increased at first and then decreased. Compared with CK, the nitrification intensity of T1 and T2 was significantly increased at tillering stage and jointing stage, while the abundance of AOA was significantly increased at tillering stage. Diversity index and OUT number of AOA in sediments were increased and a large amount of new AOA populations generated by rice cultiviton. The increased species in T1 was Candidatus nitrosocosmicus cluster (3.84% of the total sequence), and which in T2 was Candidatus nitrosotenuis cluster (3.24% of the total sequence). It indicated that rice planting can effectively alleviate the nutrient enrichment in pond sediments, which can be used as a supporting measure for sustainable pond aquaculture.
Scientific management and properly utilization of sediment is of significance for healthy aquaculture and resource utilization in long-term culture ponds. Rotation of pond culture and cultivation appropriately is an effective way, which can reuse the nutrients in sediments and improve the sediment environment. Nine ponds with the same basic conditions were suspended aquaculture activities and used for the experiment of rice substrate improvement. Empty pond was used as the control (CK), and two treatments were set: planting rice without field drying (T1) planting rice with field drying group (T2). The main chemical properties and abundance of ammoxidation archaea in the sediments during rice growth were determined, and the community diversity and structure difference of AOA in rice after harvest were determined. The results showed that, compared with CK, the TN, TP and OM in sediments of T1 (or T2) decreased significantly by 26.58% (31.04%), 58.84% (58.38%) and 11.17% (16.11%) respectively. Compared with T1 and T2, it was concluded that the degradation of TP and OM in sediment was accelerated by solarization. The nitrification intensity and the abundance of AOA in the sediments increased at first and then decreased. Compared with CK, the nitrification intensity of T1 and T2 was significantly increased at tillering stage and jointing stage, while the abundance of AOA was significantly increased at tillering stage. Diversity index and OUT number of AOA in sediments were increased and a large amount of new AOA populations generated by rice cultiviton. The increased species in T1 was Candidatus nitrosocosmicus cluster (3.84% of the total sequence), and which in T2 was Candidatus nitrosotenuis cluster (3.24% of the total sequence). It indicated that rice planting can effectively alleviate the nutrient enrichment in pond sediments, which can be used as a supporting measure for sustainable pond aquaculture.
,
Available online
, doi: 10.7541/2023.2022.0270
Abstract:
Odor problems in freshwater caused by 2-methylisoborneol (2-MIB) have received much attention in China recently. The odorous 2-MIB in freshwater is known to be mainly produced by a group of filamentous cyanobacteria which cause offensive taste and odor in drinking water and fish catch. From the detection of MIB synthase gene and GC/MS analyses, 24strains of 2-MIB-producing cyanobacteria were detected in Freshwater Algae Culture Collection at the Institute of Hydrobiology (FACHB-collection), National Aquatic Biological Resource Center, the largest microalgal culture collection in China. These strains were re-identified as Planktothricoides raciborskii (Wołoszyńska) Suda & Watanabe, Aerosakkonema funiforme Thu & Watanabe, Pseudanabaena cinerea Tuji & Niiyama, Oscillatoria lutea var. contorta Baker et Bold, Microcoleus sp., Desertifilum tharense Dadheech & Krienitz and Sodalinema sp. by morphological descriptions and molecular characteristics based on the 16S rRNA gene, respectively. Most 2-MIB-producing strains of Planktothrix in FACHB-collection should be re-identified as P. raciborskii or A. funiforme. This was the first report of 2-MIB-producing filamentous cyanobacteria of Aerosakkonema, Desertifilum and Sodalinema in the world, and was also the first report of 2-MIB-producing Microcoleus in China. The phylogenetic analyses base on 16S rRNA gene indicated that 2-MIB-producing strains in FACHB-collection were placed on seven separated clades, which reflected true taxonomic relationships. The genera Planktothricoides, Aerosakkonema, Pseudanabaena, Microcoleus, Desertifilum and Sodalinema formed six monophyletic clades in 16S rDNA tree; however, O. lutea var. contorta was closely related to some strains of Oscillatoria, Phormidium and Kamptonema. The phylogenetic analyses based on mic gene indicated that 2-MIB-producing cyanobacteria strains formed five clades with high support values. 2-MIB-producing P. raciborskii and A. funiforme were clustered into Clade I in mic tree. Two 2-MIB-producing Microcoleus strains were placed on Clade Ⅱ and Ⅲ, respectively. All 2-MIB-producing Pseudanabaena strains were clustered into Clade Ⅳ. Phylogenetic topology of some 2-MIB-producing strains in mic tree were incongruent with the topology in 16S rDNA tree. Cell quota of 2-MIB produced by these strains may vary in a wide range, varying from 6—2549 fg/cell. Cell quota of 2-MIB varied considerably among species, such as P. raciborskii > A. funiforme > P. cinerea. The results provide important experimental materials and basic data on morphological, molecular, ecological and 2-MIB-producing characteristics of filamentous cyanobacteria, and contribute to understanding ecophysiological characteristics 2-MIB-producing cyanobacteria.
Odor problems in freshwater caused by 2-methylisoborneol (2-MIB) have received much attention in China recently. The odorous 2-MIB in freshwater is known to be mainly produced by a group of filamentous cyanobacteria which cause offensive taste and odor in drinking water and fish catch. From the detection of MIB synthase gene and GC/MS analyses, 24strains of 2-MIB-producing cyanobacteria were detected in Freshwater Algae Culture Collection at the Institute of Hydrobiology (FACHB-collection), National Aquatic Biological Resource Center, the largest microalgal culture collection in China. These strains were re-identified as Planktothricoides raciborskii (Wołoszyńska) Suda & Watanabe, Aerosakkonema funiforme Thu & Watanabe, Pseudanabaena cinerea Tuji & Niiyama, Oscillatoria lutea var. contorta Baker et Bold, Microcoleus sp., Desertifilum tharense Dadheech & Krienitz and Sodalinema sp. by morphological descriptions and molecular characteristics based on the 16S rRNA gene, respectively. Most 2-MIB-producing strains of Planktothrix in FACHB-collection should be re-identified as P. raciborskii or A. funiforme. This was the first report of 2-MIB-producing filamentous cyanobacteria of Aerosakkonema, Desertifilum and Sodalinema in the world, and was also the first report of 2-MIB-producing Microcoleus in China. The phylogenetic analyses base on 16S rRNA gene indicated that 2-MIB-producing strains in FACHB-collection were placed on seven separated clades, which reflected true taxonomic relationships. The genera Planktothricoides, Aerosakkonema, Pseudanabaena, Microcoleus, Desertifilum and Sodalinema formed six monophyletic clades in 16S rDNA tree; however, O. lutea var. contorta was closely related to some strains of Oscillatoria, Phormidium and Kamptonema. The phylogenetic analyses based on mic gene indicated that 2-MIB-producing cyanobacteria strains formed five clades with high support values. 2-MIB-producing P. raciborskii and A. funiforme were clustered into Clade I in mic tree. Two 2-MIB-producing Microcoleus strains were placed on Clade Ⅱ and Ⅲ, respectively. All 2-MIB-producing Pseudanabaena strains were clustered into Clade Ⅳ. Phylogenetic topology of some 2-MIB-producing strains in mic tree were incongruent with the topology in 16S rDNA tree. Cell quota of 2-MIB produced by these strains may vary in a wide range, varying from 6—2549 fg/cell. Cell quota of 2-MIB varied considerably among species, such as P. raciborskii > A. funiforme > P. cinerea. The results provide important experimental materials and basic data on morphological, molecular, ecological and 2-MIB-producing characteristics of filamentous cyanobacteria, and contribute to understanding ecophysiological characteristics 2-MIB-producing cyanobacteria.
,
Available online
, doi: 10.7541/2023.2022.0376
Abstract:
To evaluate the effects of dietary coenzyme Q10 (CoQ10) on growth performance, body composition, antioxidant capacity, tissue structure and gene expression in juvenile genetically improved farmed tilapia (GIFT), juvenile GIFT tilapia with initial body weight of (19.97±0.13) g were fed with four diets containing 0, 40, 80 and 120 mg/kg CoQ10 for a 56-day trial. The results showed that the final body weight (FBW), feeding rate (FR), specific growth rate (SGR) and feed efficiency (FE) of supplemented CoQ10 groups had no significant difference compared with the control group, while 120 mg/kg CoQ10 group had the highest final body weight, specific growth rate and feed efficiency. The dry matter digestibility (DMD) of juvenile GIFT tilapia significantly increased when CoQ10 content was 120 mg/kg. The serum activities of catalase (CAT) and glutathione peroxidase (GSH-Px) in CoQ10 groups were significantly higher than those in the control group. The CAT and GSH-Px activities in liver of the CoQ10 groups were significantly higher than those in the control group. The SOD and GST activities in liver of 80 and 120 mg/kg CoQ10 groups were significantly higher than those in control group while malondialdehyde (MDA) content was significantly decreased. There was no significant difference in the moisture, crude protein and ash contents in the eviscerated whole fish among all groups. Compared with the control group, 120 mg/kg CoQ10significantly decreased crude lipid content in the eviscerated whole fish. There was no significant difference in the moisture, crude protein, crude lipid and ash contents in the visceral mass among all groups. No significant histological changes in liver were identified in all groups. The intestinal villi length, villi density and muscle thickness in the 120 mg/kg group significantly increased. The expression of sod, cat, gsh-px, gst and igm mRNA in 120 mg/kg CoQ10 group were significantly higher than the control group, while the expression of il-1β and il-8 mRNA significantly decreased in the CoQ10 groups compared with the control group. In the challenge experiment by intraperitoneal injection with Aeromonas hydrophila, the cumulative survival rate of juvenile GIFT tilapia in 80 and 120 mg/kg coenzyme Q10 groups was significantly higher than that in control group. In conclusion, these results suggested that dietary CoQ10 content within 120 mg/kg has no adverse effects on juvenile GIFT tilapia, dietary 120 mg/kg CoQ10 could improve digestibility, antioxidant abilities, liver antioxidant-related gene expression and resistance to Aeromonas hydrophila of juvenile GIFT tilapia.
To evaluate the effects of dietary coenzyme Q10 (CoQ10) on growth performance, body composition, antioxidant capacity, tissue structure and gene expression in juvenile genetically improved farmed tilapia (GIFT), juvenile GIFT tilapia with initial body weight of (19.97±0.13) g were fed with four diets containing 0, 40, 80 and 120 mg/kg CoQ10 for a 56-day trial. The results showed that the final body weight (FBW), feeding rate (FR), specific growth rate (SGR) and feed efficiency (FE) of supplemented CoQ10 groups had no significant difference compared with the control group, while 120 mg/kg CoQ10 group had the highest final body weight, specific growth rate and feed efficiency. The dry matter digestibility (DMD) of juvenile GIFT tilapia significantly increased when CoQ10 content was 120 mg/kg. The serum activities of catalase (CAT) and glutathione peroxidase (GSH-Px) in CoQ10 groups were significantly higher than those in the control group. The CAT and GSH-Px activities in liver of the CoQ10 groups were significantly higher than those in the control group. The SOD and GST activities in liver of 80 and 120 mg/kg CoQ10 groups were significantly higher than those in control group while malondialdehyde (MDA) content was significantly decreased. There was no significant difference in the moisture, crude protein and ash contents in the eviscerated whole fish among all groups. Compared with the control group, 120 mg/kg CoQ10significantly decreased crude lipid content in the eviscerated whole fish. There was no significant difference in the moisture, crude protein, crude lipid and ash contents in the visceral mass among all groups. No significant histological changes in liver were identified in all groups. The intestinal villi length, villi density and muscle thickness in the 120 mg/kg group significantly increased. The expression of sod, cat, gsh-px, gst and igm mRNA in 120 mg/kg CoQ10 group were significantly higher than the control group, while the expression of il-1β and il-8 mRNA significantly decreased in the CoQ10 groups compared with the control group. In the challenge experiment by intraperitoneal injection with Aeromonas hydrophila, the cumulative survival rate of juvenile GIFT tilapia in 80 and 120 mg/kg coenzyme Q10 groups was significantly higher than that in control group. In conclusion, these results suggested that dietary CoQ10 content within 120 mg/kg has no adverse effects on juvenile GIFT tilapia, dietary 120 mg/kg CoQ10 could improve digestibility, antioxidant abilities, liver antioxidant-related gene expression and resistance to Aeromonas hydrophila of juvenile GIFT tilapia.
,
Available online
, doi: 10.7541/2023.2020.269
Abstract:
Tumor necrosis factor receptor (TNFR)-associated factor 3(TRAF3) is a highly versatile regulator in many immune pathways, including TNFR and Toll-like receptor (TLRs)/RIG-I-like receptors (RLRs) signal pathway. In this study, a TRAF3 gene was cloned from Oreochromis niloticus (named OnTRAF3), (GenBank No.MN258118), which contained a RING finger, a zinc finger, a coiled-coil and MATH domain. Multiple sequence alignment showed that OnTRAF3shares a relatively high identity with other known TRAF3 proteins. Quantitative real-time PCR (qRT-PCR) analysis showed OnTRAF3 transcripts were highly expressed in brain, skin, intestine and gill, and it could be induced by Streptococcus agalactiae. In HEK293T cells, OnTRAF3 presented both in the cytoplasm and nucleus. In addition, wide type (WT) OnTRAF3, activated NF-κB signal significantly, RING or Zinc finger was important for this activation. This study provides significant insights into the functions of TRAF3 in tilapia.
Tumor necrosis factor receptor (TNFR)-associated factor 3(TRAF3) is a highly versatile regulator in many immune pathways, including TNFR and Toll-like receptor (TLRs)/RIG-I-like receptors (RLRs) signal pathway. In this study, a TRAF3 gene was cloned from Oreochromis niloticus (named OnTRAF3), (GenBank No.MN258118), which contained a RING finger, a zinc finger, a coiled-coil and MATH domain. Multiple sequence alignment showed that OnTRAF3shares a relatively high identity with other known TRAF3 proteins. Quantitative real-time PCR (qRT-PCR) analysis showed OnTRAF3 transcripts were highly expressed in brain, skin, intestine and gill, and it could be induced by Streptococcus agalactiae. In HEK293T cells, OnTRAF3 presented both in the cytoplasm and nucleus. In addition, wide type (WT) OnTRAF3, activated NF-κB signal significantly, RING or Zinc finger was important for this activation. This study provides significant insights into the functions of TRAF3 in tilapia.
,
Available online
, doi: 10.7541/2022.2021.0309
Abstract:
The Cladophora overgrowth has become a widespread global problem. The decomposition of Cladophora biomass releases large amounts of dissolved organic matter (DOM), a key substance in the biogeochemical cycle of carbon in aquatic ecosystems, resulting in a more complex organic pollution in water bodies. Field investigations and indoor experiments have proven that one of the sources of endogenous DOM in water bodies is the biodegradation of algae. Microorganisms play an important role in the decay of aquatic plants, and bacteria differ in their metabolic preferences and affinity for substrates. Bacterial diversity and community composition may both influence and respond to changes in DOM. However, it is not clear how the microbial community and the DOM composition of the surrounding water column change during the decomposition of the Cladophora. In order to study the composition of algal-derived DOM, we simulated the decay process of Cladophora in the laboratory. The experiment was carried out in a constant temperature incubator. 10 g (fresh weight) of Cladophora was placed into sterile polyethylene plastic bottles with 500 mL of sterile water and placed in dark conditions at 25℃ to decay naturally. Three replicate samples were randomly selected for chemical and microbiological analysis at 1, 4, 7, 10, 15, 20, 30 and 40 days. We performed 16S amplicon sequencing of algal-attached microorganisms to analyse the dynamic process of microbial self-assembly on decaying algae. The results showed that during the 40-day decomposition experiment, the biomass of Cladophora decreased, and it showed a trend of rapid loss in the early stages and slowed down in the later stages. At the end of the experiment (40 days), the dry matter residual rate was 43.15% and the mass loss was 56.85%. During the decomposition process of Cladophora, DOM quickly released to the maximum within 7-10 days. The composition of DOM also became complicated, and the fluorescence peaks gradually shifted from regions Ⅰ, Ⅱ and Ⅳ to regions Ⅲ and Ⅴ. A large amount of simple aromatic proteins, such as tyrosine, were transformed into various metabolites by microorganisms, and humic substances were produced. The dominant phyla of microorganisms attached to the Cladophora were Proteobacteria, Bacteroidetes and Firmicutes, with relative abundances ranging from 6.54% to 71.62%, 16.83% to 55.50% and 0.95% to 20.91%, respectively. In different stages of the decay process, the composition of microorganisms was significantly different, which was mainly dominated by Proteobacteria in the early stage and Bacteroidetes in the late stage of the experiment. Pearson's correlation (R=0.81, P=0.001) between Bray-Curtis distance and Euclidean distance of DOM composition for bacterial communities was calculated using the Mantel test (999 ranking). The results of the Mantel test indicated that changes in DOM composition were significantly correlated with changes in the composition of the bacterial community. These findings have implications for further understanding of the characteristics of DOM released during the decay of Cladophora blooms and the relationship between DOM and microbial communities, and provide theoretical support for the management of filamentous green algae blooms.
The Cladophora overgrowth has become a widespread global problem. The decomposition of Cladophora biomass releases large amounts of dissolved organic matter (DOM), a key substance in the biogeochemical cycle of carbon in aquatic ecosystems, resulting in a more complex organic pollution in water bodies. Field investigations and indoor experiments have proven that one of the sources of endogenous DOM in water bodies is the biodegradation of algae. Microorganisms play an important role in the decay of aquatic plants, and bacteria differ in their metabolic preferences and affinity for substrates. Bacterial diversity and community composition may both influence and respond to changes in DOM. However, it is not clear how the microbial community and the DOM composition of the surrounding water column change during the decomposition of the Cladophora. In order to study the composition of algal-derived DOM, we simulated the decay process of Cladophora in the laboratory. The experiment was carried out in a constant temperature incubator. 10 g (fresh weight) of Cladophora was placed into sterile polyethylene plastic bottles with 500 mL of sterile water and placed in dark conditions at 25℃ to decay naturally. Three replicate samples were randomly selected for chemical and microbiological analysis at 1, 4, 7, 10, 15, 20, 30 and 40 days. We performed 16S amplicon sequencing of algal-attached microorganisms to analyse the dynamic process of microbial self-assembly on decaying algae. The results showed that during the 40-day decomposition experiment, the biomass of Cladophora decreased, and it showed a trend of rapid loss in the early stages and slowed down in the later stages. At the end of the experiment (40 days), the dry matter residual rate was 43.15% and the mass loss was 56.85%. During the decomposition process of Cladophora, DOM quickly released to the maximum within 7-10 days. The composition of DOM also became complicated, and the fluorescence peaks gradually shifted from regions Ⅰ, Ⅱ and Ⅳ to regions Ⅲ and Ⅴ. A large amount of simple aromatic proteins, such as tyrosine, were transformed into various metabolites by microorganisms, and humic substances were produced. The dominant phyla of microorganisms attached to the Cladophora were Proteobacteria, Bacteroidetes and Firmicutes, with relative abundances ranging from 6.54% to 71.62%, 16.83% to 55.50% and 0.95% to 20.91%, respectively. In different stages of the decay process, the composition of microorganisms was significantly different, which was mainly dominated by Proteobacteria in the early stage and Bacteroidetes in the late stage of the experiment. Pearson's correlation (R=0.81, P=0.001) between Bray-Curtis distance and Euclidean distance of DOM composition for bacterial communities was calculated using the Mantel test (999 ranking). The results of the Mantel test indicated that changes in DOM composition were significantly correlated with changes in the composition of the bacterial community. These findings have implications for further understanding of the characteristics of DOM released during the decay of Cladophora blooms and the relationship between DOM and microbial communities, and provide theoretical support for the management of filamentous green algae blooms.
,
Available online
, doi: 10.7541/2023.2022.0330
Abstract:
Acrossocheilus fasciatus has been main economical fish in the mountain areas of Zhejiang province because of its high economic value and increasing demand. Based on 16S rRNA high-throughput sequencing, we systematically studied the correlation between intestinal microbiota of larval and juvenile Acrossocheilus fasciatus and bacterial community of culture water within the same period. The results showed that Chao1 and Shannon indices had no significant changes in intestinal microbiota of larval and juvenile A. fasciatus (P>0.05); however, the Chao1 and Shannon indices of culture water showed a significant downward trend with the development of A. fasciatus (P<0.05). ANOSIM analysis revealed that the compositions of intestinal microbiota in the larval and juvenile A. fasciatus were significantly different from the bacterial community of culture water (P<0.05). The dominant phyla were Proteobacteria, Bacteroidetes and Firmicutes in the intestinal microbiota of larval A. fasciatus, while Proteobacteria was the dominant phylum in culture water within the same period. Fusobacteria and Proteobacteria were the dominant phyla in the intestinal microbiota of juvenile A. fasciatus, while the dominant phylum in culture water within the same period consisted of Proteobacteria, Bacteroidetes and Fusobacteria. Linear regression analysis revealed that the changes of relative abundance of Proteobacteria, Firmicutes and Fusobacteria were consistent in the A. fasciatus and culture water. At the genus level, Acetobacter was the dominant genus in the intestinal microbiota of larval A. fasciatus, while Cetobacterium was the dominant genus in juvenile A. fasciatus. Rare taxa and conditional rare taxa were the main taxa in the intestinal microbiota of A. fasciatus and bacterial community of culture water. Correlation analysis showed that no significant correlation was observed between intestinal microbiota of A. fasciatus and bacterial community of culture water (P>0.05). SourceTracker analysis verified that the proportional contributions of culture water to shaping the intestinal microbiota of the larval and juvenile A. fasciatus ranged from 0.39% to 28.67%. This study revealed the composition, structure and succession changes of the intestinal microbiota in larval and juvenile A. fasciatus and the bacterial community in culture water, which provided a reference for further study on the intestinal microbiota and healthy cultivation of A. fasciatus.
Acrossocheilus fasciatus has been main economical fish in the mountain areas of Zhejiang province because of its high economic value and increasing demand. Based on 16S rRNA high-throughput sequencing, we systematically studied the correlation between intestinal microbiota of larval and juvenile Acrossocheilus fasciatus and bacterial community of culture water within the same period. The results showed that Chao1 and Shannon indices had no significant changes in intestinal microbiota of larval and juvenile A. fasciatus (P>0.05); however, the Chao1 and Shannon indices of culture water showed a significant downward trend with the development of A. fasciatus (P<0.05). ANOSIM analysis revealed that the compositions of intestinal microbiota in the larval and juvenile A. fasciatus were significantly different from the bacterial community of culture water (P<0.05). The dominant phyla were Proteobacteria, Bacteroidetes and Firmicutes in the intestinal microbiota of larval A. fasciatus, while Proteobacteria was the dominant phylum in culture water within the same period. Fusobacteria and Proteobacteria were the dominant phyla in the intestinal microbiota of juvenile A. fasciatus, while the dominant phylum in culture water within the same period consisted of Proteobacteria, Bacteroidetes and Fusobacteria. Linear regression analysis revealed that the changes of relative abundance of Proteobacteria, Firmicutes and Fusobacteria were consistent in the A. fasciatus and culture water. At the genus level, Acetobacter was the dominant genus in the intestinal microbiota of larval A. fasciatus, while Cetobacterium was the dominant genus in juvenile A. fasciatus. Rare taxa and conditional rare taxa were the main taxa in the intestinal microbiota of A. fasciatus and bacterial community of culture water. Correlation analysis showed that no significant correlation was observed between intestinal microbiota of A. fasciatus and bacterial community of culture water (P>0.05). SourceTracker analysis verified that the proportional contributions of culture water to shaping the intestinal microbiota of the larval and juvenile A. fasciatus ranged from 0.39% to 28.67%. This study revealed the composition, structure and succession changes of the intestinal microbiota in larval and juvenile A. fasciatus and the bacterial community in culture water, which provided a reference for further study on the intestinal microbiota and healthy cultivation of A. fasciatus.
,
Available online
Abstract:
Poyang Lake is the largest freshwater lake in China, and a typical natural lake in the middle and lower reaches of the Yangtze River. Different habitat season landscapes can meet the needs of fish in different life history stages, so that fish resources show dynamic distribution characteristics. The 10-year fishing ban have been implemented in the Yangtze River basin, including Poyang Lake since Jan 1, 2021, to conserve the aquatic organism of the Yangtze River. In this study, we applied hydroacoustic analysis with Simrad EY60split-beam echo sounder, to detect the spatial-temporal distribution of fish in Poyang Lake in 2020 to 2021. The results showed that more than half of the fish were 10—30 cm of body long in all three seasons, deduced from the fish target strength (TS) signal. However, the TS varied significantly among seasons (P<0.01), with the highest TS in winter (–51.0±14.13) dB and the lowest (52.71±9.95) dB in autumn. The horizontal distribution of fish density was not homogeneous, and also significantly different among seasons (P<0.01). The maximum density was 440.22, 169.19, and 554.18 ind./1000 m3 in autumn, spring, and winter, respectively. Vertically, the fish density decreased gradually from the bottom to the surface in autumn and winter, while the fish density in the surface and middle layers was higher than that in the bottom in spring. The fish density varied significantly in the same water layer among seasons (P<0.01). This study obtained the spatial and temporal distribution characteristics of fish in Poyang Lake by using hydroacoustic method at the beginning of fishing ban, and provided a reference for the study of fish resource in the region at a macro spatial scale under natural conditions. The results can also support for the evaluation of the fishing ban effect and the evaluation of biological integrity during the ten-year fishing ban in Poyang Lake.
Poyang Lake is the largest freshwater lake in China, and a typical natural lake in the middle and lower reaches of the Yangtze River. Different habitat season landscapes can meet the needs of fish in different life history stages, so that fish resources show dynamic distribution characteristics. The 10-year fishing ban have been implemented in the Yangtze River basin, including Poyang Lake since Jan 1, 2021, to conserve the aquatic organism of the Yangtze River. In this study, we applied hydroacoustic analysis with Simrad EY60split-beam echo sounder, to detect the spatial-temporal distribution of fish in Poyang Lake in 2020 to 2021. The results showed that more than half of the fish were 10—30 cm of body long in all three seasons, deduced from the fish target strength (TS) signal. However, the TS varied significantly among seasons (P<0.01), with the highest TS in winter (–51.0±14.13) dB and the lowest (52.71±9.95) dB in autumn. The horizontal distribution of fish density was not homogeneous, and also significantly different among seasons (P<0.01). The maximum density was 440.22, 169.19, and 554.18 ind./1000 m3 in autumn, spring, and winter, respectively. Vertically, the fish density decreased gradually from the bottom to the surface in autumn and winter, while the fish density in the surface and middle layers was higher than that in the bottom in spring. The fish density varied significantly in the same water layer among seasons (P<0.01). This study obtained the spatial and temporal distribution characteristics of fish in Poyang Lake by using hydroacoustic method at the beginning of fishing ban, and provided a reference for the study of fish resource in the region at a macro spatial scale under natural conditions. The results can also support for the evaluation of the fishing ban effect and the evaluation of biological integrity during the ten-year fishing ban in Poyang Lake.
,
Available online
, doi: 10.7541/2023.2022.0210
Abstract:
Photosynthesis is vital physiological process producing carbohydrate for the growth and distribution of submersed macrophytes, and thus may closely relate to the plant distribution depth. To clarify the differences of photosynthetic parameters and their relevance to the colonization depths of submersed macrophytes, in this study, we measured the light compensation and saturation points, photosynthetic rate and dark respiration of 15submerged macrophytes, using a liquid-phase oxygen electrode, and investigated the plants distribution depth in Erhai Lake, China. The results showed that the photosynthetic rate ranged from 2.8 to 18.1 μmol O2/(g DW·h), the dark respiration rate ranged from 0.3 to 2.0μmol O2/(g DW·h), the light compensation point ranged from 6.3 to18.1 μE/(m2·s), the light saturation point ranged from 55.6 to 441.5 μE/(m2·s). The plants had significant differences in the photosynthetic parameters. Based on a field survey of the plant distribution depth, the light compensation and saturation points of the submerged macrophytes were negatively correlated with their distribution depths. V. natans had the lowest light compensation and saturation points, and were more suitable to grow in deeper water where the experienced low light stress, and thus V. natans could be taken as a pioneer species for the restoration of submerged macrophytes in eutrophic lakes.
Photosynthesis is vital physiological process producing carbohydrate for the growth and distribution of submersed macrophytes, and thus may closely relate to the plant distribution depth. To clarify the differences of photosynthetic parameters and their relevance to the colonization depths of submersed macrophytes, in this study, we measured the light compensation and saturation points, photosynthetic rate and dark respiration of 15submerged macrophytes, using a liquid-phase oxygen electrode, and investigated the plants distribution depth in Erhai Lake, China. The results showed that the photosynthetic rate ranged from 2.8 to 18.1 μmol O2/(g DW·h), the dark respiration rate ranged from 0.3 to 2.0μmol O2/(g DW·h), the light compensation point ranged from 6.3 to18.1 μE/(m2·s), the light saturation point ranged from 55.6 to 441.5 μE/(m2·s). The plants had significant differences in the photosynthetic parameters. Based on a field survey of the plant distribution depth, the light compensation and saturation points of the submerged macrophytes were negatively correlated with their distribution depths. V. natans had the lowest light compensation and saturation points, and were more suitable to grow in deeper water where the experienced low light stress, and thus V. natans could be taken as a pioneer species for the restoration of submerged macrophytes in eutrophic lakes.
,
Available online
, doi: 10.7541/2023.2022.0339
Abstract:
In order to investigate the effects of nutritional status and metabolic range on group behavior of fish, juvenile crucian carp (Carassius auratus) was conducted as the animal model, and its feeding metabolism (specific dynamics, SDA) and metabolic rates (Standard Metabolic Rate, SMR; Maximum Metabolic Rate, MMR) was determined to calculate metabolic scope (AS=MMR–SMR) at (25.4±0.2)℃. Based on the combination of nutritional state and AS, five ‘nutritional state plus AS’ treatments were determined for their individual spatial position within a group, feeding intake, individual characteristics (e.g., individual swimming speed and acceleration), and group characteristics (e.g., synchronization of speed, inter-individual distance, nearest neighbour distance, and group polarization). Our results showed that nutritional status, starvation, aerobic scope, feeding and digestion had no effect on individual spatial position within a group. Starvation and digestion did not affect the group cohesiveness of juvenile crucian carp, but starvation reduced the group coordination of this species only during digestion, i.e., difference in individual food acquisition ability led to a different digestion strategy among group-mates, resulting in a lower synchronization of speed and eventually a decrease in group coordination. In the control group, the space in the front of the group confers the ecological advantage of individuals to obtain more food items, but starvation eliminated this ecological advantage in the front of the group. The feeding intake and feeding level of the control group were negatively correlated with the predicted remaining AS, and which of the starvation group were not correlated with the predicted remaining AS. Our results suggested that both the nutritional status and aerobic scope had no effect on the individual spatial position within schooling in gold fish. Occupying the spatial position at the front of the school can confer to the ecological benefits (e.g., more food resources), but starvation eliminates the heterogeneity of ecological benefits of individual spatial position distribution within the school. Starvation and digestion have no effect on group cohesion of the goldfish, but the phenomenon that starvation reduces the group coordination only appeared during the digestion stage. Individual difference in ability to obtain food within the group may lead to different digestive strategies among group-mates, resulting in more disordered swimming align of individuals, and finally leads to the decline of group coordination.
In order to investigate the effects of nutritional status and metabolic range on group behavior of fish, juvenile crucian carp (Carassius auratus) was conducted as the animal model, and its feeding metabolism (specific dynamics, SDA) and metabolic rates (Standard Metabolic Rate, SMR; Maximum Metabolic Rate, MMR) was determined to calculate metabolic scope (AS=MMR–SMR) at (25.4±0.2)℃. Based on the combination of nutritional state and AS, five ‘nutritional state plus AS’ treatments were determined for their individual spatial position within a group, feeding intake, individual characteristics (e.g., individual swimming speed and acceleration), and group characteristics (e.g., synchronization of speed, inter-individual distance, nearest neighbour distance, and group polarization). Our results showed that nutritional status, starvation, aerobic scope, feeding and digestion had no effect on individual spatial position within a group. Starvation and digestion did not affect the group cohesiveness of juvenile crucian carp, but starvation reduced the group coordination of this species only during digestion, i.e., difference in individual food acquisition ability led to a different digestion strategy among group-mates, resulting in a lower synchronization of speed and eventually a decrease in group coordination. In the control group, the space in the front of the group confers the ecological advantage of individuals to obtain more food items, but starvation eliminated this ecological advantage in the front of the group. The feeding intake and feeding level of the control group were negatively correlated with the predicted remaining AS, and which of the starvation group were not correlated with the predicted remaining AS. Our results suggested that both the nutritional status and aerobic scope had no effect on the individual spatial position within schooling in gold fish. Occupying the spatial position at the front of the school can confer to the ecological benefits (e.g., more food resources), but starvation eliminates the heterogeneity of ecological benefits of individual spatial position distribution within the school. Starvation and digestion have no effect on group cohesion of the goldfish, but the phenomenon that starvation reduces the group coordination only appeared during the digestion stage. Individual difference in ability to obtain food within the group may lead to different digestive strategies among group-mates, resulting in more disordered swimming align of individuals, and finally leads to the decline of group coordination.
,
Available online
, doi: 10.7541/2022.2021.0343
Abstract:
In order to study the characteristics of amh gene in largemouth bass Micropterus salmonids and its potential role during gonadal development, the cDNA full-length sequence of the amh gene was cloned by RACE technology, and the Amh polyclonal antibody was prepared. Quantitative real-time PCR (qRT-PCR) and Western blot technology was used to analyze the expression pattern of amh in different tissues and different developmental stages. Finally, HE staining and Immunohistochemistry were used to observe the morphological and histological changes of gonads at different developmental stages and their potential relationship with Amh expression. The results showed that the cDNA full-length sequence of the amh gene in largemouth bass was 2050 bp in length, including 24 bp at the 5′-UTR, 394 bp at the 3′-UTR, and a 1632 bp open reading frame (ORF) encoding 543 amino acids. The amh mRNA was found expressed in eleven tissues. The expression level in testis was the highest for male fish, then followed by muscle, and the expression level in ovary was the highest for female fish, followed by muscle. There were significant differences in the expression of amh gene in gonads of male and female fish at different developmental stages, and the expression in testis was significantly higher than that in ovary (P<0.05). Western blot showed that Amh protein was highly expressed in testis. The expression in testis increased first and then decreased, and reached the highest after hatching 65 days (P<0.05). Immunohistochemical results showed that Amh was expressed in Sertoli cells of early testis; the expression in male testis decreased significantly at 135 and 215 days after hatching. HE staining showed that the testis of male fish was in the stage of spermatogenesis and sperm deformation, Amh was mainly expressed in Sertoli cells. Sperm occupied most of the space of testis, and the proportion of Sertoli cells decreased. The expression was low in female ovaries at 45, 65 and 135 days after hatching, and increased at 215 days after hatching, and Amh positive signals were detected in the edge of oocyte membrane and peripheral follicular cells and granulosa cells. The results showed that Amh gene may be involved in the early testicular development in testis; in the ovary, it may participate in the development of granulosa cells and follicular cells. In conclusion, Amh played a key regulatory role in gonadal development of Micropterus salmoides.
In order to study the characteristics of amh gene in largemouth bass Micropterus salmonids and its potential role during gonadal development, the cDNA full-length sequence of the amh gene was cloned by RACE technology, and the Amh polyclonal antibody was prepared. Quantitative real-time PCR (qRT-PCR) and Western blot technology was used to analyze the expression pattern of amh in different tissues and different developmental stages. Finally, HE staining and Immunohistochemistry were used to observe the morphological and histological changes of gonads at different developmental stages and their potential relationship with Amh expression. The results showed that the cDNA full-length sequence of the amh gene in largemouth bass was 2050 bp in length, including 24 bp at the 5′-UTR, 394 bp at the 3′-UTR, and a 1632 bp open reading frame (ORF) encoding 543 amino acids. The amh mRNA was found expressed in eleven tissues. The expression level in testis was the highest for male fish, then followed by muscle, and the expression level in ovary was the highest for female fish, followed by muscle. There were significant differences in the expression of amh gene in gonads of male and female fish at different developmental stages, and the expression in testis was significantly higher than that in ovary (P<0.05). Western blot showed that Amh protein was highly expressed in testis. The expression in testis increased first and then decreased, and reached the highest after hatching 65 days (P<0.05). Immunohistochemical results showed that Amh was expressed in Sertoli cells of early testis; the expression in male testis decreased significantly at 135 and 215 days after hatching. HE staining showed that the testis of male fish was in the stage of spermatogenesis and sperm deformation, Amh was mainly expressed in Sertoli cells. Sperm occupied most of the space of testis, and the proportion of Sertoli cells decreased. The expression was low in female ovaries at 45, 65 and 135 days after hatching, and increased at 215 days after hatching, and Amh positive signals were detected in the edge of oocyte membrane and peripheral follicular cells and granulosa cells. The results showed that Amh gene may be involved in the early testicular development in testis; in the ovary, it may participate in the development of granulosa cells and follicular cells. In conclusion, Amh played a key regulatory role in gonadal development of Micropterus salmoides.
,
Available online
, doi: 10.7541/2022.2021.0308
Abstract:
Artemia is not only one of the most important live feed for larvi culture, but also an ideal experimental organism for scientific research. Female Artemia produce either nauplii via ovoviviparous pathway or diapause cyst via oviparous pathway. In order to reveal the mechanism of different reproductive modes of Artemia, the reproductive differential transcriptomes of parthenogenetic Artemia were constructed, and bioinformatics analysis were performed to screen reproductive differential expression genes, and the gene expression patterns were studied by using qRT-PCR. Transcriptome analysis showed that there were 1452 differentially expressed genes, of which 601 genes were up-regulated and 851 down-regulated in the abscising carpopodium. According to GO function classification, 1243306 and 530 unigene were annotated into biological process, cell composition and molecular function respectively. KEGG enrichment analysis showed that differential genes were significantly enriched in antigen processing and ribosome pathways. Combined with transcriptome data and qRT-PCR analysis, six reproductive-related genes were screened and verified. The results showed that all the six reproductive-related genes had higher expression in oviparous Artemia than in ovoviviparous Artemia. In addition, the conserved domains of the proteins encoded by six candidate reproductive related genes were predicted and phylogenetic trees were constructed respectively. The results showed that the protein domains were consistent with the previously reported reproductive genes. Over all, our study indicated that the selected six genes may influence the reproductive process of Artemia. This study provides valuable information for dissecting the molecular mechanism of reproductive pattern in the parthenogenetic Artemia, and may also help to refine the reproductive biological theory of Artemia.
Artemia is not only one of the most important live feed for larvi culture, but also an ideal experimental organism for scientific research. Female Artemia produce either nauplii via ovoviviparous pathway or diapause cyst via oviparous pathway. In order to reveal the mechanism of different reproductive modes of Artemia, the reproductive differential transcriptomes of parthenogenetic Artemia were constructed, and bioinformatics analysis were performed to screen reproductive differential expression genes, and the gene expression patterns were studied by using qRT-PCR. Transcriptome analysis showed that there were 1452 differentially expressed genes, of which 601 genes were up-regulated and 851 down-regulated in the abscising carpopodium. According to GO function classification, 1243306 and 530 unigene were annotated into biological process, cell composition and molecular function respectively. KEGG enrichment analysis showed that differential genes were significantly enriched in antigen processing and ribosome pathways. Combined with transcriptome data and qRT-PCR analysis, six reproductive-related genes were screened and verified. The results showed that all the six reproductive-related genes had higher expression in oviparous Artemia than in ovoviviparous Artemia. In addition, the conserved domains of the proteins encoded by six candidate reproductive related genes were predicted and phylogenetic trees were constructed respectively. The results showed that the protein domains were consistent with the previously reported reproductive genes. Over all, our study indicated that the selected six genes may influence the reproductive process of Artemia. This study provides valuable information for dissecting the molecular mechanism of reproductive pattern in the parthenogenetic Artemia, and may also help to refine the reproductive biological theory of Artemia.
,
Available online
, doi: 10.7541/2023.2022.0244
Abstract:
Cyanobacterial blooms worldwide have persistently posed a threat to aquatic ecosystem functions, and even more severe to human health. Due to environment-friendly and high selectivity features, allelochemicals have put forward a promising option of inhibiting cyanobacterial overgrowth and therefore mitigating blooms in a short term. This study overviewed the algicidal effects of the four allelochemicals, i.e. polyphenolics, nitrogen-containing compounds, fatty acids/esters and terpenoids, uncovering the underlying mechanisms and specific target sites against cyanobacteria, and further evaluating the application potential based on economic costs of highly effective algae-inhibiting allelochemicals. The results demonstrated distinctive algicidal property under certain allelochemical: Fatty acids/esters were the most cost-effective one for algae-inhibition, which could be extremely toxic to cyanobacteria with low doses through various algicidal targets for a key measure, suppressing target cyanobacteria by 50% in the range of 0.015—52.95 mg/L. The most abundant polyphenolics generally owned high algicidal activity, with median effect concentration concentration (EC50) ranging from 0.05 to 162.53 mg/L, which could restrain cyanobacterial growth by interfering with photosynthesis, stimulating intracellular oxidative stress and destructing cell wall or membrane structure. However, the theoretical costs of highly effective algae-inhibiting polyphenolics utilization were modestly higher and more variable, taking second place to fatty acids in terms of cost-effectiveness. N-containing compounds with uniformly efficient and specific algal-inhibiting effects, mainly interfered with cyanobacterial photosynthesis, particularly through electron transport disrupting, and disrupted cellular structures (including ultrastructure) to induce irreversible cell damage. These compounds had EC50 varies from 0.3 to 8.14 mg/L, but the high costs and lowest cost-effectiveness hinder their wide application. The inhibitory effect of terpenoids was weaker than other three allelochemical types, focusing on interference with the photosynthetic function of cyanobacterial cells by multi-approach, with EC50 up to 25.3—228 mg/L, being limited by the low inhibitory effects. Therefore, the joint effects of similar and dissimilar allelochemicals on Microcystis aeruginosa growth were summarized to reduce the amount of allelochemicals, cutting down economic costs and achieving more efficient algicidal effects. Allelochemicals quantity, target sites, mixture ratio and dosage were found to determine the joint inhibitory effects on cyanobacteria. We proposed that allelochemicals with diverse and complementary algicidal target sites exerted synergistic effects, called “Multi-target Combinations”, and put forward “New Barrel Effect”—suggesting improving the mixture proportion of allelochemicals with strong algal-inhibiting activity. In addition, allelochemicals compound based on inherent content and proportion derived from plants were more likely to arouse synergistic effects. This study provides optimal choice for scientific, comprehensive and reasonable allelochemicals option and blending proportion, in order to accelerate the application of cyanobacterial blooms control.
,
Available online
, doi: 10.7541/2023.2022.0257
Abstract:
In order to reveal the changes of plankton community structure during shellfish culture in seawater ponds before and after typhoon, 16S and 18S rRNA genes in the genomic DNA of aquaculture water environment were analyzed by high-throughput sequencing and bioinformatics. The results showed that the number of OTU in prokaryotes (28728) was significantly higher than that in eukaryotes (8498), and the dominant groups of prokaryotes were Proteobacteria, Cyanobacteria, Bacteroidetes, Actinobacteria and Chlorobi; The dominant groups of eukaryotes are ciliates, flagellates, protozoa, cup whipworms, cryptoalgae, Phaeoflagellates, diatoms, etc., among which the diatom abundance increased significantly after typhoon (P<0.05). After the typhoon, the biodiversity of eukaryotes did not change significantly, meanwhile the Shannon index and Simpson index of prokaryotes showed significant differences (P<0.05), which decreased in 5 days and then increased with time, while the OTU number and Chao I index did not change significantly. The PCoA showed that the community structure of prokaryotic and eukaryotic organisms changed markedly after typhoon. ANOSIM showed that prokaryotic microbial communities were significantly different at each time point (P<0.05), while eukaryotic microbial communities significantly in 10 days (P<0.05). Water temperature had a significant impact on prokaryotic community structure (P<0.05), while eukaryotic community was influenced by chemical oxygen demand and phosphat (P<0.05). The study suggested that after the typhoon disturbance, plankton communities markedly changed, prokaryotes was more sensitive than the eukaryotes. The diversity level of bacterial community decreased significantly at first, then returned to the level before typhoon, showing stronger sensitivity than that of eukaryote, and both of them failed to return to the community composition before typhoon. Therefore, the key measures to deal with the impact of typhoon in shellfish culture in seawater ponds should be mainly to prevent cultured organisms from causing stress to the drastic environmental changes, and to supply probiotics for environmental regulation appropriately, so as to make up for the loss of ecological functions possibly caused by the change of bacteria phase caused by typhoon.
In order to reveal the changes of plankton community structure during shellfish culture in seawater ponds before and after typhoon, 16S and 18S rRNA genes in the genomic DNA of aquaculture water environment were analyzed by high-throughput sequencing and bioinformatics. The results showed that the number of OTU in prokaryotes (28728) was significantly higher than that in eukaryotes (8498), and the dominant groups of prokaryotes were Proteobacteria, Cyanobacteria, Bacteroidetes, Actinobacteria and Chlorobi; The dominant groups of eukaryotes are ciliates, flagellates, protozoa, cup whipworms, cryptoalgae, Phaeoflagellates, diatoms, etc., among which the diatom abundance increased significantly after typhoon (P<0.05). After the typhoon, the biodiversity of eukaryotes did not change significantly, meanwhile the Shannon index and Simpson index of prokaryotes showed significant differences (P<0.05), which decreased in 5 days and then increased with time, while the OTU number and Chao I index did not change significantly. The PCoA showed that the community structure of prokaryotic and eukaryotic organisms changed markedly after typhoon. ANOSIM showed that prokaryotic microbial communities were significantly different at each time point (P<0.05), while eukaryotic microbial communities significantly in 10 days (P<0.05). Water temperature had a significant impact on prokaryotic community structure (P<0.05), while eukaryotic community was influenced by chemical oxygen demand and phosphat (P<0.05). The study suggested that after the typhoon disturbance, plankton communities markedly changed, prokaryotes was more sensitive than the eukaryotes. The diversity level of bacterial community decreased significantly at first, then returned to the level before typhoon, showing stronger sensitivity than that of eukaryote, and both of them failed to return to the community composition before typhoon. Therefore, the key measures to deal with the impact of typhoon in shellfish culture in seawater ponds should be mainly to prevent cultured organisms from causing stress to the drastic environmental changes, and to supply probiotics for environmental regulation appropriately, so as to make up for the loss of ecological functions possibly caused by the change of bacteria phase caused by typhoon.
,
Available online
, doi: 10.7541/2023.2022.0264
Abstract:
The characteristics of algal source foulants could affect the membrane fouling during the treatment of algae-rich water by microfiltration. Filtration experiments were carried out with algal cells, algogenic organic matter (AOM) and algae suspension at different growth phases to study the influence of algal source foulants characteristics on membrane fouling and its mechanisms. The UMFI method was used to analyze the fouling degree of algae cells, AOM and algae suspension at different growth stages. In particular, the changes in their fouling contribution ratios at different growth phase were further elucidated based on the criteria importance through intercriteria correlation. Meanwhile, the mixed fouling blocking model was used to analyze the main fouling blocking types at different filtration stages of algae suspension at different growth stages. The results showed that the membrane fouling caused by algae cells and AOM in the exponential phase was the lowest compared with the other two growth phases. Notably, the contribution of AOM and algae cells to membrane fouling varied with the growth phase during the treatment of algae-rich water by microfiltration. The objective weight of fouling caused by AOM decreased with the prolongation of growth phase, and the declining phase reduced to 10.2%. Meanwhile, the objective weight of algae cells increased with the prolongation of growth phase, and the exponential phase was only 28.3%. In the filtration process of algae suspension at different growth phase, there were all two stages of fouling mechanisms, and the latter stage was cake formation. These results not only elucidated how the changes in the characteristics of the algae suspension affected characteristics on the membrane fouling and disclosed its mechanism during the microfiltration treatment of algae-rich laden water by microfiltration, but also provided theoretical research guidance for the development of membrane anti-fouling improvement technologies.
The characteristics of algal source foulants could affect the membrane fouling during the treatment of algae-rich water by microfiltration. Filtration experiments were carried out with algal cells, algogenic organic matter (AOM) and algae suspension at different growth phases to study the influence of algal source foulants characteristics on membrane fouling and its mechanisms. The UMFI method was used to analyze the fouling degree of algae cells, AOM and algae suspension at different growth stages. In particular, the changes in their fouling contribution ratios at different growth phase were further elucidated based on the criteria importance through intercriteria correlation. Meanwhile, the mixed fouling blocking model was used to analyze the main fouling blocking types at different filtration stages of algae suspension at different growth stages. The results showed that the membrane fouling caused by algae cells and AOM in the exponential phase was the lowest compared with the other two growth phases. Notably, the contribution of AOM and algae cells to membrane fouling varied with the growth phase during the treatment of algae-rich water by microfiltration. The objective weight of fouling caused by AOM decreased with the prolongation of growth phase, and the declining phase reduced to 10.2%. Meanwhile, the objective weight of algae cells increased with the prolongation of growth phase, and the exponential phase was only 28.3%. In the filtration process of algae suspension at different growth phase, there were all two stages of fouling mechanisms, and the latter stage was cake formation. These results not only elucidated how the changes in the characteristics of the algae suspension affected characteristics on the membrane fouling and disclosed its mechanism during the microfiltration treatment of algae-rich laden water by microfiltration, but also provided theoretical research guidance for the development of membrane anti-fouling improvement technologies.
,
Available online
, doi: 10.7541/2023.2022.0220
Abstract:
A suitable micro-ecological condition is of great significance to the Macrobrachium rosenbergii larval development and health. However, the fine-scale temporal dynamics and assembly mechanisms of bacterioplankton of prawn larval nursery are unexplored. We investigated dynamic succession, environmental drivers, biomarkers and co-occurrence networks of bacterial communities across whole developmental cycle in 3 commercial prawn nurseries, using a high-frequency sampling strategy and bacterial 16S rRNA amplicon sequencing. The bacterial α-diversity showed a U-shaped pattern across the developmental cycle. The bacterial community’s similarity followed a time-decay pattern, with community turnover rate of 0.011. Bacteroidetes, Actinobacteria, Alphaproteobacteria, and Gammaproteobacteria were the dominant phyla, and their relative abundance varied dramatically with prawn larval development. For example, the relative abundance of actinobacterial Microbacteriaceae and Cryomorphaceae (Bacteroidetes) significantly increased with prawn larval development (P < 0.05), while that of two members of phyla Bacteroidetes, Flavobacteriaceae and Crocinitomicaceae decreased. pH is the most important environmental driver for the variations of bacterial diversity and composition. By using random forest analysis, we identified 12 biomarker taxa associated with prawn larval development. Specifically, Burkholderiaceae and Cyclobacteriaceae as the indicative taxa were detected in early (1—2d) and median stage (8—10d), respectively. While Saprospiraceae and Mycobacteriaceae accumulated in mid-late stages (16—21d). Bacterial co-occurrence patterns (mostly positive correlations) weakened and negative interactions accumulated with larval development. These findings reveal notable succession patterns and community assembly dynamics of bacterioplankton across whole prawn larval development, and will provide novel insights into microbiome management practices and prevent disease in prawn nursery.
A suitable micro-ecological condition is of great significance to the Macrobrachium rosenbergii larval development and health. However, the fine-scale temporal dynamics and assembly mechanisms of bacterioplankton of prawn larval nursery are unexplored. We investigated dynamic succession, environmental drivers, biomarkers and co-occurrence networks of bacterial communities across whole developmental cycle in 3 commercial prawn nurseries, using a high-frequency sampling strategy and bacterial 16S rRNA amplicon sequencing. The bacterial α-diversity showed a U-shaped pattern across the developmental cycle. The bacterial community’s similarity followed a time-decay pattern, with community turnover rate of 0.011. Bacteroidetes, Actinobacteria, Alphaproteobacteria, and Gammaproteobacteria were the dominant phyla, and their relative abundance varied dramatically with prawn larval development. For example, the relative abundance of actinobacterial Microbacteriaceae and Cryomorphaceae (Bacteroidetes) significantly increased with prawn larval development (P < 0.05), while that of two members of phyla Bacteroidetes, Flavobacteriaceae and Crocinitomicaceae decreased. pH is the most important environmental driver for the variations of bacterial diversity and composition. By using random forest analysis, we identified 12 biomarker taxa associated with prawn larval development. Specifically, Burkholderiaceae and Cyclobacteriaceae as the indicative taxa were detected in early (1—2d) and median stage (8—10d), respectively. While Saprospiraceae and Mycobacteriaceae accumulated in mid-late stages (16—21d). Bacterial co-occurrence patterns (mostly positive correlations) weakened and negative interactions accumulated with larval development. These findings reveal notable succession patterns and community assembly dynamics of bacterioplankton across whole prawn larval development, and will provide novel insights into microbiome management practices and prevent disease in prawn nursery.
,
Available online
, doi: 10.7541/2022.2021.0382
Abstract:
Sinilabeo decorus tungting (Nichols) is a wild endemic fish in Hunan Province. However, due to overfishing and environmental damage, the germplasm resources of wild S. decorus tungting are scarce. In order to effectively protect germplasm resources of S. decorus tungting, artificial breeding research has been carried out. In the process of domestication and parental cultivation, it was found that there were two somatotypes in the wild population: the high-back type and the flatback type. The countable traits analysis showed that there was no significant difference between the two different somatotypes S. decorus tungting on fin formula and scales. To explore the genetic differences between the two somatotypes of S. decorus tungting, Cytb and ITS1 gene sequences were used as molecular markers to analyze the genetic differences. The results showed that based on the Cytb and ITS1 gene sequences, both the high-back type and the flatback type were showed a bias in base composition. And two somatotypes of S. decorus tungting were showed high haplotype diversity and low nucleotide diversity. In addition, the results of genetic distance analysis and NJ tree construction showed that the degree of genetic differentiation of the two somatotypes was low, which did not reach the level of population differentiation. In conclusion, the high-back type and flatback type belongs to the same population. The results of this study enriched the molecular biological data of S. decorus tungting, and provided theoretical basis for the protection and industrial development of S. decorus tungting germplasm resources. The reasons for the formation of the high back type of S. decorus Tungting was unknown and needs further study.
Sinilabeo decorus tungting (Nichols) is a wild endemic fish in Hunan Province. However, due to overfishing and environmental damage, the germplasm resources of wild S. decorus tungting are scarce. In order to effectively protect germplasm resources of S. decorus tungting, artificial breeding research has been carried out. In the process of domestication and parental cultivation, it was found that there were two somatotypes in the wild population: the high-back type and the flatback type. The countable traits analysis showed that there was no significant difference between the two different somatotypes S. decorus tungting on fin formula and scales. To explore the genetic differences between the two somatotypes of S. decorus tungting, Cytb and ITS1 gene sequences were used as molecular markers to analyze the genetic differences. The results showed that based on the Cytb and ITS1 gene sequences, both the high-back type and the flatback type were showed a bias in base composition. And two somatotypes of S. decorus tungting were showed high haplotype diversity and low nucleotide diversity. In addition, the results of genetic distance analysis and NJ tree construction showed that the degree of genetic differentiation of the two somatotypes was low, which did not reach the level of population differentiation. In conclusion, the high-back type and flatback type belongs to the same population. The results of this study enriched the molecular biological data of S. decorus tungting, and provided theoretical basis for the protection and industrial development of S. decorus tungting germplasm resources. The reasons for the formation of the high back type of S. decorus Tungting was unknown and needs further study.
,
Available online
, doi: 10.7541/2022.2021.0339
Abstract:
To investigate the effect of LED light on the photosynthetic activity of cyanobacteria, the photosynthetic activity of Microcystis aeruginosa PCC 7806 was examined after 2h of LED treatment with different light quality and intensity using 25 μmol photons/(m2·s) of white fluorescent light as control. When compared to the control, results indicated that the cell photosynthetic activity (Fv/Fm) soared significantly under 25—50 μmol photons/(m2·s) LED red and blue light, and 25—100 μmol photons/(m2·s) LED white and green light treatments. LED red and blue light significantly inhibited cell photosynthetic activity at 100 μmol photons/(m2·s), whereas this intensity was more than 200 μmol photons/(m2·s) for the LED white light and 500 μmol photons/(m2·s) for the LED green light, and the maximum photochemical efficiency of photosystem II (PSII) Fv/Fm, the electron transfer rate ETR(II) and light quantum yield Y(II); the photosystem I (PSI) electron transfer rate ETR(I), and the light quantum yield Y(I) decreased with increasing light intensity; with increasing light intensity, the degree of electron transfer blockage between QA and QB, the proportion of PSII inactive reaction centers (PSIIx) and the energy flux absorbed by a single active reaction center (ABS/RC), the total energy dissipated by a single active reaction center (DI0/RC), the energy absorbed by the cell per unit area of algae (ABS/CS0), and the energy dissipated by heat per unit area of algae (DI0/CS0) were increased. Although the flux of electrons transferred by a single active reaction center (ET0/RC), the flux of energy captured per unit area of algal active reaction center (TR0/CS0), and the flux of energy transferred per unit area of algal electrons (ET0/CS0) were all decreased under the action of increasing light intensity (P<0.05), the flux of excitation energy captured by a single active reaction center (TR0/RC) was not changed significantly (P>0.05). Under the action of different light qualities of the identical light intensity, the decline degree of Fv/Fm, ETR(II), Y(II), ETR(I), Y(I), the degree of electron transfer blockage between QA– and QB, the increased degree of PSIIx, ABS/RC, DI0/RC, ABS/CS0, DI0/CS0, and the decline degree of ET0/RC, TR0/CS0, ET0/CS0 manifested most when subjected to red light therapy and least when subjected to green light treatment. These study results demonstrated that at low light intensities, the four LED light qualities significantly increased the photosynthetic activity of Microcystis aeruginosa and ensured the balance of energy distribution; high light intensities decreased the photosynthetic activity of Microcystis aeruginosa by affecting the PSII reaction center and inhibiting electron transfer on the receptor side of the PSII electron transfer chain, while the large amount of light energy absorbed by the cells protects and alleviates the stress of intense light stress by increasing heat dissipation and reducing the quantum yield of electron transfer. The mechanism of photosynthetic activity of Microcystis aeruginosa in response to LED light was revealed in this study, and it was confirmed that high light intensity LED light can suppress photosynthetic activity of algal cells, which is a feasible technical way to prevent and control the explosive proliferation of Microcystis aeruginosa.
To investigate the effect of LED light on the photosynthetic activity of cyanobacteria, the photosynthetic activity of Microcystis aeruginosa PCC 7806 was examined after 2h of LED treatment with different light quality and intensity using 25 μmol photons/(m2·s) of white fluorescent light as control. When compared to the control, results indicated that the cell photosynthetic activity (Fv/Fm) soared significantly under 25—50 μmol photons/(m2·s) LED red and blue light, and 25—100 μmol photons/(m2·s) LED white and green light treatments. LED red and blue light significantly inhibited cell photosynthetic activity at 100 μmol photons/(m2·s), whereas this intensity was more than 200 μmol photons/(m2·s) for the LED white light and 500 μmol photons/(m2·s) for the LED green light, and the maximum photochemical efficiency of photosystem II (PSII) Fv/Fm, the electron transfer rate ETR(II) and light quantum yield Y(II); the photosystem I (PSI) electron transfer rate ETR(I), and the light quantum yield Y(I) decreased with increasing light intensity; with increasing light intensity, the degree of electron transfer blockage between QA and QB, the proportion of PSII inactive reaction centers (PSIIx) and the energy flux absorbed by a single active reaction center (ABS/RC), the total energy dissipated by a single active reaction center (DI0/RC), the energy absorbed by the cell per unit area of algae (ABS/CS0), and the energy dissipated by heat per unit area of algae (DI0/CS0) were increased. Although the flux of electrons transferred by a single active reaction center (ET0/RC), the flux of energy captured per unit area of algal active reaction center (TR0/CS0), and the flux of energy transferred per unit area of algal electrons (ET0/CS0) were all decreased under the action of increasing light intensity (P<0.05), the flux of excitation energy captured by a single active reaction center (TR0/RC) was not changed significantly (P>0.05). Under the action of different light qualities of the identical light intensity, the decline degree of Fv/Fm, ETR(II), Y(II), ETR(I), Y(I), the degree of electron transfer blockage between QA– and QB, the increased degree of PSIIx, ABS/RC, DI0/RC, ABS/CS0, DI0/CS0, and the decline degree of ET0/RC, TR0/CS0, ET0/CS0 manifested most when subjected to red light therapy and least when subjected to green light treatment. These study results demonstrated that at low light intensities, the four LED light qualities significantly increased the photosynthetic activity of Microcystis aeruginosa and ensured the balance of energy distribution; high light intensities decreased the photosynthetic activity of Microcystis aeruginosa by affecting the PSII reaction center and inhibiting electron transfer on the receptor side of the PSII electron transfer chain, while the large amount of light energy absorbed by the cells protects and alleviates the stress of intense light stress by increasing heat dissipation and reducing the quantum yield of electron transfer. The mechanism of photosynthetic activity of Microcystis aeruginosa in response to LED light was revealed in this study, and it was confirmed that high light intensity LED light can suppress photosynthetic activity of algal cells, which is a feasible technical way to prevent and control the explosive proliferation of Microcystis aeruginosa.
,
Available online
, doi: 10.7541/2023.2022.0117
Abstract:
Hydrological connection plays an important role in maintaining biodiversity and ecosystem function. In order to explain the effect of internal hydrological disconnection and response of fish communities, we selected a typical hydrological disconnection lake in middle reaches of Yangtze River—Bao’an Lake as the study object. Field sampling was conducted in Xiaosihai Lake (part of Bao’an Lake, complete disconnection), Biandantang Lake (part of Bao’an Lake, semi- disconnection), Qiaodun Lake (part of Bao’an Lake, semi- disconnection) and the main lake in both summer and autumn from 2019 to 2020. We compared and analyzed the differences of fish communities and functional diversity among those lakes using the multiple statistical methods. Result showed that the fish community structure in the complete disconnection lake had been changed significantly, which species number (15±3) was significantly lower than that in the semi- disconnection lake (22±3) and the main lake (23±3, P<0.05); abundance increased while the biomass decreased; the species richness index, the Shannon index and the Simpson index were significantly lower; and functional richness index, functional dispersion index and functional evenness index were also significantly lower the other lakes (P<0.05). However, the fish community structure in the semi-disconnection lake had no significant difference with that in the main lake. The Permutational multivariate analysis of variance and non-metric multidimensional scaling analysis also showed that the fish community in the complete disconnection lake significantly distinguished from the semi-disconnection lakes and the main lake (P<0.05)., while there was no significant difference between the fish communities of semi-disconnection lakes and main lake was closer. Our study found that the internal hydrological disconnection in lake also has an important impact on the composition of fish communities, and restoring the free hydrological connectivity within lake was crucial to ecological management and biodiversity conservation.
Hydrological connection plays an important role in maintaining biodiversity and ecosystem function. In order to explain the effect of internal hydrological disconnection and response of fish communities, we selected a typical hydrological disconnection lake in middle reaches of Yangtze River—Bao’an Lake as the study object. Field sampling was conducted in Xiaosihai Lake (part of Bao’an Lake, complete disconnection), Biandantang Lake (part of Bao’an Lake, semi- disconnection), Qiaodun Lake (part of Bao’an Lake, semi- disconnection) and the main lake in both summer and autumn from 2019 to 2020. We compared and analyzed the differences of fish communities and functional diversity among those lakes using the multiple statistical methods. Result showed that the fish community structure in the complete disconnection lake had been changed significantly, which species number (15±3) was significantly lower than that in the semi- disconnection lake (22±3) and the main lake (23±3, P<0.05); abundance increased while the biomass decreased; the species richness index, the Shannon index and the Simpson index were significantly lower; and functional richness index, functional dispersion index and functional evenness index were also significantly lower the other lakes (P<0.05). However, the fish community structure in the semi-disconnection lake had no significant difference with that in the main lake. The Permutational multivariate analysis of variance and non-metric multidimensional scaling analysis also showed that the fish community in the complete disconnection lake significantly distinguished from the semi-disconnection lakes and the main lake (P<0.05)., while there was no significant difference between the fish communities of semi-disconnection lakes and main lake was closer. Our study found that the internal hydrological disconnection in lake also has an important impact on the composition of fish communities, and restoring the free hydrological connectivity within lake was crucial to ecological management and biodiversity conservation.
,
Available online
, doi: 10.7541/2023.2022.0296
Abstract:
Largemouth bass (Micropterus salmoides) has been introduced approximately for forty years, and it becomes an economically important cultured fish in China. However, given that it is an exotic species, there is a lack of natural population supply in breeding, and there is a risk of genetic degradation in the utilization progress. The imbalance between large industrial demand and shortage of improved varieties of M. salmoides are arisen in China. Genetic evolution is the baseline for genetic improvement and selection breeding programs. The microsatellites with multiplex PCR method that is popularity applied for genetic analyses in fish species. In this study, we developed six multiplex PCR panels based on 18 polymorphic microsatellites, and subsequently used in genetic analyses for three populations of M. salmoides, i.e., original population of American (USA), “Youlu No. 1” variety (YLO), and their hybrid population (HYB). The results showed that, the parameters of number of alleles (Na), effective number of alleles (Ne), observed heterozygosity (Ho), expected heterozygosity (He) and polymorphism information content (PIC) for 18 loci were ranged from 3 to 14, 1.622 to 5.841, 0.333 to 0.806, and 0.361 to 0.810, and mean with 7.722, 3.056, 0.577, and 0.579, respectively. Excluding two loci deviated from Hardy-Weinberg equilibrium, the lowest values of all diversity parameters were observed in YLO, while the highest Ho was detected in HYB (0.743), and the highest values of other diversity parameters were detected in USA. The farthest Nei’s genetic distance was evaluated between USA and YLO (0.362); meanwhile, similar Nei’s genetic distances were evaluated between HYB with other two populations (i.e., 0.112 and 0.179 for USA and YLO, respectively). Extremely significant genetic differentiations were revealed among all pairwise populations (P<0.01), and the highest fixation index was detected between USA and YLO (FST=0.209). According to the genetic structure analysis based on the allele frequency, relatively independent genetic structures were presented within USA and YLO, while admixture in genetic structure was generally showed in HYB. Additionally, the distinct distributions of individuals from three populations were visualized by using scatter plots of discriminant analysis of principal component (DAPC), and HYB showed with interval distribution between USA and YLO. In brief, six multiplex PCR panels of 18 microsatellites were developed firstly in M. salmoides, relatively high polymorphisms were detected among these loci, and the effective application in genetic analyses was evaluated in this study. That provided valuable tools for genetic and breeding researches in M. salmoides.
Largemouth bass (Micropterus salmoides) has been introduced approximately for forty years, and it becomes an economically important cultured fish in China. However, given that it is an exotic species, there is a lack of natural population supply in breeding, and there is a risk of genetic degradation in the utilization progress. The imbalance between large industrial demand and shortage of improved varieties of M. salmoides are arisen in China. Genetic evolution is the baseline for genetic improvement and selection breeding programs. The microsatellites with multiplex PCR method that is popularity applied for genetic analyses in fish species. In this study, we developed six multiplex PCR panels based on 18 polymorphic microsatellites, and subsequently used in genetic analyses for three populations of M. salmoides, i.e., original population of American (USA), “Youlu No. 1” variety (YLO), and their hybrid population (HYB). The results showed that, the parameters of number of alleles (Na), effective number of alleles (Ne), observed heterozygosity (Ho), expected heterozygosity (He) and polymorphism information content (PIC) for 18 loci were ranged from 3 to 14, 1.622 to 5.841, 0.333 to 0.806, and 0.361 to 0.810, and mean with 7.722, 3.056, 0.577, and 0.579, respectively. Excluding two loci deviated from Hardy-Weinberg equilibrium, the lowest values of all diversity parameters were observed in YLO, while the highest Ho was detected in HYB (0.743), and the highest values of other diversity parameters were detected in USA. The farthest Nei’s genetic distance was evaluated between USA and YLO (0.362); meanwhile, similar Nei’s genetic distances were evaluated between HYB with other two populations (i.e., 0.112 and 0.179 for USA and YLO, respectively). Extremely significant genetic differentiations were revealed among all pairwise populations (P<0.01), and the highest fixation index was detected between USA and YLO (FST=0.209). According to the genetic structure analysis based on the allele frequency, relatively independent genetic structures were presented within USA and YLO, while admixture in genetic structure was generally showed in HYB. Additionally, the distinct distributions of individuals from three populations were visualized by using scatter plots of discriminant analysis of principal component (DAPC), and HYB showed with interval distribution between USA and YLO. In brief, six multiplex PCR panels of 18 microsatellites were developed firstly in M. salmoides, relatively high polymorphisms were detected among these loci, and the effective application in genetic analyses was evaluated in this study. That provided valuable tools for genetic and breeding researches in M. salmoides.
,
Available online
, doi: 10.7541/2023.2022.0281
Abstract:
In recent years, the intensive breeding mode has developed rapidly, however, various problems emerge with intensive fish culture methods, especially crowding stress and increased susceptibility to disease, which will ultimately influence the growth performance, welfare, and profitability of the farmed fish. Intestinal microbes play an important role in maintaining the balance of intestinal environment and host health. We are genuinely concerned about the health of fish (via their intestinal flora) under high density culture. Therefore, the present study aimed to describe compositional and functional differences of the gut microbiome of Genetically improved farmed tilapia (GIFT, Oreochromis niloticus) reared under Acanthopanax senticosus ultrafine powder, by investigating their responses to 8 weeks culture experiment. The results showed as follows: 1) adding 4‰ A. senticosus superfine powder to the diet could significantly increase the activities of intestinal amylase, lipase and trypsin, improve the growth and development of tilapia and improve the feed conversion rate. 2) adding 4‰ A. senticosus superfine powder to the diet could significantly reduce the levels of triglyceride and total cholesterol in the liver, and reduce the content of malondialdehyde and increase the activity of superoxide dismutase in the liver. 3) adding 4‰ A. senticosus superfine powder to the diet could significantly affect the composition of intestinal microorganisms and improve the alpha diversity of intestinal microorganisms. Some diversity indexes are significantly positively correlated with amylase, lipase and superoxide dismutase, and negatively correlated with triglyceride and total cholesterol. 4) Proteobacteria, Fusobacteria and Firmicutes were the dominant phyla in the intestinal tract of GIFT. The core difference genera screened were Enterovibrio, Cetobacterium and Grimontia, which were significantly enriched in the control group. In addition, Lawsonia, Acinetobacter, Pseudomonas and Brevinema were significantly enriched in 4‰ A. senticosus adding group, indicating that there may be a certain abundance of potential pathogenic bacteria in fish during the growth cycle. Functional prediction analysis with PICRUSt2 revealed that the bacterial community was active in metabolism at hierarchy level 1. The relative abundance of human diseases in the control group was significantly higher than that in 4‰ A. senticosus adding group. Further, the abundance of functional genes was similar at hierarchy level 2, implying abundant functional diversity. In conclusion, adding 4‰ A. senticosus superfine powder to the feed could affect intestinal enzyme activity, liver biochemical indices and intestinal microflora composition and function of GIFT, and promote the healthy growth of fish.
In recent years, the intensive breeding mode has developed rapidly, however, various problems emerge with intensive fish culture methods, especially crowding stress and increased susceptibility to disease, which will ultimately influence the growth performance, welfare, and profitability of the farmed fish. Intestinal microbes play an important role in maintaining the balance of intestinal environment and host health. We are genuinely concerned about the health of fish (via their intestinal flora) under high density culture. Therefore, the present study aimed to describe compositional and functional differences of the gut microbiome of Genetically improved farmed tilapia (GIFT, Oreochromis niloticus) reared under Acanthopanax senticosus ultrafine powder, by investigating their responses to 8 weeks culture experiment. The results showed as follows: 1) adding 4‰ A. senticosus superfine powder to the diet could significantly increase the activities of intestinal amylase, lipase and trypsin, improve the growth and development of tilapia and improve the feed conversion rate. 2) adding 4‰ A. senticosus superfine powder to the diet could significantly reduce the levels of triglyceride and total cholesterol in the liver, and reduce the content of malondialdehyde and increase the activity of superoxide dismutase in the liver. 3) adding 4‰ A. senticosus superfine powder to the diet could significantly affect the composition of intestinal microorganisms and improve the alpha diversity of intestinal microorganisms. Some diversity indexes are significantly positively correlated with amylase, lipase and superoxide dismutase, and negatively correlated with triglyceride and total cholesterol. 4) Proteobacteria, Fusobacteria and Firmicutes were the dominant phyla in the intestinal tract of GIFT. The core difference genera screened were Enterovibrio, Cetobacterium and Grimontia, which were significantly enriched in the control group. In addition, Lawsonia, Acinetobacter, Pseudomonas and Brevinema were significantly enriched in 4‰ A. senticosus adding group, indicating that there may be a certain abundance of potential pathogenic bacteria in fish during the growth cycle. Functional prediction analysis with PICRUSt2 revealed that the bacterial community was active in metabolism at hierarchy level 1. The relative abundance of human diseases in the control group was significantly higher than that in 4‰ A. senticosus adding group. Further, the abundance of functional genes was similar at hierarchy level 2, implying abundant functional diversity. In conclusion, adding 4‰ A. senticosus superfine powder to the feed could affect intestinal enzyme activity, liver biochemical indices and intestinal microflora composition and function of GIFT, and promote the healthy growth of fish.
,
Available online
, doi: 10.7541/2022.2021.0377
Abstract:
Aphanizomenon and Microcystis are common dominant genera of bloom-forming cyanobacteria, and they have seasonal succession in some lakes. Aphanizomenon gracile is the most common Aphanizomenon species in Chinese freshwater bodies which can produce odor substance geosmin. The effects of the interspecific interaction between Microcystis and Aphanizomenon on the cell growth and the synthesis and release of geosmin is not clear. In this paper, two Microcystis species with different characteristics, toxic Microcystis aeruginosa and non-toxic Microcystis wesenbergii, were respectively co-cultured with geosmin producing Aphanizomenon gracile at different initial inoculation ratios (1﹕2, 1﹕1 and 2﹕1) to explore the effects of interspecific interaction on algae growth and geosmin synthesis and release. The results showed that both Microcystis inhibited the growth of Aphanizomenon, but the latter promoted the growth of the formers. Microcystis wesenbergii promoted the release of geosmin (when the initial inoculation ratio was 1﹕1, the extracellular geosmin reached 269.43 fg/cell), and promoted the synthesis of geosmin only in early and late growth stages; Microcystis aeruginosa promoted the synthesis of geosmin in the early stage of co-culture, but co-culture inhibited the release of geosmin, and geosmin was not detected in the middle and late stage of co-culture. Our research results showed that during the seasonal succession of Aphanizomenon and Microcystis in natural water bodies, Microcystis has an advantage in the competition with Aphanizomenon, and the competitive pressure of Microcystis on Aphanizomenon urges it to synthesize odor substances. As the Aphanizomenon decays, it may be accompanied by the release of a large amount of odor substances, which increases the risk of odor events.
Aphanizomenon and Microcystis are common dominant genera of bloom-forming cyanobacteria, and they have seasonal succession in some lakes. Aphanizomenon gracile is the most common Aphanizomenon species in Chinese freshwater bodies which can produce odor substance geosmin. The effects of the interspecific interaction between Microcystis and Aphanizomenon on the cell growth and the synthesis and release of geosmin is not clear. In this paper, two Microcystis species with different characteristics, toxic Microcystis aeruginosa and non-toxic Microcystis wesenbergii, were respectively co-cultured with geosmin producing Aphanizomenon gracile at different initial inoculation ratios (1﹕2, 1﹕1 and 2﹕1) to explore the effects of interspecific interaction on algae growth and geosmin synthesis and release. The results showed that both Microcystis inhibited the growth of Aphanizomenon, but the latter promoted the growth of the formers. Microcystis wesenbergii promoted the release of geosmin (when the initial inoculation ratio was 1﹕1, the extracellular geosmin reached 269.43 fg/cell), and promoted the synthesis of geosmin only in early and late growth stages; Microcystis aeruginosa promoted the synthesis of geosmin in the early stage of co-culture, but co-culture inhibited the release of geosmin, and geosmin was not detected in the middle and late stage of co-culture. Our research results showed that during the seasonal succession of Aphanizomenon and Microcystis in natural water bodies, Microcystis has an advantage in the competition with Aphanizomenon, and the competitive pressure of Microcystis on Aphanizomenon urges it to synthesize odor substances. As the Aphanizomenon decays, it may be accompanied by the release of a large amount of odor substances, which increases the risk of odor events.
,
Available online
, doi: 10.7541/2023.2022.0268
Abstract:
The experiment was conducted to investigate the effects of dietary protein source and stocking density on growth performance, body composition and serum biochemical parameters of grass carp (Ctenopharyngodon idellus). A two-factor orthogonal experiment (3×5) was used to evaluate the effects of soybean meal (SM), Clostridium autoethanogenum protein (CAP), Tenebrio molito (TM), cottonseed protein concentrate (CPC) and Chlorella (CH) for grass carps with three stocking density. Five isonitrogenous and isoenergetic diets were prepared with the five protein sources as a single protein source, respectively. Grass carps with an initial body weight of (5.36±0.18) g were fed with the five test diets at three stocking density (0.11, 0.16 and 0.21 kg/m3,) for 60 days in pond cages (1.0 m×1.0 m×1.5 m), respectively. The results showed that the feed coefficient (FCR) increased, and the specific growth rate (SGR), weight gain rate (WGR), protein efficiency (PER) and liver index (HSI) decreased with the increase of stocking density. Under the three stocking densities, FCR in TM group was significantly higher than that of other protein source groups (P<0.05), and FBW, SGR, WGR and PER were significantly lower than those in other protein source groups (P<0.05). The growth performance of grass carp in the 0.11 kg/m3 and 0.16 kg/m3 stocking density groups were similar, and were significantly better than that in the 0.21 kg/m3 stocking density group (P<0.05). Protein source and stocking density had no significant effects on the moisture, crude protein and ash content of the whole grass carp (P>0.05). The crude fat content of grass carp in the 0.21 kg/m3 stocking density group was significantly lower than that in other stocking density groups (P<0.05), and the serum biochemical indexes of aspartate aminotransferase (AST), alanine aminotransferase (ALT) and glucose (GLU) were significantly higher than those in other stocking density groups (P<0.05). Regardless of the stocking density, the serum albumin (ALB) content of the CH group was significantly higher than that in the CAP group, the TM group and the CPC group (P<0.05). The alkaline phosphatase activity of TM group was significantly higher than that in the CAP group (P<0.05). Based on the protein efficiency and weight gain rate, the ability of grass carp to utilize the five protein sources was CAP=CH=CPC =SM>TM.
The experiment was conducted to investigate the effects of dietary protein source and stocking density on growth performance, body composition and serum biochemical parameters of grass carp (Ctenopharyngodon idellus). A two-factor orthogonal experiment (3×5) was used to evaluate the effects of soybean meal (SM), Clostridium autoethanogenum protein (CAP), Tenebrio molito (TM), cottonseed protein concentrate (CPC) and Chlorella (CH) for grass carps with three stocking density. Five isonitrogenous and isoenergetic diets were prepared with the five protein sources as a single protein source, respectively. Grass carps with an initial body weight of (5.36±0.18) g were fed with the five test diets at three stocking density (0.11, 0.16 and 0.21 kg/m3,) for 60 days in pond cages (1.0 m×1.0 m×1.5 m), respectively. The results showed that the feed coefficient (FCR) increased, and the specific growth rate (SGR), weight gain rate (WGR), protein efficiency (PER) and liver index (HSI) decreased with the increase of stocking density. Under the three stocking densities, FCR in TM group was significantly higher than that of other protein source groups (P<0.05), and FBW, SGR, WGR and PER were significantly lower than those in other protein source groups (P<0.05). The growth performance of grass carp in the 0.11 kg/m3 and 0.16 kg/m3 stocking density groups were similar, and were significantly better than that in the 0.21 kg/m3 stocking density group (P<0.05). Protein source and stocking density had no significant effects on the moisture, crude protein and ash content of the whole grass carp (P>0.05). The crude fat content of grass carp in the 0.21 kg/m3 stocking density group was significantly lower than that in other stocking density groups (P<0.05), and the serum biochemical indexes of aspartate aminotransferase (AST), alanine aminotransferase (ALT) and glucose (GLU) were significantly higher than those in other stocking density groups (P<0.05). Regardless of the stocking density, the serum albumin (ALB) content of the CH group was significantly higher than that in the CAP group, the TM group and the CPC group (P<0.05). The alkaline phosphatase activity of TM group was significantly higher than that in the CAP group (P<0.05). Based on the protein efficiency and weight gain rate, the ability of grass carp to utilize the five protein sources was CAP=CH=CPC =SM>TM.
,
Available online
, doi: 10.7541/2023.2022.0226
Abstract:
Cyprinus carpio and Cyprinus carpio kio are important aquaculture varieties in China. Highly pathogenic and infectious of Cyprinid herpesvirus 3 (CyHV-3, KHV) has caused great losses in the culture of Cyprinus carpio and Cyprinus carpio kio. Therefore, the rapid and convenient detection technology is desperately needed to be used for non-laboratory and fast detection. Recombinase polymerase amplification (RPA) is such an Isothermal amplification technology which can amplify DNA within 30 minutes under low reaction temperature. Then we combined RPA with lateral flow dipstick (LFD) and established a rapid and sensitive method which are suitable for field clinical detection of KHV. In this study, primers and probe sequences were designed according to the conserved fragment of SphI-5 gene of KHV. The experimental results show that the RPA technique can detect target fragment by agarose gel electrophoresis within 30 minutes at the optimal temperature of 38℃ and the RPA results can be visualized in only 5 minutes in combination with the LFD and the entire RPA-LFD assay takes 50 minutes which are a lot faster than PCR method.. The method established in this experiment for the detection of KHV by RPA-LFD is so simple and sensitivity that can be useful for rapid diagnosis in aquaculture with limited resources.
Cyprinus carpio and Cyprinus carpio kio are important aquaculture varieties in China. Highly pathogenic and infectious of Cyprinid herpesvirus 3 (CyHV-3, KHV) has caused great losses in the culture of Cyprinus carpio and Cyprinus carpio kio. Therefore, the rapid and convenient detection technology is desperately needed to be used for non-laboratory and fast detection. Recombinase polymerase amplification (RPA) is such an Isothermal amplification technology which can amplify DNA within 30 minutes under low reaction temperature. Then we combined RPA with lateral flow dipstick (LFD) and established a rapid and sensitive method which are suitable for field clinical detection of KHV. In this study, primers and probe sequences were designed according to the conserved fragment of SphI-5 gene of KHV. The experimental results show that the RPA technique can detect target fragment by agarose gel electrophoresis within 30 minutes at the optimal temperature of 38℃ and the RPA results can be visualized in only 5 minutes in combination with the LFD and the entire RPA-LFD assay takes 50 minutes which are a lot faster than PCR method.. The method established in this experiment for the detection of KHV by RPA-LFD is so simple and sensitivity that can be useful for rapid diagnosis in aquaculture with limited resources.
,
Available online
, doi: 10.7541/2023.2022.0272
Abstract:
Environmental DNA (eDNA) is a booming biological monitoring technology. It has been proved by many studies to be an effective tool for the detection, monitoring and indication of fish species and its biodiversity and abundance. This study applies high-throughput sequencing technology to analyze the eDNA samples of the waters of the Yangtze Estuary and compares the results with the traditional fishery studies. It aims to elaborate the diverse characteristics of the fish communities in the Yangtze Estuary and to explore the prospects of applying eDNA technology to the diversity study of the fish species in the Yangtze Estuary. The study results show that the eDNA detects 45 fish species, which can be classified to 41 genera, 21 families and 10 orders, and there is no significant difference of the abundances of the species, but their diversity characters vary considerably, while the bottom trawl method detects 33 fish species, which can be classified to 29 genera, 16 families and 11 orders. 18species, accounting for 30% of the total fish species, can be detected in both monitoring methods. Among those 18species, the number of Perciformes is the most, followed by Cypriniforms. The results of both monitoring methods show Coilia nasus and Coilia Mystus are the dominant species in the Yangtze Estuary. When comparing the two monitoring methods by Alpha diversity, both Simpson and Shannon indexes show the Alpha diversity of the fish communities in the Yangtze River Estuary detected by eDNA method is significantly greater than of bottom trawl. The study shows that it is feasible to apply eDNA technology in monitoring fishery resources in the Yangtze River Estuary, while during the fishing moratorium different methods can be used to monitor fishery resources based on the actual situation.
Environmental DNA (eDNA) is a booming biological monitoring technology. It has been proved by many studies to be an effective tool for the detection, monitoring and indication of fish species and its biodiversity and abundance. This study applies high-throughput sequencing technology to analyze the eDNA samples of the waters of the Yangtze Estuary and compares the results with the traditional fishery studies. It aims to elaborate the diverse characteristics of the fish communities in the Yangtze Estuary and to explore the prospects of applying eDNA technology to the diversity study of the fish species in the Yangtze Estuary. The study results show that the eDNA detects 45 fish species, which can be classified to 41 genera, 21 families and 10 orders, and there is no significant difference of the abundances of the species, but their diversity characters vary considerably, while the bottom trawl method detects 33 fish species, which can be classified to 29 genera, 16 families and 11 orders. 18species, accounting for 30% of the total fish species, can be detected in both monitoring methods. Among those 18species, the number of Perciformes is the most, followed by Cypriniforms. The results of both monitoring methods show Coilia nasus and Coilia Mystus are the dominant species in the Yangtze Estuary. When comparing the two monitoring methods by Alpha diversity, both Simpson and Shannon indexes show the Alpha diversity of the fish communities in the Yangtze River Estuary detected by eDNA method is significantly greater than of bottom trawl. The study shows that it is feasible to apply eDNA technology in monitoring fishery resources in the Yangtze River Estuary, while during the fishing moratorium different methods can be used to monitor fishery resources based on the actual situation.
,
Available online
, doi: 10.7541/2023.2022.0307
Abstract:
To investigate the effects of fasting for 1—2 weeks on swimming performance, thermal tolerance and spontaneous activity juvenile Chinese sucker (Myxocyprinus asiaticus), the body mass and body length of 108 fish with (3.26±0.64) g and (5.32±0.32) cm were randomly divided into 3 groups, i.e., control group, 1 week fasting group and 2 week fasting group. Then, relevant parameters of swimming ability, thermal tolerance and spontaneous activity of these fishes were measured after different fasting times. Fasting for 1—2 weeks has no effects on the rest metabolic rate and critical swimming speed of M. asiaticus. Maximum metabolic rate, metabolic scope, cost of transport, head height/head length and body height/body length significantly increased in 1 week and 2 weeks fasting groups compared to that in control group (P<0.05). Fasting for 1—2 weeks has no effects on the critical thermal minimum and lethal thermal minimum of M. asiaticus. Critical thermal maximum and lethal thermal maximum significantly increased in 1 week and 2 weeks fasting groups compared to that in control group (P<0.05). Fasting for 1—2 weeks has no effects on the total movement distance, average movement speed and percent time spent moving of M. asiaticus. Our results suggested that aerobic swimming capacity and spontaneous activity of M. asiaticus was not affected by fasting for 1—2 weeks, which may be beneficial for maintaining their daily foraging activities. Moreover, fasting for 1—2 weeks has no significant impact on the low-temperature tolerance, but this stress can improve the high-temperature tolerance of M. asiaticus.
To investigate the effects of fasting for 1—2 weeks on swimming performance, thermal tolerance and spontaneous activity juvenile Chinese sucker (Myxocyprinus asiaticus), the body mass and body length of 108 fish with (3.26±0.64) g and (5.32±0.32) cm were randomly divided into 3 groups, i.e., control group, 1 week fasting group and 2 week fasting group. Then, relevant parameters of swimming ability, thermal tolerance and spontaneous activity of these fishes were measured after different fasting times. Fasting for 1—2 weeks has no effects on the rest metabolic rate and critical swimming speed of M. asiaticus. Maximum metabolic rate, metabolic scope, cost of transport, head height/head length and body height/body length significantly increased in 1 week and 2 weeks fasting groups compared to that in control group (P<0.05). Fasting for 1—2 weeks has no effects on the critical thermal minimum and lethal thermal minimum of M. asiaticus. Critical thermal maximum and lethal thermal maximum significantly increased in 1 week and 2 weeks fasting groups compared to that in control group (P<0.05). Fasting for 1—2 weeks has no effects on the total movement distance, average movement speed and percent time spent moving of M. asiaticus. Our results suggested that aerobic swimming capacity and spontaneous activity of M. asiaticus was not affected by fasting for 1—2 weeks, which may be beneficial for maintaining their daily foraging activities. Moreover, fasting for 1—2 weeks has no significant impact on the low-temperature tolerance, but this stress can improve the high-temperature tolerance of M. asiaticus.
,
Available online
, doi: 10.7541/2023.2022.0263
Abstract:
Myrmecia incisa is a kind of green alga, which was rich in arachidonic acid (AA). On the basis of the available reports, it was speculated that phospholipase A2 (PLA2) might play an important role in the lipid synthesis of M. incisa. In order to identify the function of PLA2, the full- length cDNA sequence of PLA2 gene (MiPLA2) of this alga was cloned by RACE technology. The full- length cDNA sequence of MiPLA2 was 1082 bp in length, and consisted of a 5′-untranslated region (UTR) of 180 bp, a 3′-UTR of 464 bp, and an open reading frame (ORF) of 438 bp, which encoded a protein of 145 amino acids. And the full-length DNA sequence of MiPLA2 gene was 1594 bp, which contained 3 introns and 4 exons. Multi-sequence alignments of the secreted PLA2 (sPLA2) proteins from several different species of plants showed that MiPLA2harbored a conserved Ca2+ binding motif and a catalytically active domain. Phylogenetic analysis illustrated that MiPLA2 belongs to the plant sPLA2-XIA family. Then, the pET32a-Mipla2 prokaryotic expression vector was constructed. After induction and purification, a recombinant MiPLA2 protein with a molecular weight size of 31.36 kD was obtained. Thin-layer chromatography (TLC) analysis of the in vitro enzymatic reaction products showed that the recombinant MiPLA2 could catalyze the hydrolysis of phosphatidylcholine (PC) into hemolytic phosphatidylcholine (LPC). The results might help to reveal the pathway and mechanism of ArA being preferentially used for triacylglycerol (TAG) synthesis, and lay a foundation for improving the oil production in this alga by the genetic modification of pla2 gene.
Myrmecia incisa is a kind of green alga, which was rich in arachidonic acid (AA). On the basis of the available reports, it was speculated that phospholipase A2 (PLA2) might play an important role in the lipid synthesis of M. incisa. In order to identify the function of PLA2, the full- length cDNA sequence of PLA2 gene (MiPLA2) of this alga was cloned by RACE technology. The full- length cDNA sequence of MiPLA2 was 1082 bp in length, and consisted of a 5′-untranslated region (UTR) of 180 bp, a 3′-UTR of 464 bp, and an open reading frame (ORF) of 438 bp, which encoded a protein of 145 amino acids. And the full-length DNA sequence of MiPLA2 gene was 1594 bp, which contained 3 introns and 4 exons. Multi-sequence alignments of the secreted PLA2 (sPLA2) proteins from several different species of plants showed that MiPLA2harbored a conserved Ca2+ binding motif and a catalytically active domain. Phylogenetic analysis illustrated that MiPLA2 belongs to the plant sPLA2-XIA family. Then, the pET32a-Mipla2 prokaryotic expression vector was constructed. After induction and purification, a recombinant MiPLA2 protein with a molecular weight size of 31.36 kD was obtained. Thin-layer chromatography (TLC) analysis of the in vitro enzymatic reaction products showed that the recombinant MiPLA2 could catalyze the hydrolysis of phosphatidylcholine (PC) into hemolytic phosphatidylcholine (LPC). The results might help to reveal the pathway and mechanism of ArA being preferentially used for triacylglycerol (TAG) synthesis, and lay a foundation for improving the oil production in this alga by the genetic modification of pla2 gene.
,
Available online
, doi: 10.7541/2023.2022.0003
Abstract:
In this study, the cold shock treatment was used to induce triploid yellow drum (Nibea albiflora) and the ploidy was determined. The histology and gene expression analysis of reproduction-related genes were further used to characterize the gonadal development in triploid yellow drum. Firstly, the fertilized eggs were subjected to the cold shock treatment implemented at 3℃ for a period of 10 min commencing at post-fertilization 2.5min, and the fertilization rate and hatching rate in the cold shock treatment groups were (70.31±4.49)% and (21.5±6.63)%, respectively, which were significantly lower than that of diploid. Secondly, we found that the DNA relative content of triploid was 1.5 times larger than that of diploid by flow cytometer analysis, and the number of the chromosome in the triploid was 72, whereas the number of the chromosome in the diploid was 48shown by karyotype analysis. The rate of the triploid was 100% in the present study. Thirdly, the gonadosomatic indexes of the triploids were significantly lower than that of the diploids. Histological results showed that the gonadal development of the triploids was slower than that of the diploids. At the age of 12 months, the testis and ovary of the diploids were both at the stage V, while the testis and ovary of the triploids were at stage Ⅲ and stage Ⅰ, respectively. Fourthly, the dmrt1 and vasa expression in the triploid testis and cyp19a expression in the triploid ovary were significantly lower than those in the diploid gonads (P<0.05), and the vasa expression in the triploid ovary was also lower than that in the diploids (P>0.05). Taken together, our results indicated that the triploid yellow drum could be successfully induced by the cold shock treatment, and the gonadal development of the triploids was retarded. The results of present study will lay a basis for the application of the triploid in germ cell transplantation and the genetic improvement of yellow drum.
In this study, the cold shock treatment was used to induce triploid yellow drum (Nibea albiflora) and the ploidy was determined. The histology and gene expression analysis of reproduction-related genes were further used to characterize the gonadal development in triploid yellow drum. Firstly, the fertilized eggs were subjected to the cold shock treatment implemented at 3℃ for a period of 10 min commencing at post-fertilization 2.5min, and the fertilization rate and hatching rate in the cold shock treatment groups were (70.31±4.49)% and (21.5±6.63)%, respectively, which were significantly lower than that of diploid. Secondly, we found that the DNA relative content of triploid was 1.5 times larger than that of diploid by flow cytometer analysis, and the number of the chromosome in the triploid was 72, whereas the number of the chromosome in the diploid was 48shown by karyotype analysis. The rate of the triploid was 100% in the present study. Thirdly, the gonadosomatic indexes of the triploids were significantly lower than that of the diploids. Histological results showed that the gonadal development of the triploids was slower than that of the diploids. At the age of 12 months, the testis and ovary of the diploids were both at the stage V, while the testis and ovary of the triploids were at stage Ⅲ and stage Ⅰ, respectively. Fourthly, the dmrt1 and vasa expression in the triploid testis and cyp19a expression in the triploid ovary were significantly lower than those in the diploid gonads (P<0.05), and the vasa expression in the triploid ovary was also lower than that in the diploids (P>0.05). Taken together, our results indicated that the triploid yellow drum could be successfully induced by the cold shock treatment, and the gonadal development of the triploids was retarded. The results of present study will lay a basis for the application of the triploid in germ cell transplantation and the genetic improvement of yellow drum.
,
Available online
, doi: 10.7541/2023.2022.0245
Abstract:
The effects of methanotroph (Methylococcus capsulatus Barh) bacteria meal (MBM, FeedKind®) replaces fishmeal (FM) on the growth performance and antioxidant capacity of Trachinotus ovatus (initial mean weight 34.88±1.13 g) were conducted through a 56-day breeding trial. MBM at 0, 3%, 7% and 10.5% were added to replace fishmeal at 0, 10%, 20% and 30%, to formulate four isonitrogenous and isolipidic feeds named MBM0, MBM10, MBM20 and MBM30, respectively. The results of the experiment showed that there was no significant difference in the final mean weight, weight gain rate, specific growth rate, survival rate, hepatosomatic index, visceral index and feed factor between the groups as the MBM content in the diets increased (P>0.05). The condition factor of the MBM30 group was significantly higher than that of the MBM0 group (P<0.05). The crude protein content of whole fish in each group was not significantly different (P>0.05), while the crude fat content of whole fish in the MBM20 group was significantly higher than that in the MBM0 and MBM10 groups (P<0.05). The crude fat content of dorsal muscle in the MBM20 and MBM30 groups was significantly higher than that in the MBM0 group (P<0.05), and there was a significant positive correlation between the crude fat content in dorsal muscle and the proportion of fishmeal replaced by MBM (P<0.05). Serum triglycerides were significantly lower in the MBM20 and MBM30 groups than those in MBM0 group (P<0.05), serum glutathione transaminase activity was significantly higher in the MBM20 group than that in the MBM0 group (P<0.05), and serum albumin was significantly higher in the MBM10 group than those in MBM0 group (P<0.05). Total serum antioxidant capacity in MBM20 group was not significantly different with the MBM0 group (P> 0.05), while significantly higher than that in the MBM10 and MBM30 groups (P<0.05). Intestinal superoxide dismutase activity in the MBM20 group was significantly higher than that in the rest of the groups (P<0.05). Vacuolar area in liver through H&E-stained was significantly higher in the MBM20 and MBM30 groups than that in the MBM0 group (P<0.05). In conclusion, at 35% fishmeal content in the basal diet, MBM could replace 20%—30% of fishmeal without negatively affecting growth performance, morphological indices, body composition and serum biochemical indices of Trachinotus ovatus.
The effects of methanotroph (Methylococcus capsulatus Barh) bacteria meal (MBM, FeedKind®) replaces fishmeal (FM) on the growth performance and antioxidant capacity of Trachinotus ovatus (initial mean weight 34.88±1.13 g) were conducted through a 56-day breeding trial. MBM at 0, 3%, 7% and 10.5% were added to replace fishmeal at 0, 10%, 20% and 30%, to formulate four isonitrogenous and isolipidic feeds named MBM0, MBM10, MBM20 and MBM30, respectively. The results of the experiment showed that there was no significant difference in the final mean weight, weight gain rate, specific growth rate, survival rate, hepatosomatic index, visceral index and feed factor between the groups as the MBM content in the diets increased (P>0.05). The condition factor of the MBM30 group was significantly higher than that of the MBM0 group (P<0.05). The crude protein content of whole fish in each group was not significantly different (P>0.05), while the crude fat content of whole fish in the MBM20 group was significantly higher than that in the MBM0 and MBM10 groups (P<0.05). The crude fat content of dorsal muscle in the MBM20 and MBM30 groups was significantly higher than that in the MBM0 group (P<0.05), and there was a significant positive correlation between the crude fat content in dorsal muscle and the proportion of fishmeal replaced by MBM (P<0.05). Serum triglycerides were significantly lower in the MBM20 and MBM30 groups than those in MBM0 group (P<0.05), serum glutathione transaminase activity was significantly higher in the MBM20 group than that in the MBM0 group (P<0.05), and serum albumin was significantly higher in the MBM10 group than those in MBM0 group (P<0.05). Total serum antioxidant capacity in MBM20 group was not significantly different with the MBM0 group (P> 0.05), while significantly higher than that in the MBM10 and MBM30 groups (P<0.05). Intestinal superoxide dismutase activity in the MBM20 group was significantly higher than that in the rest of the groups (P<0.05). Vacuolar area in liver through H&E-stained was significantly higher in the MBM20 and MBM30 groups than that in the MBM0 group (P<0.05). In conclusion, at 35% fishmeal content in the basal diet, MBM could replace 20%—30% of fishmeal without negatively affecting growth performance, morphological indices, body composition and serum biochemical indices of Trachinotus ovatus.
,
Available online
, doi: 10.7541/2022.2021.0315
Abstract:
Mandarin fish (Siniperca chuatsi) is a kind of carnivorous fish that feeds on live prey fish. Recent research has shown that it could be domesticated by artificial diet. However, the effects of artificial diet feeding after domestication on the nutritional value and flesh quality were lacking. The present study compared nutritional composition, amino acid component and its nutritional evaluation, fatty acid profiles, and texture properties between mandarin fish fed with live prey fish and artificial diet. The results showed that no significant differences were observed in the protein levels of the two groups, while the lipid levels were significantly higher in fish fed the artificial diet (P<0.05). The amino acid score (AAS), chemical score (CS), essential amino acid index (EAAI) and F value did not vary between groups. However, Met+Cys were both the first-limiting amino acids in mandarin fish under the two feeding modes, which could provide information to improve diet formulation for mandarin fish. The levels of unsaturated fatty acids (SFA), monounsaturated fatty acids (MUFA), and polyunsaturated fatty acids (PUFA) were extremely significantly higher in mandarin fish fed an artificial diet (P<0.01), especially for the levels of C20: 5 (EPA) and C22: 6 (DHA), which indicated that artificial diet feeding could provide better fatty acid profiles than live prey fish by balanced diet formulation. The firmness, chewiness, gumminess, and resilience in the muscle of mandarin fish fed with artificial diet were extremely higher than the live prey fish group (P<0.01), whereas the stickiness showed the opposite levels (P<0.01), suggesting the improvement on texture of flesh quality. Overall, we found no variations in protein levels and amino acid evaluations in mandarin fish fed the artificial diet, but the fatty acid profiles showed superior results as indicated by higher levels of EPA and DHA. Therefore, our findings evaluated the flesh quality properties of mandarin fish by feeding an artificial diet, showing the potential of the use of an artificial diet in mandarin fish and the sustainable development of its industry.
Mandarin fish (Siniperca chuatsi) is a kind of carnivorous fish that feeds on live prey fish. Recent research has shown that it could be domesticated by artificial diet. However, the effects of artificial diet feeding after domestication on the nutritional value and flesh quality were lacking. The present study compared nutritional composition, amino acid component and its nutritional evaluation, fatty acid profiles, and texture properties between mandarin fish fed with live prey fish and artificial diet. The results showed that no significant differences were observed in the protein levels of the two groups, while the lipid levels were significantly higher in fish fed the artificial diet (P<0.05). The amino acid score (AAS), chemical score (CS), essential amino acid index (EAAI) and F value did not vary between groups. However, Met+Cys were both the first-limiting amino acids in mandarin fish under the two feeding modes, which could provide information to improve diet formulation for mandarin fish. The levels of unsaturated fatty acids (SFA), monounsaturated fatty acids (MUFA), and polyunsaturated fatty acids (PUFA) were extremely significantly higher in mandarin fish fed an artificial diet (P<0.01), especially for the levels of C20: 5 (EPA) and C22: 6 (DHA), which indicated that artificial diet feeding could provide better fatty acid profiles than live prey fish by balanced diet formulation. The firmness, chewiness, gumminess, and resilience in the muscle of mandarin fish fed with artificial diet were extremely higher than the live prey fish group (P<0.01), whereas the stickiness showed the opposite levels (P<0.01), suggesting the improvement on texture of flesh quality. Overall, we found no variations in protein levels and amino acid evaluations in mandarin fish fed the artificial diet, but the fatty acid profiles showed superior results as indicated by higher levels of EPA and DHA. Therefore, our findings evaluated the flesh quality properties of mandarin fish by feeding an artificial diet, showing the potential of the use of an artificial diet in mandarin fish and the sustainable development of its industry.
,
Available online
, doi: 10.7541/2023.2022.0266
Abstract:
In order to clarify how different environmental sample types affect the detectability of mussel species when using environmental DNA metabarcoding technology, surface water, bottom water and sediment were collected in Poyang Lake in winter and spring of 2021 for environmental DNA metabarcoding analysis, and then combined with traditional methods for collection and verification. A total of 33 species of mussels from Poyang Lake were detected by environmental DNA metabarcoding technology, while 18species were collected by traditional methods. All the species collected by traditional methods could be detected by environmental DNA metabarcoding technology. The number of mussel species annotated in surface water and bottom water was respectively higher than that in sediment, and the mussel species annotated in surface water and bottom water completely covered sediment, respectively. There was no significant seasonal difference in α diversity level of mussels based on environmental DNA metabarcoding, but significant seasonal difference in β diversity level of mussels. The mussel diversity in both surface and bottom water was significantly respectively higher than that in sediment samples. The Beta diversity analysis also showed significant differences between water samples (surface and bottom water respectively) and sediment samples. But there were no significant differences in the diversity and community structure between surface and bottom water. Water depth (WD), depth of Secchi disk (SD), water temperature (WT) and total nitrogen (TN) significantly affected the community structure of mussels in Poyang Lake. Environmental DNA metabarcoding is feasible in monitoring mussel freshwater diversity, and water sampling is better than sediment sampling. There is no significant difference between surface water and bottom water.
In order to clarify how different environmental sample types affect the detectability of mussel species when using environmental DNA metabarcoding technology, surface water, bottom water and sediment were collected in Poyang Lake in winter and spring of 2021 for environmental DNA metabarcoding analysis, and then combined with traditional methods for collection and verification. A total of 33 species of mussels from Poyang Lake were detected by environmental DNA metabarcoding technology, while 18species were collected by traditional methods. All the species collected by traditional methods could be detected by environmental DNA metabarcoding technology. The number of mussel species annotated in surface water and bottom water was respectively higher than that in sediment, and the mussel species annotated in surface water and bottom water completely covered sediment, respectively. There was no significant seasonal difference in α diversity level of mussels based on environmental DNA metabarcoding, but significant seasonal difference in β diversity level of mussels. The mussel diversity in both surface and bottom water was significantly respectively higher than that in sediment samples. The Beta diversity analysis also showed significant differences between water samples (surface and bottom water respectively) and sediment samples. But there were no significant differences in the diversity and community structure between surface and bottom water. Water depth (WD), depth of Secchi disk (SD), water temperature (WT) and total nitrogen (TN) significantly affected the community structure of mussels in Poyang Lake. Environmental DNA metabarcoding is feasible in monitoring mussel freshwater diversity, and water sampling is better than sediment sampling. There is no significant difference between surface water and bottom water.
,
Available online
, doi: 10.7541/2023.2022.0241
Abstract:
The water-level-fluctuation zone (WLFZ) of the Three Gorges Reservoir (TGR) has the characteristics of large water level drop, wide area and high vegetation coverage. In order to explore the distribution law of vegetation in the WLFZ of the TGR and its potential contribution to the ecological environment and fishery in the reservoir area, the plant community structural characteristics, plant nutritional components, section slope and soil physical and chemical characteristics of 30 typical sections of the WLFZ in Zigui, Yunyang and Zhongxian Reservoir Areas were investigated and analyzed. The results showed that: (1) 209species belonging to 61 genera and 54 families were found, of which Cynodon dactylon and Xanthium sibiricum were the main dominant species, with an average coverage of 29.73% and 26.87%, respectively. With the decrease of water level elevation, the coverage of C. dactylon, Alternanthera philoxeroides and Abutilon theophrasti gradually increased, the coverage of X. sibiricum, Melilotus officinalis and Bidens tripartite gradually decreased, while the coverage of Humulus scandens, Setaria viridis and Polygonum lapathifolium first increased and then decreased. The distribution of vegetation was also affected by the slope of the sampling sections. The coverage of C. dactylon was significantly negatively correlated with the slope (P<0.001), while that of X. sibiricum showed a significant single peak distribution (P<0.001). Higher soil moisture content promoted the formation of common dominant communities dominated by C. dactylon, and with the decrease of soil moisture content, vegetation types gradually succeed to common dominant communities dominated by X. sibiricum; (2) The surface soil in the WLFZ at low water level elevation (150—160 m) showed an obvious phosphorus absorption trend, while the soil at high water level elevation (160—175 m) showed an obvious phosphorus release trend, which was closely related to the vegetation types and the soil microbial community structure characteristics of the sampling plots; (3) The total ground fresh weights of C. dactylon and X. sibiricum in the whole WLFZ of TGR was 2.51×108 and 2.48×108 kg, respectively, their total amount and protein content are much higher than those of other plants, and their potential contribution to the fishery productivity in the reservoir area are 1.25×108 and 1.24×108 kg, respectively. To sum up, the dominant species of vegetation in the WLFZ of the TGR are C. dactylon and X. sibiricum. The distribution of vegetation is mainly affected by water level elevation, section slope and soil moisture content. The vegetation in the WLFZ of the TGR has high ecological service value in terms of terrestrial phosphorus interception, phosphorus regulation and fishery contribution. This study can provide an important reference for evaluating the ecological fishery function of the reservoir WLFZ and developing the vegetation restoration technology for the WLFZ.
The water-level-fluctuation zone (WLFZ) of the Three Gorges Reservoir (TGR) has the characteristics of large water level drop, wide area and high vegetation coverage. In order to explore the distribution law of vegetation in the WLFZ of the TGR and its potential contribution to the ecological environment and fishery in the reservoir area, the plant community structural characteristics, plant nutritional components, section slope and soil physical and chemical characteristics of 30 typical sections of the WLFZ in Zigui, Yunyang and Zhongxian Reservoir Areas were investigated and analyzed. The results showed that: (1) 209species belonging to 61 genera and 54 families were found, of which Cynodon dactylon and Xanthium sibiricum were the main dominant species, with an average coverage of 29.73% and 26.87%, respectively. With the decrease of water level elevation, the coverage of C. dactylon, Alternanthera philoxeroides and Abutilon theophrasti gradually increased, the coverage of X. sibiricum, Melilotus officinalis and Bidens tripartite gradually decreased, while the coverage of Humulus scandens, Setaria viridis and Polygonum lapathifolium first increased and then decreased. The distribution of vegetation was also affected by the slope of the sampling sections. The coverage of C. dactylon was significantly negatively correlated with the slope (P<0.001), while that of X. sibiricum showed a significant single peak distribution (P<0.001). Higher soil moisture content promoted the formation of common dominant communities dominated by C. dactylon, and with the decrease of soil moisture content, vegetation types gradually succeed to common dominant communities dominated by X. sibiricum; (2) The surface soil in the WLFZ at low water level elevation (150—160 m) showed an obvious phosphorus absorption trend, while the soil at high water level elevation (160—175 m) showed an obvious phosphorus release trend, which was closely related to the vegetation types and the soil microbial community structure characteristics of the sampling plots; (3) The total ground fresh weights of C. dactylon and X. sibiricum in the whole WLFZ of TGR was 2.51×108 and 2.48×108 kg, respectively, their total amount and protein content are much higher than those of other plants, and their potential contribution to the fishery productivity in the reservoir area are 1.25×108 and 1.24×108 kg, respectively. To sum up, the dominant species of vegetation in the WLFZ of the TGR are C. dactylon and X. sibiricum. The distribution of vegetation is mainly affected by water level elevation, section slope and soil moisture content. The vegetation in the WLFZ of the TGR has high ecological service value in terms of terrestrial phosphorus interception, phosphorus regulation and fishery contribution. This study can provide an important reference for evaluating the ecological fishery function of the reservoir WLFZ and developing the vegetation restoration technology for the WLFZ.
,
Available online
, doi: 10.7541/2022.2021.0291
Abstract:
MicroRNA (miRNA) is a non-coding single-stranded RNA about 21—25 nt in length. It is highly conserved and exhibit silencing-inducing effects at the post-transcriptional level of target genes, which regulate biological processes, including growth, development and immune response. Vitamin D3 is an essential substance in fish diets, many studies have shown fish are highly tolerant to vitamin D3, adding vitamin D3 into feed can enhance the immunity and disease resistance of fish and reduce the death rate when attacked by pathogenic microorganisms. In order to investigate the mechanism about the regulation of immune response by miRNAs mediating feed vitamin D3 in the JAK-STAT pathway of yellow catfish (Pelteobagrus fulvidraco), three diets with vitamin D3 content at 1120, 3950 and 16600 IU/kg were designed for juvenile Pelteobagrus fulvidraco. The growth trial was carried out over a 12-week period, following by an Edwardsiella ictaluri challenge experiment. Illumina high-throughput sequencing of head kidney and spleen after bacteria challenge identified differentially expressed miRNAs. The target genes of miR-194a was enriched in the JAK-STAT pathway. The relationship between miR-194a and the possible target genes jak2a and tyk2 had been verified by a dual luciferase reporter gene assay, which indicated the inhibitory role of miR-194a on jak2a and tyk2. In vitro, miR-194a was also found to respond with different concentrations of vitamin D3, inhibiting the expression of the target genes of jak2a and tyk2. With the activation of the JAK-STAT signaling pathway, the expression of anti-inflammatory response (AIR) factors and the target genes were also activated, the NF-κB pathway was inhibited, with significant decrease in expression of pro-inflammatory factors IL-1β, IL-6 and TNF-α and the transformation of macrophages from M1-type to M2-type polarization was accelerated with the increasing of vitamin D3 concentration (P<0.05). In conclusion, the results of this study demonstrated that miR-194a could respond to different concentration of vitamin D3 in in vivo and in vitro experiments. Dietary vitamin D3 up-regulated the expression of miR-194a, which negatively regulated the target genes of jak2a and tyk2, and exerted indirect effects towards the downstream genes in the JAK-STAT pathway, illuminating the mechanism of miR-194a-mediated regulation of immune response by dietary vitamin D3 through the JAK-STAT signaling pathway in Pelteobagrus fulvidraco. The results of this study provide a further knowledge of the mechanisms about dietary vitamin D3 in the regulation of immunity for fish. Furthermore, this study also provides a theoretical basis for the application of nutritional and immunological methods to prevent fish diseases and reduce the disadvantages of residues and water pollution caused from the use of drugs in aquaculture production.
MicroRNA (miRNA) is a non-coding single-stranded RNA about 21—25 nt in length. It is highly conserved and exhibit silencing-inducing effects at the post-transcriptional level of target genes, which regulate biological processes, including growth, development and immune response. Vitamin D3 is an essential substance in fish diets, many studies have shown fish are highly tolerant to vitamin D3, adding vitamin D3 into feed can enhance the immunity and disease resistance of fish and reduce the death rate when attacked by pathogenic microorganisms. In order to investigate the mechanism about the regulation of immune response by miRNAs mediating feed vitamin D3 in the JAK-STAT pathway of yellow catfish (Pelteobagrus fulvidraco), three diets with vitamin D3 content at 1120, 3950 and 16600 IU/kg were designed for juvenile Pelteobagrus fulvidraco. The growth trial was carried out over a 12-week period, following by an Edwardsiella ictaluri challenge experiment. Illumina high-throughput sequencing of head kidney and spleen after bacteria challenge identified differentially expressed miRNAs. The target genes of miR-194a was enriched in the JAK-STAT pathway. The relationship between miR-194a and the possible target genes jak2a and tyk2 had been verified by a dual luciferase reporter gene assay, which indicated the inhibitory role of miR-194a on jak2a and tyk2. In vitro, miR-194a was also found to respond with different concentrations of vitamin D3, inhibiting the expression of the target genes of jak2a and tyk2. With the activation of the JAK-STAT signaling pathway, the expression of anti-inflammatory response (AIR) factors and the target genes were also activated, the NF-κB pathway was inhibited, with significant decrease in expression of pro-inflammatory factors IL-1β, IL-6 and TNF-α and the transformation of macrophages from M1-type to M2-type polarization was accelerated with the increasing of vitamin D3 concentration (P<0.05). In conclusion, the results of this study demonstrated that miR-194a could respond to different concentration of vitamin D3 in in vivo and in vitro experiments. Dietary vitamin D3 up-regulated the expression of miR-194a, which negatively regulated the target genes of jak2a and tyk2, and exerted indirect effects towards the downstream genes in the JAK-STAT pathway, illuminating the mechanism of miR-194a-mediated regulation of immune response by dietary vitamin D3 through the JAK-STAT signaling pathway in Pelteobagrus fulvidraco. The results of this study provide a further knowledge of the mechanisms about dietary vitamin D3 in the regulation of immunity for fish. Furthermore, this study also provides a theoretical basis for the application of nutritional and immunological methods to prevent fish diseases and reduce the disadvantages of residues and water pollution caused from the use of drugs in aquaculture production.
,
Available online
, doi: 10.7541/2022.2021.0314
Abstract:
In order to assess the current situation of fish resources in The Provincial Nature Reserve for Yangtze Cetacean of Zhenjiang, a simultaneous survey of fish resources was carried out in spring (April) and autumn (September) in 2020 by using hydroacoustic frequency difference technology and net survey method, and the temporal and spatial characteristics of fish resources in the surveyed river section were evaluated. Based on the analysis of fish echo image data of 200 and 333 kHz, the acoustic assessment of fish resources was carried out by frequency difference technique. The results of hydroacoustic survey showed that the average density of fish resources was (0.094±0.183) ind/m2, and the average target strength (TS) of fish was (–57.33±5.69) dB, mainly distributed in the range of –62.5 to –50.5 dB. In addition, TS increases with increasing water depth. The results of net survey showed that 758 fishes (53.53 kg) were collected in the river section and a total of 48species were identified, of which Cypriniformes dominated. The proportion of pelagic fish population quantity and mass was 36.15% and 66.12%, respectively. The proportion of the quantity and mass of fish (pelagic fish with body length less than 20 cm, body height less than 6 cm and body weight less than 100 g) fed on the Yangtze finless porpoise was 23.22% and 8.72%, respectively. In terms of time characteristics, there was no significant difference in fish resource density between April and September (P>0.05), and the average TS in April was smaller than that in September, and the average size of fish in April was smaller than that in September. In terms of spatial characteristics, the fish resources were mainly distributed in the waters near the north branch of He Changzhou and Jiaobei Beach, and the pelagic fish resources were relatively large, and the fish resources were more concentrated in April. Underwater acoustic frequency difference technology can effectively eliminate plankton signals and background noise signals in the water environment, which is of reference significance for fishery acoustic evaluation in the Yangtze River Basin. The results of this study can provide a scientific basis for the accurate assessment of the bait fish resources of the Yangtze finless porpoise in the reserve, support the conservation of the Yangtze finless porpoise in situ, and provide a scientific basis for the conservation of fish resources in the lower Reaches of the Yangtze River.
In order to assess the current situation of fish resources in The Provincial Nature Reserve for Yangtze Cetacean of Zhenjiang, a simultaneous survey of fish resources was carried out in spring (April) and autumn (September) in 2020 by using hydroacoustic frequency difference technology and net survey method, and the temporal and spatial characteristics of fish resources in the surveyed river section were evaluated. Based on the analysis of fish echo image data of 200 and 333 kHz, the acoustic assessment of fish resources was carried out by frequency difference technique. The results of hydroacoustic survey showed that the average density of fish resources was (0.094±0.183) ind/m2, and the average target strength (TS) of fish was (–57.33±5.69) dB, mainly distributed in the range of –62.5 to –50.5 dB. In addition, TS increases with increasing water depth. The results of net survey showed that 758 fishes (53.53 kg) were collected in the river section and a total of 48species were identified, of which Cypriniformes dominated. The proportion of pelagic fish population quantity and mass was 36.15% and 66.12%, respectively. The proportion of the quantity and mass of fish (pelagic fish with body length less than 20 cm, body height less than 6 cm and body weight less than 100 g) fed on the Yangtze finless porpoise was 23.22% and 8.72%, respectively. In terms of time characteristics, there was no significant difference in fish resource density between April and September (P>0.05), and the average TS in April was smaller than that in September, and the average size of fish in April was smaller than that in September. In terms of spatial characteristics, the fish resources were mainly distributed in the waters near the north branch of He Changzhou and Jiaobei Beach, and the pelagic fish resources were relatively large, and the fish resources were more concentrated in April. Underwater acoustic frequency difference technology can effectively eliminate plankton signals and background noise signals in the water environment, which is of reference significance for fishery acoustic evaluation in the Yangtze River Basin. The results of this study can provide a scientific basis for the accurate assessment of the bait fish resources of the Yangtze finless porpoise in the reserve, support the conservation of the Yangtze finless porpoise in situ, and provide a scientific basis for the conservation of fish resources in the lower Reaches of the Yangtze River.
,
Available online
, doi: 10.7541/2022.2021.0261
Abstract:
Ammonia nitrogen, as one of the main pollutants, have toxicity to organisms under high concentration in aquatic ecosystem. It has been widely reported about the negative impacts of ammonia on the behavior, growth and reproduction of organisms. However, the previous studies were mainly focused on fish, rarely studies were conducted with zoobenthos and limited to small scale experiments. To explore the toxicity of ammonia on zoobenthos, we conducted a one-year semi-natural experiment in 6 ponds (ca. 600 m2 in surface area; ca. 1.5 m in depth) located in Hubei Province and analyzed the difference of zoobenthos (mollusc) community under 6 ammonia concentrations (N25>N20>N15>N10>N5>N0 (control; 0.2—33.7 mg/L). The result showed that: (1) the mollusc identified during the experiment was mainly Bellamya aeruginosa; (2) N0, N5, N10 and N15 treatments had similar B. aeruginosa density [28(0—85) ind./m2], which were significantly higher than that in N20 and N25 treatments [5(0—29) ind./m2] (P<0.05); (3) N0, N5, N10, N15 and N20 treatments had similar B. aeruginosa biomass [40.0(0—85.5) g/m2], which were significantly lower than that in N25 treatment [0.8(0—4.0) g/m2] (P<0.05); (4) shell length, shell width and body mass of B. aeruginosa were the lowest in N0 treatment, while were the highest in N20 or N25 treatment; (5) B. aeruginosa density and biomass were negatively correlated with ammonia concentration significantly (P<0.05), and decreased with the increasing non-ionized ammonia concentration; (6) shell length, shell width and body mass of B. aeruginosa were positively correlated with non-ionized ammonia concentration significantly (P<0.05), and increased with the increasing non-ionized ammonia concentration. The results suggested that ammonia concentration higher than 21.7 mg/L and non-ionized ammonia concentration higher than 0.18 mg/L (annunal mean value in N15 treatment) had significantly negative impact on mollusc, especially for its reproduction, while no negative impact was found on the growth of individuals. More phytoplankton induced by ammonia loading may provide more food for mollusc which was advantageous for the accumulation of carbohydrate and help to detoxify the body. The shelter from sediments might have released B. aeruginosa from ammonia exposure as the non-ionized ammonia concentration was lower at the bottom layer near the water-sediment interface compared with that at the surface layer. This study could help to develop the understanding of ammonia toxicity to mollusc and may improve scientific basis for nitrogen management in aquatic ecosystems to a certain extent.
Ammonia nitrogen, as one of the main pollutants, have toxicity to organisms under high concentration in aquatic ecosystem. It has been widely reported about the negative impacts of ammonia on the behavior, growth and reproduction of organisms. However, the previous studies were mainly focused on fish, rarely studies were conducted with zoobenthos and limited to small scale experiments. To explore the toxicity of ammonia on zoobenthos, we conducted a one-year semi-natural experiment in 6 ponds (ca. 600 m2 in surface area; ca. 1.5 m in depth) located in Hubei Province and analyzed the difference of zoobenthos (mollusc) community under 6 ammonia concentrations (N25>N20>N15>N10>N5>N0 (control; 0.2—33.7 mg/L). The result showed that: (1) the mollusc identified during the experiment was mainly Bellamya aeruginosa; (2) N0, N5, N10 and N15 treatments had similar B. aeruginosa density [28(0—85) ind./m2], which were significantly higher than that in N20 and N25 treatments [5(0—29) ind./m2] (P<0.05); (3) N0, N5, N10, N15 and N20 treatments had similar B. aeruginosa biomass [40.0(0—85.5) g/m2], which were significantly lower than that in N25 treatment [0.8(0—4.0) g/m2] (P<0.05); (4) shell length, shell width and body mass of B. aeruginosa were the lowest in N0 treatment, while were the highest in N20 or N25 treatment; (5) B. aeruginosa density and biomass were negatively correlated with ammonia concentration significantly (P<0.05), and decreased with the increasing non-ionized ammonia concentration; (6) shell length, shell width and body mass of B. aeruginosa were positively correlated with non-ionized ammonia concentration significantly (P<0.05), and increased with the increasing non-ionized ammonia concentration. The results suggested that ammonia concentration higher than 21.7 mg/L and non-ionized ammonia concentration higher than 0.18 mg/L (annunal mean value in N15 treatment) had significantly negative impact on mollusc, especially for its reproduction, while no negative impact was found on the growth of individuals. More phytoplankton induced by ammonia loading may provide more food for mollusc which was advantageous for the accumulation of carbohydrate and help to detoxify the body. The shelter from sediments might have released B. aeruginosa from ammonia exposure as the non-ionized ammonia concentration was lower at the bottom layer near the water-sediment interface compared with that at the surface layer. This study could help to develop the understanding of ammonia toxicity to mollusc and may improve scientific basis for nitrogen management in aquatic ecosystems to a certain extent.
,
Available online
, doi: 10.7541/2023.2022.0259
Abstract:
For a long time, the phylogeny of Grapsoidea (Decapoda: Brachyura) has been controversial. Complete mitochondrial genome (mitogenome) provides important information for better understanding of gene rearrangement, molecular evolution and phylogenetic analysis. However, only a few mitogenomes of Grapsidae species have been reported and the phylogenetic status of Grapsidae within Grapsoidea remains unresolved. In order clarify the phylogenetic relationship of Grapsoidea and further explore the correlation between phygeny and mitogenome rearangement, the complete mitogenome of Grapsus albolineatus, the representative species of Grapsidae was sequenced. The total length of this mitogenome is 15577 bp, containing 13 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA genes and a control region. The nucleotide composition is shown as follows: 33.4% A, 12.0% G, 20.6% C, 34.0% T, respectively, with a high AT bias (67.4%). Majority protein-coding genes are initiated by the typical start codon ATN, with an exception GTG in ATP8 and ND1. Most of them terminate with TAN, while two genes (COII and Cyt b) use a single T as a stop codon. Leu (15.8%) and Cys (0.81%) are the most and least frequently used amino acid, respectively. Except for tRNA-Ser1, which lacks DHU arm, all tRNAs have the typical cloverleaf structure. The phylogenetic relationships among Grapsoidea were reconstructed based on nucleotide sequences of 13 PCGs using maximum likelihood (ML) and Bayesian (BI) methods. The phylogenetic trees obtained identical topological structures, which showed that all grapsid crabs clustered into a clade, and G. albolineatus shared the closest relationship with G. tenuicrustatus. Sesarmidae and Xenograpsidae clustered together, and then formed a sister group with Gecarcinidae, and finally form a sister group with Grapsidae. Varunidae formed a separate clade. A significant correlation between gene rearrangement and phylogeny was found in Grapsoidea for the first time. These findings will contribute to a better understanding of gene rearrangement and molecular evolution, as well as provide insights into the phylogenetic studies of Grapsoidea.
For a long time, the phylogeny of Grapsoidea (Decapoda: Brachyura) has been controversial. Complete mitochondrial genome (mitogenome) provides important information for better understanding of gene rearrangement, molecular evolution and phylogenetic analysis. However, only a few mitogenomes of Grapsidae species have been reported and the phylogenetic status of Grapsidae within Grapsoidea remains unresolved. In order clarify the phylogenetic relationship of Grapsoidea and further explore the correlation between phygeny and mitogenome rearangement, the complete mitogenome of Grapsus albolineatus, the representative species of Grapsidae was sequenced. The total length of this mitogenome is 15577 bp, containing 13 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA genes and a control region. The nucleotide composition is shown as follows: 33.4% A, 12.0% G, 20.6% C, 34.0% T, respectively, with a high AT bias (67.4%). Majority protein-coding genes are initiated by the typical start codon ATN, with an exception GTG in ATP8 and ND1. Most of them terminate with TAN, while two genes (COII and Cyt b) use a single T as a stop codon. Leu (15.8%) and Cys (0.81%) are the most and least frequently used amino acid, respectively. Except for tRNA-Ser1, which lacks DHU arm, all tRNAs have the typical cloverleaf structure. The phylogenetic relationships among Grapsoidea were reconstructed based on nucleotide sequences of 13 PCGs using maximum likelihood (ML) and Bayesian (BI) methods. The phylogenetic trees obtained identical topological structures, which showed that all grapsid crabs clustered into a clade, and G. albolineatus shared the closest relationship with G. tenuicrustatus. Sesarmidae and Xenograpsidae clustered together, and then formed a sister group with Gecarcinidae, and finally form a sister group with Grapsidae. Varunidae formed a separate clade. A significant correlation between gene rearrangement and phylogeny was found in Grapsoidea for the first time. These findings will contribute to a better understanding of gene rearrangement and molecular evolution, as well as provide insights into the phylogenetic studies of Grapsoidea.
,
Available online
, doi: 10.7541/2022.2021.0329
Abstract:
With the growing seriousness of surface freshwater eutrophication, many lakes, reservoirs and rivers occur cyanobacterial or algal blooms including Taihu Lake, Dianchi and Chaohu Lake, in China. Nitrogen and phosphorus are limiting and vital macronutrients to maintain the growth of cyanobacteria, and monitoring their changes is fundamental to lake management. Cyanobacterial cells normally have high protein contents which are inevitable to contribute a lot to total nitrogen (TN) in the bloom water body. The relationship of TN and phytoplankton chlorophyll a (Chl. a) was reported in some researches, however, among the researches, some TN may be underestimated due to measurement errors in bloom occurring water bodies. Alkaline potassium persulfate digestion-UV spectrophotometry method with simple operation, good accuracy and reliability is widely used for water quality determination for TN. The prerequisite for using the method is that the nitrogenous compounds (including organic nitrogen) in the sample must be completely oxidized to nitrate. A high concentration of organic matter often leads to underestimated TN in water samples and there is a high density of organic particles, cyanobacterial cells, in the cyanobacterial bloom occurring waterbody. The organic nitrogen in cyanobacterial cells (mainly proteins, phycocyanin, etc.) may be difficult to be completely degraded, which should result in the underestimation of TN. However, there is no detailed study on TN determination of bloom water containing high-density algal cells using the alkaline potassium persulfate digestion-UV spectrophotometry method. In this study, the TN values of water samples from Taihu Lake were measured by the alkaline potassium persulfate digestion-UV spectrophotometry method. The results showed that the TN concentrations were underestimated by directly measuring the field water samples, although the TN levels were within the allowable concentration range of the standard method (<7.0 mg/L, HJ636-2012). In order to explore the effect of cell densities on the determination of TN, three cyanobacteria (unicellular strain Microcystis aeruginosa PCC7806, colonial strain M. aeruginosa XW01 and Anabaena sp. PCC7120) and a green alga (Chlorella ellipsoidea QZ) were cultured in the laboratory, and TN values of the cyanobacterial and green algal species with different dilution gradients were measured. The results showed that the TN values of high-density cells were significantly underestimated. The greater the dilution, the higher the measured TN value, and the measured TN value became stable only after dilution to a certain extent. The density of algal cells must be less than 108/L in order to meet the requirements of accurate determination of TN. During the digestion of organic matter, proteins are usually difficult to degrade. We used glycine and casein to verify the effect of protein concentration on TN determination. The results showed when the TN concentration of glycine solution was less than 4 mg/L, the measured TN was consistent with the theoretical data, however, at a higher concentration, the TN would be underestimated. Similar results were obtained for casein. The recovery of casein TN was about 90% at a low concentration of 2 mg/L TN, while at a high concentration of 8 mg/L TN, the measured TN value was underestimated by about 40%. The results indicated that alkaline potassium persulfate could hardly disintegrate proteins and amino acids completely in cyanobacterial blooms with high cell density, resulting in the underestimation of TN. To estimate the TN situation in the Microcystis blooms, we measured several samples from Taihu Lake and other water bodies with Microcystis blooms. Comparing the value obtained from the direct determination of the original water sample with the measured value of the water sample diluted 10—30 times, the results showed that the TN value directly determined is underestimated by 26.59%—40.42%. The results were consistent with the data from laboratory samples. Our tests demonstrated that sufficient dilution is necessary for the TN measuring of cyanobacterial blooms. To estimate the contribution of Microcystis biomass to TN, the TN and Chl. a in four samples collected from Taihu Lake during water blooms were measured. As a result, the lowest TN content was 0.12 mg N/μg Chl. a, the highest was 0.18 mg N/μg Chl. a, and the mean value was 0.15 mg N/μg Chl. a (Spiked recovery rate was 98.84%—109.39%). To estimate nitrogen content in the biomass of Microcystis blooms, we measured the nitrogen content of blooms samples filtered from Lake Taihu, the average nitrogen content of dry Microcystis blooms was about 16%, higher than normal nitrogen content in bacteria (12%—15%). The reason for this result may be that the cyanobacteria contain many nitrogen-rich substances such as protein, nucleic acid, phycocyanin, etc. These data should be useful for the ecological research of and the control of Microcystis blooms.
With the growing seriousness of surface freshwater eutrophication, many lakes, reservoirs and rivers occur cyanobacterial or algal blooms including Taihu Lake, Dianchi and Chaohu Lake, in China. Nitrogen and phosphorus are limiting and vital macronutrients to maintain the growth of cyanobacteria, and monitoring their changes is fundamental to lake management. Cyanobacterial cells normally have high protein contents which are inevitable to contribute a lot to total nitrogen (TN) in the bloom water body. The relationship of TN and phytoplankton chlorophyll a (Chl. a) was reported in some researches, however, among the researches, some TN may be underestimated due to measurement errors in bloom occurring water bodies. Alkaline potassium persulfate digestion-UV spectrophotometry method with simple operation, good accuracy and reliability is widely used for water quality determination for TN. The prerequisite for using the method is that the nitrogenous compounds (including organic nitrogen) in the sample must be completely oxidized to nitrate. A high concentration of organic matter often leads to underestimated TN in water samples and there is a high density of organic particles, cyanobacterial cells, in the cyanobacterial bloom occurring waterbody. The organic nitrogen in cyanobacterial cells (mainly proteins, phycocyanin, etc.) may be difficult to be completely degraded, which should result in the underestimation of TN. However, there is no detailed study on TN determination of bloom water containing high-density algal cells using the alkaline potassium persulfate digestion-UV spectrophotometry method. In this study, the TN values of water samples from Taihu Lake were measured by the alkaline potassium persulfate digestion-UV spectrophotometry method. The results showed that the TN concentrations were underestimated by directly measuring the field water samples, although the TN levels were within the allowable concentration range of the standard method (<7.0 mg/L, HJ636-2012). In order to explore the effect of cell densities on the determination of TN, three cyanobacteria (unicellular strain Microcystis aeruginosa PCC7806, colonial strain M. aeruginosa XW01 and Anabaena sp. PCC7120) and a green alga (Chlorella ellipsoidea QZ) were cultured in the laboratory, and TN values of the cyanobacterial and green algal species with different dilution gradients were measured. The results showed that the TN values of high-density cells were significantly underestimated. The greater the dilution, the higher the measured TN value, and the measured TN value became stable only after dilution to a certain extent. The density of algal cells must be less than 108/L in order to meet the requirements of accurate determination of TN. During the digestion of organic matter, proteins are usually difficult to degrade. We used glycine and casein to verify the effect of protein concentration on TN determination. The results showed when the TN concentration of glycine solution was less than 4 mg/L, the measured TN was consistent with the theoretical data, however, at a higher concentration, the TN would be underestimated. Similar results were obtained for casein. The recovery of casein TN was about 90% at a low concentration of 2 mg/L TN, while at a high concentration of 8 mg/L TN, the measured TN value was underestimated by about 40%. The results indicated that alkaline potassium persulfate could hardly disintegrate proteins and amino acids completely in cyanobacterial blooms with high cell density, resulting in the underestimation of TN. To estimate the TN situation in the Microcystis blooms, we measured several samples from Taihu Lake and other water bodies with Microcystis blooms. Comparing the value obtained from the direct determination of the original water sample with the measured value of the water sample diluted 10—30 times, the results showed that the TN value directly determined is underestimated by 26.59%—40.42%. The results were consistent with the data from laboratory samples. Our tests demonstrated that sufficient dilution is necessary for the TN measuring of cyanobacterial blooms. To estimate the contribution of Microcystis biomass to TN, the TN and Chl. a in four samples collected from Taihu Lake during water blooms were measured. As a result, the lowest TN content was 0.12 mg N/μg Chl. a, the highest was 0.18 mg N/μg Chl. a, and the mean value was 0.15 mg N/μg Chl. a (Spiked recovery rate was 98.84%—109.39%). To estimate nitrogen content in the biomass of Microcystis blooms, we measured the nitrogen content of blooms samples filtered from Lake Taihu, the average nitrogen content of dry Microcystis blooms was about 16%, higher than normal nitrogen content in bacteria (12%—15%). The reason for this result may be that the cyanobacteria contain many nitrogen-rich substances such as protein, nucleic acid, phycocyanin, etc. These data should be useful for the ecological research of and the control of Microcystis blooms.
,
Available online
, doi: 10.7541/2022.2021.0297
Abstract:
Microcystis blooms are common in eutrophic water bodies in China. Some Microcystis species can produce microcystins (MCS), which pose a serious threat to the safety of humans and ecosystems. The anionic surfactant linear alkylbenzene sulfonate (LAS), as a kind of widespread organic pollutant in eutrophic water bodies, its potential effects on the succession of toxic and non-toxic Microcystis and its influence on the toxicity of toxic Microcystis are often ignored. The effects of different LAS concentrations (0, 0.05, 0.2, 0.5, 1.0 and 5.0 mg/L) on the growth, photosynthetic characteristics, interspecific competition and toxin synthesis of toxic Microcystis aeruginosa and non-toxic Microcystis wesenbergii were studied in the present study. The results showed that the biomass, mcyD expression and MCs content of the toxic Microcystis increased significantly after 12 days of culture at 0.05—5.0 mg/L LAS. The concentrations of intracellular and extracellular MCs in toxic Microcystis were 0.069, 0.052, 0.061, 0.038, 0.037 fg/fg chl-a and 107.1, 103.7, 127.1, 99.6 and 113.7 ng/L, respectively. 0—0.2 mg/L LAS had no significant effect on the biomass of Microcystis wesenbergii, while a higher concentration of LAS (0.5—5.0 mg/L) significantly inhibited the growth of non-toxic Microcystis wesenbergii. When two Microcystis strains were co-cultured, the expression of mcyD in Microcystis aeruginosa responded quickly to LAS, the proportion of toxic Microcystis aeruginosa in the total Microcystis up to 60%—80%. But the synthesis and release of MCs were slow. A large number of MCs were synthesized and released after 12 days of co-culture. The intracellular MCs content was 0.098, 0.184, 0.201, 0.216, 0.168 and 0.241 fg/fg chl-a, respectively. In general, this research showed that LAS could promote the growth and toxin synthesis of toxic Microcystis. Therefore, the potential role of LAS pollution on the dominance formation of toxic Microcystis and toxin of blooms in eutrophic water can not be ignored.
Microcystis blooms are common in eutrophic water bodies in China. Some Microcystis species can produce microcystins (MCS), which pose a serious threat to the safety of humans and ecosystems. The anionic surfactant linear alkylbenzene sulfonate (LAS), as a kind of widespread organic pollutant in eutrophic water bodies, its potential effects on the succession of toxic and non-toxic Microcystis and its influence on the toxicity of toxic Microcystis are often ignored. The effects of different LAS concentrations (0, 0.05, 0.2, 0.5, 1.0 and 5.0 mg/L) on the growth, photosynthetic characteristics, interspecific competition and toxin synthesis of toxic Microcystis aeruginosa and non-toxic Microcystis wesenbergii were studied in the present study. The results showed that the biomass, mcyD expression and MCs content of the toxic Microcystis increased significantly after 12 days of culture at 0.05—5.0 mg/L LAS. The concentrations of intracellular and extracellular MCs in toxic Microcystis were 0.069, 0.052, 0.061, 0.038, 0.037 fg/fg chl-a and 107.1, 103.7, 127.1, 99.6 and 113.7 ng/L, respectively. 0—0.2 mg/L LAS had no significant effect on the biomass of Microcystis wesenbergii, while a higher concentration of LAS (0.5—5.0 mg/L) significantly inhibited the growth of non-toxic Microcystis wesenbergii. When two Microcystis strains were co-cultured, the expression of mcyD in Microcystis aeruginosa responded quickly to LAS, the proportion of toxic Microcystis aeruginosa in the total Microcystis up to 60%—80%. But the synthesis and release of MCs were slow. A large number of MCs were synthesized and released after 12 days of co-culture. The intracellular MCs content was 0.098, 0.184, 0.201, 0.216, 0.168 and 0.241 fg/fg chl-a, respectively. In general, this research showed that LAS could promote the growth and toxin synthesis of toxic Microcystis. Therefore, the potential role of LAS pollution on the dominance formation of toxic Microcystis and toxin of blooms in eutrophic water can not be ignored.
,
Available online
, doi: 10.7541/2023.2022.0276
Abstract:
The tiger puffer, Takifugu rubripes, which distribute in the East China sea, Yellow sea and Bohai sea, is an important fish species in aquaculture and stock enhancement in China. Due to the higher fishing pressure, catches of wild tiger puffer decreased significantly in the late 1980s. Aquaculture-based fisheries enhancement involves the release of cultured organisms to enhance, conserve, or restore fisheries. To restore the stock of tiger puffer, China, Korea and Japan began to release this species. High mortalities in stock enhancement have been found in many species after release due to predation and starvation. Swimming ability directly affects the capacity of finding food, escaping from predators, maintaining position, schooling and migration in released fish. In this study, we investigated the effects of body mass and starvation on the swimming ability of juvenile tiger puffer. The critical swimming speed (Ucrit, cm/s), preferred swimming speed (Upref, cm/s), percentage of accumulated time (Pt, %) under six flow velocities (2—36 cm/s), average flow velocity of preferred zone (Vmean, cm/s) and total swimming distance (D1h, m) of juvenile tiger puffer was determined under different body mass (0.22—3.31 g) and starvation days (1, 3, 6 and 9d). Body mass and starvation significantly affected the Ucrit, Pt, Vmean and D1h of juvenile tiger puffer. The Ucrit, Upref, Vmean and D1h increased from 10.17 cm/s, 2—5 cm/s, 3.79 cm/s and 139.06 m to 17.13 cm/s, 13—26 cm/s, 16.51 cm/s and 580.03 m, respectively, as the body mass increased, whereas the relative Ucrit (Ucrit’, body length/s, BL/s) decreased from 5.83 to 3.56 BL/s. The relationship between body mass and Ucrit, Ucrit’, Pt, Vmean and D1h can be described by the quadratic model. The Ucrit, Ucrit’, Upref, Vmean and D1h decreased from 16.47 cm/s, 3.38 BL/s, 13—26 cm/s, 15.45 cm/s and 566.18 m to 10.03 cm/s, 1.98 BL/s, 2 cm/s, 2.83 cm/s and 119.74 m, respectively, as the starvation day increased. The relationship between starvation day and Ucrit, Ucrit’, Pt, Vmean and D1h can be described by the quadratic model. The Ucrit increased as the body mass increased, which might be due to the increase in muscle mass and efficiency, available energy stores and metabolic capacity with size. Compared to larger conspecifics, the cardiorespiratory system of small fish is more efficient because they have relatively larger respiratory and circulatory organs. The maximum metabolic rate (MMR) decreased as the body mass increased in fish, which might lead to the decrease in Ucrit’. The stronger the swimming ability of the released fish, the higher the survival rate. As the swimming ability of juvenile tiger puffer increased with the body mass, we suggested that the release size should above 5 cm. In order to prevent the released tiger puffer from being flushed away by the current or swimming against the current constantly, the current velocity of the releasing area should below 20 cm/s. The swimming ability of juvenile tiger puffer decreased with the starvation days, which might be due to the decrease in muscle enzyme activity, metabolic capacity and available energy for swimming under starvation. The reduction in the swimming ability might weaken the predation and anti-predation capacity of the released tiger puffer. Results can be of value in understanding ecological processes and improving the stock enhancement of tiger puffer.
The tiger puffer, Takifugu rubripes, which distribute in the East China sea, Yellow sea and Bohai sea, is an important fish species in aquaculture and stock enhancement in China. Due to the higher fishing pressure, catches of wild tiger puffer decreased significantly in the late 1980s. Aquaculture-based fisheries enhancement involves the release of cultured organisms to enhance, conserve, or restore fisheries. To restore the stock of tiger puffer, China, Korea and Japan began to release this species. High mortalities in stock enhancement have been found in many species after release due to predation and starvation. Swimming ability directly affects the capacity of finding food, escaping from predators, maintaining position, schooling and migration in released fish. In this study, we investigated the effects of body mass and starvation on the swimming ability of juvenile tiger puffer. The critical swimming speed (Ucrit, cm/s), preferred swimming speed (Upref, cm/s), percentage of accumulated time (Pt, %) under six flow velocities (2—36 cm/s), average flow velocity of preferred zone (Vmean, cm/s) and total swimming distance (D1h, m) of juvenile tiger puffer was determined under different body mass (0.22—3.31 g) and starvation days (1, 3, 6 and 9d). Body mass and starvation significantly affected the Ucrit, Pt, Vmean and D1h of juvenile tiger puffer. The Ucrit, Upref, Vmean and D1h increased from 10.17 cm/s, 2—5 cm/s, 3.79 cm/s and 139.06 m to 17.13 cm/s, 13—26 cm/s, 16.51 cm/s and 580.03 m, respectively, as the body mass increased, whereas the relative Ucrit (Ucrit’, body length/s, BL/s) decreased from 5.83 to 3.56 BL/s. The relationship between body mass and Ucrit, Ucrit’, Pt, Vmean and D1h can be described by the quadratic model. The Ucrit, Ucrit’, Upref, Vmean and D1h decreased from 16.47 cm/s, 3.38 BL/s, 13—26 cm/s, 15.45 cm/s and 566.18 m to 10.03 cm/s, 1.98 BL/s, 2 cm/s, 2.83 cm/s and 119.74 m, respectively, as the starvation day increased. The relationship between starvation day and Ucrit, Ucrit’, Pt, Vmean and D1h can be described by the quadratic model. The Ucrit increased as the body mass increased, which might be due to the increase in muscle mass and efficiency, available energy stores and metabolic capacity with size. Compared to larger conspecifics, the cardiorespiratory system of small fish is more efficient because they have relatively larger respiratory and circulatory organs. The maximum metabolic rate (MMR) decreased as the body mass increased in fish, which might lead to the decrease in Ucrit’. The stronger the swimming ability of the released fish, the higher the survival rate. As the swimming ability of juvenile tiger puffer increased with the body mass, we suggested that the release size should above 5 cm. In order to prevent the released tiger puffer from being flushed away by the current or swimming against the current constantly, the current velocity of the releasing area should below 20 cm/s. The swimming ability of juvenile tiger puffer decreased with the starvation days, which might be due to the decrease in muscle enzyme activity, metabolic capacity and available energy for swimming under starvation. The reduction in the swimming ability might weaken the predation and anti-predation capacity of the released tiger puffer. Results can be of value in understanding ecological processes and improving the stock enhancement of tiger puffer.
,
Available online
, doi: 10.7541/2023.2022.0251
Abstract:
The safe disposal of domestic sewage has posed a serious threat to the safety of drinking water sources. Microalgae have remarkable effects on the advanced treatment of domestic sewage, but the sewage has strong inhibitory effects on algae. Nanoparticles have a positive regulatory effect on the growth of microalgae. Therefore, exploring the appropriate nano materials and adding methods, and studying their effects on the treatment of domestic sewage by microalgae are meaningful. In this study, titanate nano materials (TNTs) and microalgae were synergistically used to purify domestic sewage. Different addition methods of TNTS were set up to treat domestic sewage together with five microalgae. The photochemical efficiency of chlorophyⅡ and photosynthetic pigment using different algae species and treatment methods were compared. The superior algae species and efficient treatment methods were screened. The results showed that TNTs could significantly enhance the treatment effect of microalgae on domestic sewage. After the addition of TNTs, microalgae cells all showed aggregation, and the contents of chlorophyll a and carotenoids increased. Inoculation of after Microalgae had the best effect on domestic sewage treatment after TNTs mediated two days later. T. obliquus, T. obliquus, C. vulgaris, and Quadricauda sp. had the highest removal rates of COD, NH3-N, TN, and TP (95.00%, 88.62%, 83.14% and 79.43%), respectively. Compared with microalgae alone, the addition of TNTs significantly increased the degradation rate of pollutants (>10%) and the removal rate from microalgae (>5%). TNTs has a certain application prospect in microalgae advanced treatment of domestic sewage.
The safe disposal of domestic sewage has posed a serious threat to the safety of drinking water sources. Microalgae have remarkable effects on the advanced treatment of domestic sewage, but the sewage has strong inhibitory effects on algae. Nanoparticles have a positive regulatory effect on the growth of microalgae. Therefore, exploring the appropriate nano materials and adding methods, and studying their effects on the treatment of domestic sewage by microalgae are meaningful. In this study, titanate nano materials (TNTs) and microalgae were synergistically used to purify domestic sewage. Different addition methods of TNTS were set up to treat domestic sewage together with five microalgae. The photochemical efficiency of chlorophyⅡ and photosynthetic pigment using different algae species and treatment methods were compared. The superior algae species and efficient treatment methods were screened. The results showed that TNTs could significantly enhance the treatment effect of microalgae on domestic sewage. After the addition of TNTs, microalgae cells all showed aggregation, and the contents of chlorophyll a and carotenoids increased. Inoculation of after Microalgae had the best effect on domestic sewage treatment after TNTs mediated two days later. T. obliquus, T. obliquus, C. vulgaris, and Quadricauda sp. had the highest removal rates of COD, NH3-N, TN, and TP (95.00%, 88.62%, 83.14% and 79.43%), respectively. Compared with microalgae alone, the addition of TNTs significantly increased the degradation rate of pollutants (>10%) and the removal rate from microalgae (>5%). TNTs has a certain application prospect in microalgae advanced treatment of domestic sewage.
,
Available online
, doi: 10.7541/2023.2022.0195
Abstract:
In order to explore the role of Isthmin-1 (Ism-1) in glucose and lipid metabolism of grass carp, this study cloned the open reading frame (ORF) of Ism-1 by RT-PCR, and the sequence was analyzed by bioinformatics technology. The distribution characteristics of Ism-1 in different tissues of grass carp were detected by RT-qPCR, and the expression of Ism-1 under different nutritional conditions were analyzed in vitro and in vivo. In this study, ORF region of Ism-1 was successfully cloned. Sequence analysis showed that the ORF region of Ism-1 was 1380 bp, encoding 459 amino acids, and the relative molecular weight of protein was 50.96 kD. Amino acid multiple sequence alignment and phylogenetic tree analysis showed that the evolutionary relationship of Ism-1 between grass carp and fathead minnow was the closest (amino acid similarity was up to 96.51%). Ism-1 was widely expressed in multiple tissues, and had higher expression in red muscle, next are gill, brain and white muscle of grass carp. The fasting and refeeding experiment indicated the expression of Ism-1 in hepatopancreas was significantly upregulated after 14 days of starvation treatment (P<0.05), and the expression decreased after refeeding, but was still significantly higher than that of control group (P<0.05). The expression of Ism-1 in white muscle was significantly up-regulated after starvation and refeeding (P<0.05). The results of intraperitoneal injection of glucagon experiment eventuated that the expression of Ism-1 in hepatopancreas was significantly downregulated compared with control group (P<0.05). In addition, the expression of Ism-1 was significantly decreased (P<0.001) in hepatocyte after treatment with 80 μg/mL oleic acid for 24h. Overall, this research confirmed Ism-1 may be involved in the regulation of glucose and lipid metabolism of grass carp, which would provide essential data for the following study of the function of Ism-1.
In order to explore the role of Isthmin-1 (Ism-1) in glucose and lipid metabolism of grass carp, this study cloned the open reading frame (ORF) of Ism-1 by RT-PCR, and the sequence was analyzed by bioinformatics technology. The distribution characteristics of Ism-1 in different tissues of grass carp were detected by RT-qPCR, and the expression of Ism-1 under different nutritional conditions were analyzed in vitro and in vivo. In this study, ORF region of Ism-1 was successfully cloned. Sequence analysis showed that the ORF region of Ism-1 was 1380 bp, encoding 459 amino acids, and the relative molecular weight of protein was 50.96 kD. Amino acid multiple sequence alignment and phylogenetic tree analysis showed that the evolutionary relationship of Ism-1 between grass carp and fathead minnow was the closest (amino acid similarity was up to 96.51%). Ism-1 was widely expressed in multiple tissues, and had higher expression in red muscle, next are gill, brain and white muscle of grass carp. The fasting and refeeding experiment indicated the expression of Ism-1 in hepatopancreas was significantly upregulated after 14 days of starvation treatment (P<0.05), and the expression decreased after refeeding, but was still significantly higher than that of control group (P<0.05). The expression of Ism-1 in white muscle was significantly up-regulated after starvation and refeeding (P<0.05). The results of intraperitoneal injection of glucagon experiment eventuated that the expression of Ism-1 in hepatopancreas was significantly downregulated compared with control group (P<0.05). In addition, the expression of Ism-1 was significantly decreased (P<0.001) in hepatocyte after treatment with 80 μg/mL oleic acid for 24h. Overall, this research confirmed Ism-1 may be involved in the regulation of glucose and lipid metabolism of grass carp, which would provide essential data for the following study of the function of Ism-1.
,
Available online
, doi: 10.7541/2023.2022.0234
Abstract:
To further study the molecular characteristics and functions of complement activation regulators in teleost fish, this study cloned the CD46 gene of rainbow trout (Oncorhynchus mykiss) and analyzed its molecular characteristics systematically. The results showed that the CD46 gene of rainbow trout was composed of 10 exons and 9 introns; the cDNA sequence of CD46 was 2812 bp and encoded 317 amino acids; the protein sequence of CD46 was composed of 1signal peptide, 4 SCR domains, 1 transmembrane region and 1 intracellular region; and the predicted molecular weight of CD46 was 33.9 kD. Synteny analyses showed that the rainbow trout CD46 gene was located on chromosome 16, and its gene locus had conserved synteny in vertebrates. The expression analyses showed that the rainbow trout CD46 gene was expressed in various tissues and leukocyte subpopulations. To further clarify the immune function of rainbow trout CD46, the GST protein and the fusion protein GST-CD46 were prokaryotically expressed and purified. The experiment of hemolytic activity showed that, compared with GST, GST-CD46 could significantly inhibit the hemolytic activity of rainbow trout serum to rabbit erythrocytes in a dose-dependent manner, indicating that rainbow trout CD46 is a regulator of complement activation. In addition, GFP or GFP-CD46 were overexpressed in HEK293T cells. The experiment of cell damage showed that, compared with GFP, GFP-CD46 could significantly inhibit the damage of rainbow trout serum to HEK293T cells, further indicating that rainbow trout CD46 is a regulator of complement activation and can protect cells from the damage of complement system. In conclusion, this study not only increased the knowledge of the molecular characteristics and regulatory function of rainbow trout CD46, but also provided a theoretical basis for the in-depth study of the immune function of this molecule and its application in disease resistance.
To further study the molecular characteristics and functions of complement activation regulators in teleost fish, this study cloned the CD46 gene of rainbow trout (Oncorhynchus mykiss) and analyzed its molecular characteristics systematically. The results showed that the CD46 gene of rainbow trout was composed of 10 exons and 9 introns; the cDNA sequence of CD46 was 2812 bp and encoded 317 amino acids; the protein sequence of CD46 was composed of 1signal peptide, 4 SCR domains, 1 transmembrane region and 1 intracellular region; and the predicted molecular weight of CD46 was 33.9 kD. Synteny analyses showed that the rainbow trout CD46 gene was located on chromosome 16, and its gene locus had conserved synteny in vertebrates. The expression analyses showed that the rainbow trout CD46 gene was expressed in various tissues and leukocyte subpopulations. To further clarify the immune function of rainbow trout CD46, the GST protein and the fusion protein GST-CD46 were prokaryotically expressed and purified. The experiment of hemolytic activity showed that, compared with GST, GST-CD46 could significantly inhibit the hemolytic activity of rainbow trout serum to rabbit erythrocytes in a dose-dependent manner, indicating that rainbow trout CD46 is a regulator of complement activation. In addition, GFP or GFP-CD46 were overexpressed in HEK293T cells. The experiment of cell damage showed that, compared with GFP, GFP-CD46 could significantly inhibit the damage of rainbow trout serum to HEK293T cells, further indicating that rainbow trout CD46 is a regulator of complement activation and can protect cells from the damage of complement system. In conclusion, this study not only increased the knowledge of the molecular characteristics and regulatory function of rainbow trout CD46, but also provided a theoretical basis for the in-depth study of the immune function of this molecule and its application in disease resistance.
,
Available online
, doi: 10.7541/2022.2021.0300
Abstract:
In the middle-lower reach of the Yangtze River, there are many lakes with intensive fish biodiversity, which are connected with the Yangtze mainstream historically. Since the 1950s, most of these lakes have experienced river-lake disconnection by anthropogenic impacts, leading to remarkable biodiversity decline of fish in these lakes. Based on the published literatures about fish assemblages in lakes, the taxonomic distinctness and temporal changes of fish communities in the connected lakes and disconnected lakes were examined by using two widely used taxonomic diversity indices (average taxonomic distinctness, Δ+ and variation in taxonomic distinctness, Λ+), to assess the impact of river-lake disconnection. The results indicated that disconnected lakes showed significantly lower species richness and Δ+ values (average values 48.47±14.64 and 74.02±3.093, respectively) than connected lakes (average values 76.22±14.40 and 78.31±0.98, respectively; P<0.001), indicating the loss of fish diversity. On the contrary, the disconnected lakes showed significantly higher Λ+ values (average values 736.89±33.80) than connected lakes (average values 697.31±25.53; P=0.002), indicating the increasing unevenness of taxonomic distinctness. Our analysis of temporal changes showed that species richness and Δ+ generally declined, and Λ+ generally increased through time within representative connected and disconnected lakes. However, the species richness, Δ+ and Λ+ values of the connected lake fluctuated over time, and the Λ+ increased significantly over time. These mean that connected lakes were also affected by various disturbances, which led to the decline of taxonomic diversity and the distribution of fish in disconnected lakes was more concentrated in some taxa resulting high unevenness and low stability in the community. Based on our results, we suggested to restore the fish diversity in the middle and lower reaches of the Yangtze River by recovering the connection between the lakes and the Yangtze mainstream, improving the quality of fish habitat through water environment management, and scientifically adjusting the fish community structure.
In the middle-lower reach of the Yangtze River, there are many lakes with intensive fish biodiversity, which are connected with the Yangtze mainstream historically. Since the 1950s, most of these lakes have experienced river-lake disconnection by anthropogenic impacts, leading to remarkable biodiversity decline of fish in these lakes. Based on the published literatures about fish assemblages in lakes, the taxonomic distinctness and temporal changes of fish communities in the connected lakes and disconnected lakes were examined by using two widely used taxonomic diversity indices (average taxonomic distinctness, Δ+ and variation in taxonomic distinctness, Λ+), to assess the impact of river-lake disconnection. The results indicated that disconnected lakes showed significantly lower species richness and Δ+ values (average values 48.47±14.64 and 74.02±3.093, respectively) than connected lakes (average values 76.22±14.40 and 78.31±0.98, respectively; P<0.001), indicating the loss of fish diversity. On the contrary, the disconnected lakes showed significantly higher Λ+ values (average values 736.89±33.80) than connected lakes (average values 697.31±25.53; P=0.002), indicating the increasing unevenness of taxonomic distinctness. Our analysis of temporal changes showed that species richness and Δ+ generally declined, and Λ+ generally increased through time within representative connected and disconnected lakes. However, the species richness, Δ+ and Λ+ values of the connected lake fluctuated over time, and the Λ+ increased significantly over time. These mean that connected lakes were also affected by various disturbances, which led to the decline of taxonomic diversity and the distribution of fish in disconnected lakes was more concentrated in some taxa resulting high unevenness and low stability in the community. Based on our results, we suggested to restore the fish diversity in the middle and lower reaches of the Yangtze River by recovering the connection between the lakes and the Yangtze mainstream, improving the quality of fish habitat through water environment management, and scientifically adjusting the fish community structure.
,
Available online
, doi: 10.7541/2022.2021.0292
Abstract:
Thymallus arcticus grubei is only distributed in the Irtysh River basin in northern Xinjiang Uygur Autonomous Region in China. In recent years, due to overfishing and construction of water conservancy projects, its resources have declined sharply. It was listed as a second-level protected fish in Xinjiang Uygur Autonomous Region in 2004. This research carried out systematic observations on the embryonic development of artificially propagated Thymallus arcticus grubei, and recorded and analyzed the morphological characteristics of their embryos and larvae at various stages of development, aiming to provide necessary basic data for the breeding of Thymallus arcticus grubei and resource protection. The results showed that the fertilized eggs of Thymallus arcticus grubei were spherical, golden yellow, sinking eggs, unabsorbed eggs diameter (2.46±0.14) mm, water-absorbed eggs diameter (3.14±0.18) mm, and there were multiple oil droplets in the yolk. The number and spatial distribution of oil droplets changed regularly during embryonic development. Under the conditions of incubation water temperature (11.06±0.72)℃ and dissolved oxygen of 8.3—9.8 mg/L, it takes 301h to complete the entire embryonic development process, and the required accumulated temperature is 3384.84h·℃. There are 7stages, zygote, cleavage, blastula, gastrula, neurula, organ formation and hatching, totaling 26stages. The differentiation of caudal and pectoral fins and eye pigmentation of Thymallus arcticus grubei larvae have been completed in the late embryonic development of the fertilized egg, and the dorsal fin, pelvic fin, anal fin, adipose fin, etc. differentiated in the post-embryonic development process. The average length of the newly hatched larvae is (9.33±0.35) mm. The yolk sac and oil droplets are completely consumed at the age of 18 days. The growth characteristics of its early developmental stage (0—16 days old) conform to the formula: y=0.0005x4–0.0201x3+0.2264x2–0.3773x+9.6102 (R2=0.9968). This study preliminarily clarified the timing characteristics of the embryonic development and larval development of Thymallus arcticus grubei, and provided a theoretical basis for the future large-scale breeding of seedlings.
Thymallus arcticus grubei is only distributed in the Irtysh River basin in northern Xinjiang Uygur Autonomous Region in China. In recent years, due to overfishing and construction of water conservancy projects, its resources have declined sharply. It was listed as a second-level protected fish in Xinjiang Uygur Autonomous Region in 2004. This research carried out systematic observations on the embryonic development of artificially propagated Thymallus arcticus grubei, and recorded and analyzed the morphological characteristics of their embryos and larvae at various stages of development, aiming to provide necessary basic data for the breeding of Thymallus arcticus grubei and resource protection. The results showed that the fertilized eggs of Thymallus arcticus grubei were spherical, golden yellow, sinking eggs, unabsorbed eggs diameter (2.46±0.14) mm, water-absorbed eggs diameter (3.14±0.18) mm, and there were multiple oil droplets in the yolk. The number and spatial distribution of oil droplets changed regularly during embryonic development. Under the conditions of incubation water temperature (11.06±0.72)℃ and dissolved oxygen of 8.3—9.8 mg/L, it takes 301h to complete the entire embryonic development process, and the required accumulated temperature is 3384.84h·℃. There are 7stages, zygote, cleavage, blastula, gastrula, neurula, organ formation and hatching, totaling 26stages. The differentiation of caudal and pectoral fins and eye pigmentation of Thymallus arcticus grubei larvae have been completed in the late embryonic development of the fertilized egg, and the dorsal fin, pelvic fin, anal fin, adipose fin, etc. differentiated in the post-embryonic development process. The average length of the newly hatched larvae is (9.33±0.35) mm. The yolk sac and oil droplets are completely consumed at the age of 18 days. The growth characteristics of its early developmental stage (0—16 days old) conform to the formula: y=0.0005x4–0.0201x3+0.2264x2–0.3773x+9.6102 (R2=0.9968). This study preliminarily clarified the timing characteristics of the embryonic development and larval development of Thymallus arcticus grubei, and provided a theoretical basis for the future large-scale breeding of seedlings.
,
Available online
, doi: 10.7541/2023.2022.0239
Abstract:
Obscure puffer (Takifugu obscurus) is a euryhaline fugu species and belongs to the Family Tetraodontidae of teleost fish. In China, the Takifugu species is very popular because of its delicious taste and high nutrition, and it is widely farmed on a commercial scale. In recent years, the aquaculture area for obscure puffer is increasing year by year, however, the industry is confronted with many challenges, such as outbreak of diseases and overwintering culture. When winter comes, the growth and breeding of obscure puffer are affected by the environmental temperature. Furthermore, the dramatic decrease of water temperature in winter will cause mass mortality of obscure puffer, and then huge economic losses. Therefore, it is an urgent need for the further development of the industry to obtain low-temperature tolerance fish species through artificial breeding methods, and the premise of this work is to analyze the low-temperature tolerance mechanism of obscure puffer. To explore the response mechanism of obscure puffer to low temperature environment, we cloned the cDNA sequences of tolerance related genes CIRBP, HMGB1 and AFP-Ⅳ and then characterized their molecular features and potential functions. Real-time PCR analysis showed that CIRBP and HMGB1 were highly expressed in the hypothalamus, liver and muscle, while AFP-Ⅳ was mainly expressed in the liver. The obscure puffer was subjected to acute cold stress, then tissue samples were taken at different time periods. Real-time PCR analysis showed that the expression patterns of the above three genes were different in liver and hypothalamus. For example, the expression of CIRBP increased significantly at 48h in liver, while only slightly increased at 12h and 48h in hypothalamus. The expression of HMGB1 showed a gradual increase and reached the highest level at 48h in liver, while it first increased and then decreased in hypothalamus tissue. It reached the maximum at 2h after treatment, decreased at 2—8h, and reached the lowest at 8h, then recovered to the initial level. The expression of AFP-Ⅳ in liver showed no significant change from 0 to 24h, but increased to the maximum at 48h. The antifreeze role of AFP-Ⅳ was further investigated by heterologous expression in Escherichia coli. It was found that the expression of AFP-Ⅳ in E.coli exerted antifreeze effect at -80℃, and the antifreeze activity became apparent with the increase of the concentration of AFP-Ⅳ. Collectively, the results showed that the three genes were involved in the response to low temperature stress, which laid a foundation for further exploring the mechanism of low temperature tolerance in obscure puffer.
Obscure puffer (Takifugu obscurus) is a euryhaline fugu species and belongs to the Family Tetraodontidae of teleost fish. In China, the Takifugu species is very popular because of its delicious taste and high nutrition, and it is widely farmed on a commercial scale. In recent years, the aquaculture area for obscure puffer is increasing year by year, however, the industry is confronted with many challenges, such as outbreak of diseases and overwintering culture. When winter comes, the growth and breeding of obscure puffer are affected by the environmental temperature. Furthermore, the dramatic decrease of water temperature in winter will cause mass mortality of obscure puffer, and then huge economic losses. Therefore, it is an urgent need for the further development of the industry to obtain low-temperature tolerance fish species through artificial breeding methods, and the premise of this work is to analyze the low-temperature tolerance mechanism of obscure puffer. To explore the response mechanism of obscure puffer to low temperature environment, we cloned the cDNA sequences of tolerance related genes CIRBP, HMGB1 and AFP-Ⅳ and then characterized their molecular features and potential functions. Real-time PCR analysis showed that CIRBP and HMGB1 were highly expressed in the hypothalamus, liver and muscle, while AFP-Ⅳ was mainly expressed in the liver. The obscure puffer was subjected to acute cold stress, then tissue samples were taken at different time periods. Real-time PCR analysis showed that the expression patterns of the above three genes were different in liver and hypothalamus. For example, the expression of CIRBP increased significantly at 48h in liver, while only slightly increased at 12h and 48h in hypothalamus. The expression of HMGB1 showed a gradual increase and reached the highest level at 48h in liver, while it first increased and then decreased in hypothalamus tissue. It reached the maximum at 2h after treatment, decreased at 2—8h, and reached the lowest at 8h, then recovered to the initial level. The expression of AFP-Ⅳ in liver showed no significant change from 0 to 24h, but increased to the maximum at 48h. The antifreeze role of AFP-Ⅳ was further investigated by heterologous expression in Escherichia coli. It was found that the expression of AFP-Ⅳ in E.coli exerted antifreeze effect at -80℃, and the antifreeze activity became apparent with the increase of the concentration of AFP-Ⅳ. Collectively, the results showed that the three genes were involved in the response to low temperature stress, which laid a foundation for further exploring the mechanism of low temperature tolerance in obscure puffer.
,
Available online
, doi: 10.7541/2023.2022.0217
Abstract:
Microcystin is a class of cyclic hepatotoxin, which poses a great threat to human and animal health. Microcystin synthesis is regulated by a variety of environmental factors, and the synthesis efficiency of microcystin is directly determined by the amount of the corresponding synthetase and the catalytic rate. However, the relationship between protein expression levels of the microcystin synthesis gene cluster and environmental factors is still unclear. In this study, the mcyC and mcyI genes located in the two operons of the microcystin synthesis gene cluster were selected as representatives, using high-efficiency McyC and McyI polyclonal antibodies, detected the effect of iron stress on microcystin synthetase McyC and McyI protein expression levels by Western Blot. The result indicated that the protein levels of McyC and McyI within Microcystis aeruginosa PCC 7806 were consistent with the changes in the synthesis yield of toxins in vivo under iron stress, suggested that iron stress directly regulates the synthesis of the toxin by influencing the expression level of microcystin synthetase. This study provided the basis for further understanding the synthesis mechanism of microcystin.
Microcystin is a class of cyclic hepatotoxin, which poses a great threat to human and animal health. Microcystin synthesis is regulated by a variety of environmental factors, and the synthesis efficiency of microcystin is directly determined by the amount of the corresponding synthetase and the catalytic rate. However, the relationship between protein expression levels of the microcystin synthesis gene cluster and environmental factors is still unclear. In this study, the mcyC and mcyI genes located in the two operons of the microcystin synthesis gene cluster were selected as representatives, using high-efficiency McyC and McyI polyclonal antibodies, detected the effect of iron stress on microcystin synthetase McyC and McyI protein expression levels by Western Blot. The result indicated that the protein levels of McyC and McyI within Microcystis aeruginosa PCC 7806 were consistent with the changes in the synthesis yield of toxins in vivo under iron stress, suggested that iron stress directly regulates the synthesis of the toxin by influencing the expression level of microcystin synthetase. This study provided the basis for further understanding the synthesis mechanism of microcystin.
,
Available online
, doi: 10.7541/2023.2022.0269
Abstract:
Cyprinid herpesvirus 2 (CyHV-2) causes herpesviral haematopoietic necrosis, which is a serious threat to the health of the crucian carp farming industry. ORF66 is an immunogenic capsid protein of CyHV-2. To investigate the biological function of Cyprinid herpesvirus 2 during infection, a prokaryotic expression plasmid pET28a-tORF66 with ORF66 truncated gene was constructed based on a region with abundant antigenic table, transformed into BL21 receptor cells and then induced to express the protein using IPTG (Isopropyl-beta-D-thiogalactopyranoside) at 16℃. The lysed recombinant protein was obtained by urea lysis dialysis and then immunized in 6-week-old mice to prepare a murine anti-tORF66 polyclonal antibody. The solubilised recombinant proteins were screened for intercalating peptides by phage display techniques. The Western Blot assay showed that the antibody was able to recognize CyHV-2 in infected GICF cells with high potency and good specificity. The results of the phage elution showed by bioinformatics analysis that a peptide with the highest frequency of occurrence, N′-LHLHQNRMSLSR-C′, was obtained. The polypeptide has high homology with three genes in the goldfish genome, including the leukotriene B4 receptor 1 (BLT1) gene, which has six consecutive amino acid repeats with the polypeptide, so it is inferred that the polypeptide may interact with the rORF66 recombinant protein. This will provide a new basis for an in-depth investigation of the biological function of ORF66 during CyHV-2 virus infection, the development of new anti-CyHV-2 virus drugs and the search for potential drug targets.
Cyprinid herpesvirus 2 (CyHV-2) causes herpesviral haematopoietic necrosis, which is a serious threat to the health of the crucian carp farming industry. ORF66 is an immunogenic capsid protein of CyHV-2. To investigate the biological function of Cyprinid herpesvirus 2 during infection, a prokaryotic expression plasmid pET28a-tORF66 with ORF66 truncated gene was constructed based on a region with abundant antigenic table, transformed into BL21 receptor cells and then induced to express the protein using IPTG (Isopropyl-beta-D-thiogalactopyranoside) at 16℃. The lysed recombinant protein was obtained by urea lysis dialysis and then immunized in 6-week-old mice to prepare a murine anti-tORF66 polyclonal antibody. The solubilised recombinant proteins were screened for intercalating peptides by phage display techniques. The Western Blot assay showed that the antibody was able to recognize CyHV-2 in infected GICF cells with high potency and good specificity. The results of the phage elution showed by bioinformatics analysis that a peptide with the highest frequency of occurrence, N′-LHLHQNRMSLSR-C′, was obtained. The polypeptide has high homology with three genes in the goldfish genome, including the leukotriene B4 receptor 1 (BLT1) gene, which has six consecutive amino acid repeats with the polypeptide, so it is inferred that the polypeptide may interact with the rORF66 recombinant protein. This will provide a new basis for an in-depth investigation of the biological function of ORF66 during CyHV-2 virus infection, the development of new anti-CyHV-2 virus drugs and the search for potential drug targets.
,
Available online
, doi: 10.7541/2023.2022.0214
Abstract:
In order to explore the community characteristics of culturable filamentous fungi in Nam Co Lake in spring, the composition and abundance of filamentous fungi were determined based on the isolation and purification of filamentous fungi, combined with morphological characterization and ITS sequence analysis. At the same time, water environmental factors were determined to analyze correlations between ecological differentiation of dominant species of filamentous fungi and environmental factors in Nam Co Lake. The results showed that a total of 921 filamentous fungi strains were isolated from Nam Co Lake. These strains were identified as 62 species in 20 genera. Fungus resources are abundant, among which, the dominant species (Y>0.02) include: Penicillium commune, Penicillium vinaceum, Penicillium polonicum, Penicillium goetzii, Penicillium griseoroseum, Mucor hiemalis, Mucor racemosus, Pleosporales sp.2 and Penicillium crustosum. The niche indices of the dominant species showed that the sum of ecological response rates of dominant species is negative, and low overlap species accounted for a large proportion (56.94%). Overall, there was a positive correlation among the dominant species, but it did not reach a significant level (χ2>3.841), indicating that the community was in a stage of decline. With weak competition and loose relationships and great differences in resource utilization or ecological adaptability among dominant species. Moreover, the dominant species have not reached a relative dynamic balance, and their succession has not reached the top stage. The correlation between environmental factors and dominant species showed that salinity, conductivity, chemical oxygen demand, turbidity and ammonium nitrogen are the main factors affecting the distribution of dominant species of filamentous fungi in Nam Co Lake. These studies provided basic data for correctly understanding the population characteristics of culturable filamentous fungi in plateau lakes and laid a foundation for the development and utilization of culturable filamentous fungi.
In order to explore the community characteristics of culturable filamentous fungi in Nam Co Lake in spring, the composition and abundance of filamentous fungi were determined based on the isolation and purification of filamentous fungi, combined with morphological characterization and ITS sequence analysis. At the same time, water environmental factors were determined to analyze correlations between ecological differentiation of dominant species of filamentous fungi and environmental factors in Nam Co Lake. The results showed that a total of 921 filamentous fungi strains were isolated from Nam Co Lake. These strains were identified as 62 species in 20 genera. Fungus resources are abundant, among which, the dominant species (Y>0.02) include: Penicillium commune, Penicillium vinaceum, Penicillium polonicum, Penicillium goetzii, Penicillium griseoroseum, Mucor hiemalis, Mucor racemosus, Pleosporales sp.2 and Penicillium crustosum. The niche indices of the dominant species showed that the sum of ecological response rates of dominant species is negative, and low overlap species accounted for a large proportion (56.94%). Overall, there was a positive correlation among the dominant species, but it did not reach a significant level (χ2>3.841), indicating that the community was in a stage of decline. With weak competition and loose relationships and great differences in resource utilization or ecological adaptability among dominant species. Moreover, the dominant species have not reached a relative dynamic balance, and their succession has not reached the top stage. The correlation between environmental factors and dominant species showed that salinity, conductivity, chemical oxygen demand, turbidity and ammonium nitrogen are the main factors affecting the distribution of dominant species of filamentous fungi in Nam Co Lake. These studies provided basic data for correctly understanding the population characteristics of culturable filamentous fungi in plateau lakes and laid a foundation for the development and utilization of culturable filamentous fungi.
,
Available online
, doi: 10.7541/2023.2022.0106
Abstract:
In order to investigate the effects of underwater noise on behavior (swimming rate, feeding rate, spatial distribution) and gut microorganisms of sturgeon, hybridized sturgeon were exposed to noise (145±5 dB, 400 Hz) for 0, 48h, 7d, 7d, and 14d, followed by 48h of recovery in an environment without stressful noise. The results showed that the swimming and feeding rates of hybrid sturgeon were significantly reduced and the spatial distribution was changed after noise stimulation. At the beginning of the noise stimulation, the hybrid sturgeon gathered on the side away from the noise source, but gradually approached the noise source after 3min. The microbial composition was significantly different from the other groups at 7 days of noise stress. There was no significant effect of noise on the abundance of gut microorganisms in hybrid sturgeon. Differences in the dominant populations of gut microorganisms existed in each group at different time periods and the dominant populations changed over time. The results of the above microbiological analysis showed that "cell signaling processes", "carbohydrate transport" and "amino acid transport and metabolic functions" were significantly lower than those of the other groups at 48h and 7d of noise stress as predicted by COG. The results showed that noise had significant effects on the feeding rate, swimming rate, and spatial distribution of hybrid sturgeon, changing the composition and proportion of its gut microorganisms and affecting various vital life pathways, such as amino acid metabolism. This experiment simulated the mixed noise of various underwater noise sources and explored their effects on the behavior and gut microorganisms of hybrid sturgeon for the first time, which can provide basic information for the in-depth exploration of healthy ecological breeding and physiological response mechanisms to adversity of hybrid sturgeon.
In order to investigate the effects of underwater noise on behavior (swimming rate, feeding rate, spatial distribution) and gut microorganisms of sturgeon, hybridized sturgeon were exposed to noise (145±5 dB, 400 Hz) for 0, 48h, 7d, 7d, and 14d, followed by 48h of recovery in an environment without stressful noise. The results showed that the swimming and feeding rates of hybrid sturgeon were significantly reduced and the spatial distribution was changed after noise stimulation. At the beginning of the noise stimulation, the hybrid sturgeon gathered on the side away from the noise source, but gradually approached the noise source after 3min. The microbial composition was significantly different from the other groups at 7 days of noise stress. There was no significant effect of noise on the abundance of gut microorganisms in hybrid sturgeon. Differences in the dominant populations of gut microorganisms existed in each group at different time periods and the dominant populations changed over time. The results of the above microbiological analysis showed that "cell signaling processes", "carbohydrate transport" and "amino acid transport and metabolic functions" were significantly lower than those of the other groups at 48h and 7d of noise stress as predicted by COG. The results showed that noise had significant effects on the feeding rate, swimming rate, and spatial distribution of hybrid sturgeon, changing the composition and proportion of its gut microorganisms and affecting various vital life pathways, such as amino acid metabolism. This experiment simulated the mixed noise of various underwater noise sources and explored their effects on the behavior and gut microorganisms of hybrid sturgeon for the first time, which can provide basic information for the in-depth exploration of healthy ecological breeding and physiological response mechanisms to adversity of hybrid sturgeon.
,
Available online
, doi: 10.7541/2023.2022.0231
Abstract:
This article aims to study the effect of rapeseed meal and cottonseed meal on the muscle quality and the expression of genes related to muscle fiber development after replacing part of the fish meal in the diets of yellow catfish. Five groups of equal nitrogen and equal energy diets were designed in the experiment. The group containing 25% fish meal was used as the control diet (FM), and rapeseed meal and cotton meal were mixed 3:2 to replace 10%, 20%, 30% and 40% fish meal, and then set up four test groups as RM10, RM20, RM30 and RM40, respectively. The juvenile yellow catfish with an initial body weight of (2.38±0.02) g were fed with the above five diets for 8 weeks. The experiment showed that, compared with the fishmeal group, as the replacement level exceeded 10%, the crude protein and crude fat in the muscle of yellow catfish decreased significantly when the replacement level increased, but there was no significant difference in moisture and ash. In addition, the content of hydroxyproline in muscle also showed a downward trend. Among the muscle fibers of yellow catfish, the number with a diameter of ≥50 μm decreased when the replacement level reached 10%, while the number of fibers with a diameter of ≤20 μm showed an upward trend. At the same time, the replacement of plant protein sources will also have a certain impact on the muscle texture of yellow catfish. In addition, the mRNA levels of muscle fiber development-related genes myod, myog, and mrf4 gradually increased as the replacement level reached 10%, while the gene expression of myf5 and mstn did not show significance between the groups. The expression of TOR and S6K1 decreased as the replacement level increased, and the expression of 4E-BP1 increased as the replacement level increased. Therefore, this study show that use of the rapeseed meal and cottonseed meal to replace more than 10% of the fish meal in the diet of yellow catfish juveniles will damage the muscle growth and muscle quality.
This article aims to study the effect of rapeseed meal and cottonseed meal on the muscle quality and the expression of genes related to muscle fiber development after replacing part of the fish meal in the diets of yellow catfish. Five groups of equal nitrogen and equal energy diets were designed in the experiment. The group containing 25% fish meal was used as the control diet (FM), and rapeseed meal and cotton meal were mixed 3:2 to replace 10%, 20%, 30% and 40% fish meal, and then set up four test groups as RM10, RM20, RM30 and RM40, respectively. The juvenile yellow catfish with an initial body weight of (2.38±0.02) g were fed with the above five diets for 8 weeks. The experiment showed that, compared with the fishmeal group, as the replacement level exceeded 10%, the crude protein and crude fat in the muscle of yellow catfish decreased significantly when the replacement level increased, but there was no significant difference in moisture and ash. In addition, the content of hydroxyproline in muscle also showed a downward trend. Among the muscle fibers of yellow catfish, the number with a diameter of ≥50 μm decreased when the replacement level reached 10%, while the number of fibers with a diameter of ≤20 μm showed an upward trend. At the same time, the replacement of plant protein sources will also have a certain impact on the muscle texture of yellow catfish. In addition, the mRNA levels of muscle fiber development-related genes myod, myog, and mrf4 gradually increased as the replacement level reached 10%, while the gene expression of myf5 and mstn did not show significance between the groups. The expression of TOR and S6K1 decreased as the replacement level increased, and the expression of 4E-BP1 increased as the replacement level increased. Therefore, this study show that use of the rapeseed meal and cottonseed meal to replace more than 10% of the fish meal in the diet of yellow catfish juveniles will damage the muscle growth and muscle quality.
,
Available online
, doi: 10.7541/2023.2022.0260
Abstract:
To evaluate the effects of dietary aflatoxin B1 (AFB1) on growth performance, feed efficiency, and histological changes in juvenile red swamp crayfish (Procambarus clarkii), crayfish with initial body weight of [(0.382±0.005) g] were fed with four diets containing 0, 10, 100 and 1000 μg/kg AFB1 for a 42-day trial. Significant lower survival rate (SR), feeding rate (FR), final body weight (FBW), specific growth rate (SGR) and feed efficiency (FE) were observed in 100 μg/kg and 1000 μg/kg AFB1 group, while no significant differences were found in 10 μg/kg group compared to control group. There were no significant differences in alkaline phosphatase (AKP), alanine aminotransferase (ALT), aspartate, aminotransferase (AST), catalase (CAT), glutathione peroxidase (GSH-Px), glutathione S-transferase (GST) and malondialdehyde (MDA) in hepatopancreas between the control and 10 μg/kg AFB1 group, while significant decrease in superoxide dismutase (SOD) was observed in 10 μg/kg AFB1 group. AFB1 above 100 μg/kg significantly impacted activities of the aforementioned hepatopancreas enzymes. Slight histological changes were identified in hepatopancreas of 10 μg/kg AFB1 group. However, severe lesions of hepatopancreas were found in 100 μg/kg and 1000 μg/kg AFB1 group, which showed decreased numbers of R-cells and increased numbers of B-cells. The ultrastructural results showed that with the increase of AFB1 concentration, hepatopancreas demonstrated swelling mitochondria, expanded rough endoplasmic reticulum, increased cytoplasmic vesicles and larger lipid droplets. No AFB1 residues were detected in whole body when crayfish were fed with AFB1 up to 100μg/kg, however, tiny dose (1.65 μg/kg) of AFB1 were detected in the group with 1000 μg/kg AFB1, which was below the safety limitation of FDA. In summary, dietary AFB1 above 10 μg/kg had an adverse effect on juvenile crayfish, which indicated that red swamp crayfish was a sensitive species to AFB1.
To evaluate the effects of dietary aflatoxin B1 (AFB1) on growth performance, feed efficiency, and histological changes in juvenile red swamp crayfish (Procambarus clarkii), crayfish with initial body weight of [(0.382±0.005) g] were fed with four diets containing 0, 10, 100 and 1000 μg/kg AFB1 for a 42-day trial. Significant lower survival rate (SR), feeding rate (FR), final body weight (FBW), specific growth rate (SGR) and feed efficiency (FE) were observed in 100 μg/kg and 1000 μg/kg AFB1 group, while no significant differences were found in 10 μg/kg group compared to control group. There were no significant differences in alkaline phosphatase (AKP), alanine aminotransferase (ALT), aspartate, aminotransferase (AST), catalase (CAT), glutathione peroxidase (GSH-Px), glutathione S-transferase (GST) and malondialdehyde (MDA) in hepatopancreas between the control and 10 μg/kg AFB1 group, while significant decrease in superoxide dismutase (SOD) was observed in 10 μg/kg AFB1 group. AFB1 above 100 μg/kg significantly impacted activities of the aforementioned hepatopancreas enzymes. Slight histological changes were identified in hepatopancreas of 10 μg/kg AFB1 group. However, severe lesions of hepatopancreas were found in 100 μg/kg and 1000 μg/kg AFB1 group, which showed decreased numbers of R-cells and increased numbers of B-cells. The ultrastructural results showed that with the increase of AFB1 concentration, hepatopancreas demonstrated swelling mitochondria, expanded rough endoplasmic reticulum, increased cytoplasmic vesicles and larger lipid droplets. No AFB1 residues were detected in whole body when crayfish were fed with AFB1 up to 100μg/kg, however, tiny dose (1.65 μg/kg) of AFB1 were detected in the group with 1000 μg/kg AFB1, which was below the safety limitation of FDA. In summary, dietary AFB1 above 10 μg/kg had an adverse effect on juvenile crayfish, which indicated that red swamp crayfish was a sensitive species to AFB1.
,
Available online
, doi: 10.7541/2023.2022.0246
Abstract:
Ge-Xian-Mi (Nostoc sphaeroids Kützing) grown in paddy fields is a rare edible cyanobacteria. The yield of wild resources of Ge-Xian-Mi has decreased owing to the extensive use of pesticides and fertilizers. The physiological toxic effects on Ge-Xian-Mi was lack of studies for bentazone, although it was a broad-spectrum and high-efficiency and low-toxicity new herbicide. This study compared and analyzed the physiological toxic effects in growth, oxidation and antioxidant system, photosynthesis and respiration of Ge-Xian-Mi treated by different times and different concentrations of bentazone. The results showed that bentazone inhibited the growth of Ge-Xian-Mi. In the wake of increased concentration and prolonged treatments for bentazone, they showed an upward trend as production rate of\begin{document}${\rm{O}}^-_2 $\end{document} ![]()
![]()
Ge-Xian-Mi (Nostoc sphaeroids Kützing) grown in paddy fields is a rare edible cyanobacteria. The yield of wild resources of Ge-Xian-Mi has decreased owing to the extensive use of pesticides and fertilizers. The physiological toxic effects on Ge-Xian-Mi was lack of studies for bentazone, although it was a broad-spectrum and high-efficiency and low-toxicity new herbicide. This study compared and analyzed the physiological toxic effects in growth, oxidation and antioxidant system, photosynthesis and respiration of Ge-Xian-Mi treated by different times and different concentrations of bentazone. The results showed that bentazone inhibited the growth of Ge-Xian-Mi. In the wake of increased concentration and prolonged treatments for bentazone, they showed an upward trend as production rate of
,
Available online
, doi: 10.7541/2023.2022.0049
Abstract:
In order to improve the reproductive efficiency of pink heelsplitter, Potamilus alatus, and explore the influence of parasitism on nutritive index of freshwater drum, Aplodinotus grunniens, this experiment measured the effect of parasitism of different scales through comparing the amount of glochidium falling from freshwater drum, and analyzed changes of serum biochemical indices of the host, and content of amino acid and fatty acid under stress of parasitism. Results indicated that the amount of glochidium falling from the hosts in group of big freshwater drum is significantly greater than that in group of small freshwater drum (P<0.05), while the average amount of juvenile mollusk falling from the hosts in each kilogram in group of small freshwater drum is much bigger than that in group of big freshwater drum (P<0.05); creatinine in muscles significantly increases under stress of parasitism (P<0.05), and glutamic-pyruvic transaminase, glutamic oxalacetic transaminase and lactic dehydrogenase greatly drop (P<0.05), while blood glucose, total protein, albumin, triglyceride, total cholesterol, high-density lipoprotein and low density lipoprotein barely change comparing with those in the control group (P>0.05); Ash content in the experimental group barely differs from that in the control group (P>0.05), and water content and crude fat in muscle in the experimental group are significantly higher than those in the control group (P<0.05), while content of crude protein in experimental group is obviously lower than that in the control group (P<0.05); content of aspartic acid, alanine, glutamic acid, tyrosine, glycine and arginine in the experimental group are greatly lower than those in the control group (P<0.05), and content of non-essential amino acid is notably lower than that in the control group (P<0.05), while the content of other amino acids in two groups are barely different (P>0.05); the content of lauric acid (C12:0) and arachidonic acid (C20:1) in the experimental group are remarkably higher than those in the control group (P<0.05), while there is no other significant difference (P>0.05). Results indicated that small size host fish is more suitable for practical production and parasitism had little influence on the nutritive index of freshwater drum.
In order to improve the reproductive efficiency of pink heelsplitter, Potamilus alatus, and explore the influence of parasitism on nutritive index of freshwater drum, Aplodinotus grunniens, this experiment measured the effect of parasitism of different scales through comparing the amount of glochidium falling from freshwater drum, and analyzed changes of serum biochemical indices of the host, and content of amino acid and fatty acid under stress of parasitism. Results indicated that the amount of glochidium falling from the hosts in group of big freshwater drum is significantly greater than that in group of small freshwater drum (P<0.05), while the average amount of juvenile mollusk falling from the hosts in each kilogram in group of small freshwater drum is much bigger than that in group of big freshwater drum (P<0.05); creatinine in muscles significantly increases under stress of parasitism (P<0.05), and glutamic-pyruvic transaminase, glutamic oxalacetic transaminase and lactic dehydrogenase greatly drop (P<0.05), while blood glucose, total protein, albumin, triglyceride, total cholesterol, high-density lipoprotein and low density lipoprotein barely change comparing with those in the control group (P>0.05); Ash content in the experimental group barely differs from that in the control group (P>0.05), and water content and crude fat in muscle in the experimental group are significantly higher than those in the control group (P<0.05), while content of crude protein in experimental group is obviously lower than that in the control group (P<0.05); content of aspartic acid, alanine, glutamic acid, tyrosine, glycine and arginine in the experimental group are greatly lower than those in the control group (P<0.05), and content of non-essential amino acid is notably lower than that in the control group (P<0.05), while the content of other amino acids in two groups are barely different (P>0.05); the content of lauric acid (C12:0) and arachidonic acid (C20:1) in the experimental group are remarkably higher than those in the control group (P<0.05), while there is no other significant difference (P>0.05). Results indicated that small size host fish is more suitable for practical production and parasitism had little influence on the nutritive index of freshwater drum.
,
Available online
, doi: 10.7541/2023.2022.0077
Abstract:
Although dragonfly larvae can be good bioindictors in fresh water environment assessments, their identification based on morphological characteristics is still a tough work, especially at species level. In the present study, 116 larvae of two Chinese widespread damselfly, Ceriagrion fallax Ris and Ceriagrion auranticum Fraser, were identified depending on sequence data of the mitochondrial genes Cytochrome Oxidase I (COI) and nuclear ribosomal genes ITS. The stability of two important morphological characters, caudal gills and mandibles, was discussed. For molecular analysis, LCO1490d (TTTCTACWAACCAYAAAGATATTGG) and HCO2198d (TAAACTTCWGGRTGTCCAAARAATCA) were used as COI primers, and Vrain2F (CTTTGTACACACCGCCCGTCGCT) and Vrain2R (TTTCACTCGCCGTTACTAAGGGAATC) as ITS primers. The reaction systems were 31.0 μL: DNA template 3.0 μL, upstream and downstream primers 2.0 μL each, Mix 15.0 μL (Jiangsu ComWin Biotech Co., Ltd's 2×Es Taq Master Mix), ddH2O 9.0 μL. Take 5.0 μL PCR amplification products and detect them by electrophoresis using 1.5% agarose gel. The amplification products with detected by electrophoresis, and then sent to Chongqing Tsingke Xingye Biotechnology Co to sequence. Neighbor-Joining (NJ) trees and genetic distance method were using for the molecular identification of larvae, with the help of identified adults’ sequences as conference. Relative large size of larval specimens, C. fallax (n=110) and C. auranticum (n=6), were dissected and photographed using LY-WN-OPLENC ultra-clear microphotographic system. Detailed comparative morphological examination was conducted focusing on two typical morphological features, caudal gill and mandibles. Our result showed that: (1) the presence or absence, numbers, and color of the black spots on the caudal gill were unstable, which have nothing to do with populations and sex; (2) characters of mandibles were also variable even within the same population. The discovery of the instability of the two typical diagnostic morphological characters indicates that characters of caudal gills and mandibles, at least, in these two species should be used with caution latterly in taxonomy. Our result also suggests that the similar instability may exist in other diagnostic morphological characteristics in other odonate species. The idea and methodology of this study can be instructive to future morphological studies on insect taxonomy.
Although dragonfly larvae can be good bioindictors in fresh water environment assessments, their identification based on morphological characteristics is still a tough work, especially at species level. In the present study, 116 larvae of two Chinese widespread damselfly, Ceriagrion fallax Ris and Ceriagrion auranticum Fraser, were identified depending on sequence data of the mitochondrial genes Cytochrome Oxidase I (COI) and nuclear ribosomal genes ITS. The stability of two important morphological characters, caudal gills and mandibles, was discussed. For molecular analysis, LCO1490d (TTTCTACWAACCAYAAAGATATTGG) and HCO2198d (TAAACTTCWGGRTGTCCAAARAATCA) were used as COI primers, and Vrain2F (CTTTGTACACACCGCCCGTCGCT) and Vrain2R (TTTCACTCGCCGTTACTAAGGGAATC) as ITS primers. The reaction systems were 31.0 μL: DNA template 3.0 μL, upstream and downstream primers 2.0 μL each, Mix 15.0 μL (Jiangsu ComWin Biotech Co., Ltd's 2×Es Taq Master Mix), ddH2O 9.0 μL. Take 5.0 μL PCR amplification products and detect them by electrophoresis using 1.5% agarose gel. The amplification products with detected by electrophoresis, and then sent to Chongqing Tsingke Xingye Biotechnology Co to sequence. Neighbor-Joining (NJ) trees and genetic distance method were using for the molecular identification of larvae, with the help of identified adults’ sequences as conference. Relative large size of larval specimens, C. fallax (n=110) and C. auranticum (n=6), were dissected and photographed using LY-WN-OPLENC ultra-clear microphotographic system. Detailed comparative morphological examination was conducted focusing on two typical morphological features, caudal gill and mandibles. Our result showed that: (1) the presence or absence, numbers, and color of the black spots on the caudal gill were unstable, which have nothing to do with populations and sex; (2) characters of mandibles were also variable even within the same population. The discovery of the instability of the two typical diagnostic morphological characters indicates that characters of caudal gills and mandibles, at least, in these two species should be used with caution latterly in taxonomy. Our result also suggests that the similar instability may exist in other diagnostic morphological characteristics in other odonate species. The idea and methodology of this study can be instructive to future morphological studies on insect taxonomy.
,
Available online
, doi: 10.7541/2023.2022.0177
Abstract:
In order to explore the influence of farming mode on the quality of grass carp (Ctenopharyngodon idellus), a comparative study was conducted on edible quality of grass carp between traditional pond farming and recirculating aquaculture system. The results showed that the muscle quality and edible quality of grass carp farmed in recirculating water were better than those farmed in the traditional pond. The whiteness and springiness of recirculating aquaculture grass carp were higher than those of traditional pond farmed grass carp, the contents of unsaturated fatty acids and essential amino acids in recirculating water aquaculture grass carp were significantly higher than those in the traditional pond. The contents of n-3 and n-6 unsaturated fatty acids in recirculating water aquaculture grass carp were significantly higher than those in the traditional pond grass carp, indicating better nutritional characteristics and better muscle quality. Besides, the contents of the total amino acids in recirculating cultured grass carp was significantly higher than that of traditional cultured grass carp, which made grass carp have higher nutritional characteristics. The contents of protein in grass carp cultured by recirculating aquaculture was higher, in line with contemporary nutrition. Recirculating aquaculture could reduce the contents of hexanal, heptanal and 1-octen-3-ol in grass carp with off-odor, and the content of hypoxanthine nucleotide (IMP) was higher than that in the traditional pond, which made grass carp taste more delicious and dense. The results showed that the muscle quality and nutritional characteristics of grass carp farmed in recirculating water were better than those of the traditional pond.
In order to explore the influence of farming mode on the quality of grass carp (Ctenopharyngodon idellus), a comparative study was conducted on edible quality of grass carp between traditional pond farming and recirculating aquaculture system. The results showed that the muscle quality and edible quality of grass carp farmed in recirculating water were better than those farmed in the traditional pond. The whiteness and springiness of recirculating aquaculture grass carp were higher than those of traditional pond farmed grass carp, the contents of unsaturated fatty acids and essential amino acids in recirculating water aquaculture grass carp were significantly higher than those in the traditional pond. The contents of n-3 and n-6 unsaturated fatty acids in recirculating water aquaculture grass carp were significantly higher than those in the traditional pond grass carp, indicating better nutritional characteristics and better muscle quality. Besides, the contents of the total amino acids in recirculating cultured grass carp was significantly higher than that of traditional cultured grass carp, which made grass carp have higher nutritional characteristics. The contents of protein in grass carp cultured by recirculating aquaculture was higher, in line with contemporary nutrition. Recirculating aquaculture could reduce the contents of hexanal, heptanal and 1-octen-3-ol in grass carp with off-odor, and the content of hypoxanthine nucleotide (IMP) was higher than that in the traditional pond, which made grass carp taste more delicious and dense. The results showed that the muscle quality and nutritional characteristics of grass carp farmed in recirculating water were better than those of the traditional pond.
,
Available online
, doi: 10.7541/2023.2022.0162
Abstract:
Tris(1,3-dichloro-2-propyl) phosphate (TDCIPP), widely used as a kind of organophosphorus flame retardant, has been detected in the Yangtze River water environments. Many toxicological assessments have shown that TDCIPP could change morphology of fish. Silver carp (Hypophthalmichthys molitrix) lives in the Yangtze River for its entire life story. However, the effects of TDCIPP on silver carp is unclear. In order to clarify the main morphological characters of growth inhibition of silver carp larvae caused by TDCIPP, the present study analyzed the morphological traits between four environmentally relevant concentrations (0.05, 0.5, 5 and 50 μg/L) and the control group by geometric morphometric analysis. After the image information of larvae simple was obtained, the body length and body weight were measured. Then, digitization of landmarks was carried out with the TPS series software. Finally, principal component analysis (PCA), canonical variates analysis (CVA) and results visualization were carried out with Morpho J software. The body length and body weight of silver carp larvae decreased significantly under exposure to 0.5、5 and 50 μg/L of TDCIPP compared with the control group, but no effects were observed in 0.05 μg/L. This indicated that environmentally relevant concentrations of TDCIPP induced growth inhibition in silver carp larvae. The results of PCA and CVA indicated that the first principal component (PC1) and the second principal component (PC2) together accounted for 62.15% of the overall variables (47.36% and 14.51%, respectively). The first canonical variates (CV1) and the second canonical variates (CV2) together accounted for 79.48% (54.55% and 24.93%, respectively), which satisfied the requirement of morphological analysis of silver carp larvae. The results of grid profile analysis indicated that the average morphology of silver carp larvae in different concentrations was significantly different with the control group(P ＜ 0.05), which identified by the growth retardation of the head, longitudinal axis of body and tail. As a conclusion, TDCIPP could induce the growth retardation of head, longitudinal axis of body and tail in silver carp larvae. Therefore, attentions should be paid to the environmental concentrations of TDCIPP in the Yangtze River Basin, and the ecological risk of TDCIPP to the replenishment of silver carp population resources should be assessed.
Tris(1,3-dichloro-2-propyl) phosphate (TDCIPP), widely used as a kind of organophosphorus flame retardant, has been detected in the Yangtze River water environments. Many toxicological assessments have shown that TDCIPP could change morphology of fish. Silver carp (Hypophthalmichthys molitrix) lives in the Yangtze River for its entire life story. However, the effects of TDCIPP on silver carp is unclear. In order to clarify the main morphological characters of growth inhibition of silver carp larvae caused by TDCIPP, the present study analyzed the morphological traits between four environmentally relevant concentrations (0.05, 0.5, 5 and 50 μg/L) and the control group by geometric morphometric analysis. After the image information of larvae simple was obtained, the body length and body weight were measured. Then, digitization of landmarks was carried out with the TPS series software. Finally, principal component analysis (PCA), canonical variates analysis (CVA) and results visualization were carried out with Morpho J software. The body length and body weight of silver carp larvae decreased significantly under exposure to 0.5、5 and 50 μg/L of TDCIPP compared with the control group, but no effects were observed in 0.05 μg/L. This indicated that environmentally relevant concentrations of TDCIPP induced growth inhibition in silver carp larvae. The results of PCA and CVA indicated that the first principal component (PC1) and the second principal component (PC2) together accounted for 62.15% of the overall variables (47.36% and 14.51%, respectively). The first canonical variates (CV1) and the second canonical variates (CV2) together accounted for 79.48% (54.55% and 24.93%, respectively), which satisfied the requirement of morphological analysis of silver carp larvae. The results of grid profile analysis indicated that the average morphology of silver carp larvae in different concentrations was significantly different with the control group(P ＜ 0.05), which identified by the growth retardation of the head, longitudinal axis of body and tail. As a conclusion, TDCIPP could induce the growth retardation of head, longitudinal axis of body and tail in silver carp larvae. Therefore, attentions should be paid to the environmental concentrations of TDCIPP in the Yangtze River Basin, and the ecological risk of TDCIPP to the replenishment of silver carp population resources should be assessed.
,
Available online
, doi: 10.7541/2023.2022.0139
Abstract:
The Chinese sturgeon, Acipenser sinensis, is a large anadromous fish, with an average 14 years for males and 21 years for females. It was listed as critically endangered by the International Union for Conservation of Nature (IUCN) since 2010, and its spawning activity was not observed during the past five spawning seasons. Therefore, there is an urgent need to preserve the genetic resources of Chinese sturgeon. To investigate the germplasm conservation of Chinese sturgeon and its spermatogonia stem cell culture in vitro, a new cell line (designated as AST) derived from the testis of Chinese sturgeon was established and characterized. The AST cell line are fibroblast-like cells, and have been stably subcultured for more than 80 passages. The optimal growth conditions for the AST cell line are DMEM medium, 25℃, and 15% FBS. After cryopreservation in liquid nitrogen, the viability of AST cells was about (81.36±1.13)%, as measured by trypan blue staining. Chromosome analysis of AST cells at the 30th passage showed that the number of chromosomes ranged from 142 to 310, and the modal number was 264. To detect the expression characterization of Sertoli cell-related genes (amh and gsdf), Leydig cell-related genes (cyp17a1), and germ cell-related genes (dazl, dnd, and vasa) in AST cells by RT-PCR, all of the genes were found in the P0 and P1 cells, where their amounts were similar with those of in testis; however, in P15, P30, and P60 AST cells, only amh and vasa genes were detected with very low level, suggesting only a few number of Sertoli cells and germ cells in the late passage of AST cells. The signal of enhanced green florescence protein (GFP) were detected in a few of AST cells after transfection with pEGFP-N3 plasmid. The establishment of the AST cell line could provide important experimental material for the conservation genetic resources of Chinese sturgeon, the in vitro study of proliferation and differentiation of spermatogonia stem cell, and function analysis of testicular related genes.
The Chinese sturgeon, Acipenser sinensis, is a large anadromous fish, with an average 14 years for males and 21 years for females. It was listed as critically endangered by the International Union for Conservation of Nature (IUCN) since 2010, and its spawning activity was not observed during the past five spawning seasons. Therefore, there is an urgent need to preserve the genetic resources of Chinese sturgeon. To investigate the germplasm conservation of Chinese sturgeon and its spermatogonia stem cell culture in vitro, a new cell line (designated as AST) derived from the testis of Chinese sturgeon was established and characterized. The AST cell line are fibroblast-like cells, and have been stably subcultured for more than 80 passages. The optimal growth conditions for the AST cell line are DMEM medium, 25℃, and 15% FBS. After cryopreservation in liquid nitrogen, the viability of AST cells was about (81.36±1.13)%, as measured by trypan blue staining. Chromosome analysis of AST cells at the 30th passage showed that the number of chromosomes ranged from 142 to 310, and the modal number was 264. To detect the expression characterization of Sertoli cell-related genes (amh and gsdf), Leydig cell-related genes (cyp17a1), and germ cell-related genes (dazl, dnd, and vasa) in AST cells by RT-PCR, all of the genes were found in the P0 and P1 cells, where their amounts were similar with those of in testis; however, in P15, P30, and P60 AST cells, only amh and vasa genes were detected with very low level, suggesting only a few number of Sertoli cells and germ cells in the late passage of AST cells. The signal of enhanced green florescence protein (GFP) were detected in a few of AST cells after transfection with pEGFP-N3 plasmid. The establishment of the AST cell line could provide important experimental material for the conservation genetic resources of Chinese sturgeon, the in vitro study of proliferation and differentiation of spermatogonia stem cell, and function analysis of testicular related genes.
,
Available online
, doi: 10.7541/2023.2022.0143
Abstract:
Through the population dynamics, study the temporal and spatial changes of Diplostomum spathaceum infection, and study whether the infection has parasitic preference for host gender, left and right eyes and different parts of eyeball, find out the infection of D. spathaceum in Gymnocypris selincuoenses from Selinco Lake, analyze the causes of population growth and decline, and explore its life history strategy. Catching the G. namensis in different seasons over the year, and recorded the total length, weight and gender. Collected and counted numbers of D. spathaceum, and calculated the prevalence and mean abundance in different seaons and of different total-length groups of G. namensis. Through independent sample nonparametric test, it was judged whether there were significant differences in the number of infections in different gender hosts, left and right eyes and different parts of eyeball, so as to test whether there were parasitic preferences of D. spathaceum. A total of 165 G. namensis (28.7—49.5 cm in length, 37.9±4.0 cm in average length, 196.9—827.2 g in weight, 473.3±127.9 g in average, including 82 females and 83 males) were dissected. A total of 515 D. spathaceum were detected, and the maximum parasitic amount was 32 per fish. We found D. spathaceum can infect D. spathaceum all year round. In the summer and autumn of 2020, the prevalence and mean abundance showed a downward trend. In 2021, the prevalence was high in spring, decreased in summer, and the highest in autumn. The mean abundance showed an upward trend. According to the total-length range of G. namensis, they were divided into five total-length groups at an interval of 5 cm. The prevalence and mean abundance were the lowest in the total-length group of 25 cm≤TL<30 cm, close in the total-length groups of 30 cm≤TL<35 cm, 35 cm≤TL<40 cm and 40 cm≤TL<45 cm, and increased greatly in the total-length group of 45 cm≤TL<50 cm. There was no preference in the host of different genders, and left and right eyes of the hosts, but there was an obvious preference in the lens and vitreous humours, and more parasitic in the lens. The seasonal dynamics of the population growth and decline of D. spathaceum are closely related to environmental factors such as water temperature, the migration time of migratory birds and the existence of snails. With the increase of the total length of G. namensis, the eyeball volume increases, which can accommodate more eye flukes, and the long-term cumulative contact also makes the number of infections more. In the 45 cm≤TL<50 cm total-length group, the prevalence and mean abundance increased sharply, may be because of the larger body size represents a larger surface area, which can not only be invaded by more cercariae, but also can help G. namensis to survive under the increasing infection level to a certain extent, so as to accumulate more D. spathaceum. The parasitic preference of D. spathaceum in Gymnocypris selincuoenses from Selinco Lake is a life history strategy to adapt to the environment, and its purpose is to be conducive to the spread and reproduction of the population.
Through the population dynamics, study the temporal and spatial changes of Diplostomum spathaceum infection, and study whether the infection has parasitic preference for host gender, left and right eyes and different parts of eyeball, find out the infection of D. spathaceum in Gymnocypris selincuoenses from Selinco Lake, analyze the causes of population growth and decline, and explore its life history strategy. Catching the G. namensis in different seasons over the year, and recorded the total length, weight and gender. Collected and counted numbers of D. spathaceum, and calculated the prevalence and mean abundance in different seaons and of different total-length groups of G. namensis. Through independent sample nonparametric test, it was judged whether there were significant differences in the number of infections in different gender hosts, left and right eyes and different parts of eyeball, so as to test whether there were parasitic preferences of D. spathaceum. A total of 165 G. namensis (28.7—49.5 cm in length, 37.9±4.0 cm in average length, 196.9—827.2 g in weight, 473.3±127.9 g in average, including 82 females and 83 males) were dissected. A total of 515 D. spathaceum were detected, and the maximum parasitic amount was 32 per fish. We found D. spathaceum can infect D. spathaceum all year round. In the summer and autumn of 2020, the prevalence and mean abundance showed a downward trend. In 2021, the prevalence was high in spring, decreased in summer, and the highest in autumn. The mean abundance showed an upward trend. According to the total-length range of G. namensis, they were divided into five total-length groups at an interval of 5 cm. The prevalence and mean abundance were the lowest in the total-length group of 25 cm≤TL<30 cm, close in the total-length groups of 30 cm≤TL<35 cm, 35 cm≤TL<40 cm and 40 cm≤TL<45 cm, and increased greatly in the total-length group of 45 cm≤TL<50 cm. There was no preference in the host of different genders, and left and right eyes of the hosts, but there was an obvious preference in the lens and vitreous humours, and more parasitic in the lens. The seasonal dynamics of the population growth and decline of D. spathaceum are closely related to environmental factors such as water temperature, the migration time of migratory birds and the existence of snails. With the increase of the total length of G. namensis, the eyeball volume increases, which can accommodate more eye flukes, and the long-term cumulative contact also makes the number of infections more. In the 45 cm≤TL<50 cm total-length group, the prevalence and mean abundance increased sharply, may be because of the larger body size represents a larger surface area, which can not only be invaded by more cercariae, but also can help G. namensis to survive under the increasing infection level to a certain extent, so as to accumulate more D. spathaceum. The parasitic preference of D. spathaceum in Gymnocypris selincuoenses from Selinco Lake is a life history strategy to adapt to the environment, and its purpose is to be conducive to the spread and reproduction of the population.
,
Available online
, doi: 10.7541/2023.2022.0203
Abstract:
Based on survey data collected in 4seasons of 2019 by single bottom trawling of Zhejiang surrounding waters, the paper analysed species composition, dominant species and the distribution of resources density of molluscs. Ecosystem diversity index, Species similarity index(Js), Alternate index (AI), Migration index (MI) and abundance/biomass comparison curve (ABC curve) were adopted to analyse species diversity of community and its dynamic changes. The results showed that 62 molluscs species were captured belonging to 3 classes 10 orders, and 32 families, and the dominant species were Octopus variabilis, Loligo edulis, Turritella bacillum, Abralia multihamatai, and Sepiola birostrata all the year. The seasonal variation of dominant species was quite different. The annual average resource density was 204.94 kg/km2, The resource density in summer was the highest value in the whole year, and Winter was the lowest. The average resource density was increasing gradually from north to south roughly. The annual average values of species abundance index (D), species diversity index (H’) and species evenness index (J’) were 0.70, 0.88 and 0.61 respectively. Three indices values indicated that molluscs community diversity was on a low level. The values of Species similarity index (Js), Alternate index (AI) and Migration index (MI) indicated that the community stability was higher in spring and winter than in summer and autumn. According to the ABC curve, molluscs community all the year were moderately disturbed respectively.
Based on survey data collected in 4seasons of 2019 by single bottom trawling of Zhejiang surrounding waters, the paper analysed species composition, dominant species and the distribution of resources density of molluscs. Ecosystem diversity index, Species similarity index(Js), Alternate index (AI), Migration index (MI) and abundance/biomass comparison curve (ABC curve) were adopted to analyse species diversity of community and its dynamic changes. The results showed that 62 molluscs species were captured belonging to 3 classes 10 orders, and 32 families, and the dominant species were Octopus variabilis, Loligo edulis, Turritella bacillum, Abralia multihamatai, and Sepiola birostrata all the year. The seasonal variation of dominant species was quite different. The annual average resource density was 204.94 kg/km2, The resource density in summer was the highest value in the whole year, and Winter was the lowest. The average resource density was increasing gradually from north to south roughly. The annual average values of species abundance index (D), species diversity index (H’) and species evenness index (J’) were 0.70, 0.88 and 0.61 respectively. Three indices values indicated that molluscs community diversity was on a low level. The values of Species similarity index (Js), Alternate index (AI) and Migration index (MI) indicated that the community stability was higher in spring and winter than in summer and autumn. According to the ABC curve, molluscs community all the year were moderately disturbed respectively.
,
Available online
, doi: 10.7541/2023.2022.0160
Abstract:
Biological soil crusts (BSCs) play critical ecological functions in desert ecosystem. Microcoleus sp. are key filamentous cyanobacteria and play vital roles in BSCs. More and more strains of Microcoleaceae were found in desert areas. However, it is difficult to distinguish them in species level due to similar morphological characteristic. In this manuscript, 11 filamentous cyanobacterial strains with similar morphology to Microcoleus were isolated and purified from BSCs in Gurbantonggute desert. The experimental cyanobacterial strains were examined morphologically as well as phylogenetically using 16S rRNA gene and the 16S—23S internal transcribed spacer (ITS) rigion. The results show that the experimental cyanobacterial strains belong to the genera Microcoleus and Symplocastrum, including two newly recorded species in China: M. steenstrupii and S. flechtnerii, as well as M. vaginatus and a suspect species similar to M. steenstrupii. The number and alignment of cyanobacterial filaments, cell size and the shape of apical cells, and phylogenetic relationship based on 16S rRNA are key evidence to identity different species of Microcoleaceae. Secondary structure of ITS are also vital reference to distinguish to different species in same genus.
Biological soil crusts (BSCs) play critical ecological functions in desert ecosystem. Microcoleus sp. are key filamentous cyanobacteria and play vital roles in BSCs. More and more strains of Microcoleaceae were found in desert areas. However, it is difficult to distinguish them in species level due to similar morphological characteristic. In this manuscript, 11 filamentous cyanobacterial strains with similar morphology to Microcoleus were isolated and purified from BSCs in Gurbantonggute desert. The experimental cyanobacterial strains were examined morphologically as well as phylogenetically using 16S rRNA gene and the 16S—23S internal transcribed spacer (ITS) rigion. The results show that the experimental cyanobacterial strains belong to the genera Microcoleus and Symplocastrum, including two newly recorded species in China: M. steenstrupii and S. flechtnerii, as well as M. vaginatus and a suspect species similar to M. steenstrupii. The number and alignment of cyanobacterial filaments, cell size and the shape of apical cells, and phylogenetic relationship based on 16S rRNA are key evidence to identity different species of Microcoleaceae. Secondary structure of ITS are also vital reference to distinguish to different species in same genus.
,
Available online
, doi: 10.7541/2023.2022.0144
Abstract:
In order to reveal the diversity and distribution of parasites, as well as the interaction and coexistence mechanism among parasites, analyze the relationship among parasites, hosts and environment, study the community ecology of intestinal helminths in Gymnocypris waddellii from Yamdrok Lake, understand the species diversity of aquatic organisms in Xizang Autonomous Region, explore the community characteristics and interspecific relations, and accumulate data for studying the relationship among parasites, Tibetan plateau environment and unique fish hosts, 180 G. waddellii (120 females and 60 males, with a total length of 22.20—49.20 cm, an average length of 36.76±4.18 cm, a body weight of 77.3—896.7 g, and an average weight of 425.92±148.27 g) were dissected in July 2020. The contents of community ecology such as community structure and interspecific relationship were analyzed. The results showed that the intestinal helminth community of G. waddellii in Yamdrok Lake were composed of five species: Parabreviscolex niepin, Contracaecum eudyptulae, Streptocara sp., Neoechinorhynchus sp. and Allocreadium sp.. From high to low, the prevalence of populations were Neoechinorhynchus sp., P. niepin, Allocreadium sp., C. eudyptulae and Streptocara sp.; the infection intensity of populations were P. niepin, Neoechinorhynchus sp., C. eudyptulae, Allocreadium sp. and Streptocara sp.; the average abundance of populations were P. niepin, Neoechinorhynchus sp., Streptocara sp., Allocreadium sp. and C. eudyptulae. The Margalef index of community was 0.59, Shannon-Wiener index was 1.26, Pielou index was 0.83 and Berger- Parker index was 0.50. The dominant species was P. niepin. There were positive correlations among four populations, and the order of correlation from high to generation were as follows: Neoechinorhynchus sp.and Allocreadium sp, C. eudyptulae and Neoechinorhynchus sp., C. eudyptulae and Allocreadium sp., C. eudyptulae and Streptocara sp.. There were no interspecific association between other parasitic worm populations. In terms of infection or not, the number of infected hosts was more than half of that of the sampled population. Among them, the host frequency with one parasite was the most, the host frequency with two parasites was also more, the host frequency with three and four parasites were significantly reduced, and no hosts infected with five parasites at the same time was found. Compared with Lake Chugutso, which is also located in southern Xizang and once connected with Yamdrok Lake, although the two lakes are geographically similar, the host fish species are the same, and the intestinal helminth species composition is the same, intestinal helminths in G. waddellii from Yamdrok Lake has its own characteristics, that is, higher average abundance, and most parasitic worm populations also have higher prevalence, and the dominant species in the community are also different from Chugutso Lake. Interspecific association is used to judge whether there is coexistence or exclusion between various groups in intestinal helminths community, that is, interspecific affinity. In the intestinal helminths community of G. waddellii from Yamdrok Lake, the affinity between the undetermined species of Neoechinorhynchus sp. and Allocreadium sp. were the highest. However, this relationship is not stable and will change with the changes of water ecological environment and species composition in the community. The frequency of co-infected hosts suggests that with the increase of species in a sub community, the greater the interaction between species, the more difficult it is to maintain coexistence.
In order to reveal the diversity and distribution of parasites, as well as the interaction and coexistence mechanism among parasites, analyze the relationship among parasites, hosts and environment, study the community ecology of intestinal helminths in Gymnocypris waddellii from Yamdrok Lake, understand the species diversity of aquatic organisms in Xizang Autonomous Region, explore the community characteristics and interspecific relations, and accumulate data for studying the relationship among parasites, Tibetan plateau environment and unique fish hosts, 180 G. waddellii (120 females and 60 males, with a total length of 22.20—49.20 cm, an average length of 36.76±4.18 cm, a body weight of 77.3—896.7 g, and an average weight of 425.92±148.27 g) were dissected in July 2020. The contents of community ecology such as community structure and interspecific relationship were analyzed. The results showed that the intestinal helminth community of G. waddellii in Yamdrok Lake were composed of five species: Parabreviscolex niepin, Contracaecum eudyptulae, Streptocara sp., Neoechinorhynchus sp. and Allocreadium sp.. From high to low, the prevalence of populations were Neoechinorhynchus sp., P. niepin, Allocreadium sp., C. eudyptulae and Streptocara sp.; the infection intensity of populations were P. niepin, Neoechinorhynchus sp., C. eudyptulae, Allocreadium sp. and Streptocara sp.; the average abundance of populations were P. niepin, Neoechinorhynchus sp., Streptocara sp., Allocreadium sp. and C. eudyptulae. The Margalef index of community was 0.59, Shannon-Wiener index was 1.26, Pielou index was 0.83 and Berger- Parker index was 0.50. The dominant species was P. niepin. There were positive correlations among four populations, and the order of correlation from high to generation were as follows: Neoechinorhynchus sp.and Allocreadium sp, C. eudyptulae and Neoechinorhynchus sp., C. eudyptulae and Allocreadium sp., C. eudyptulae and Streptocara sp.. There were no interspecific association between other parasitic worm populations. In terms of infection or not, the number of infected hosts was more than half of that of the sampled population. Among them, the host frequency with one parasite was the most, the host frequency with two parasites was also more, the host frequency with three and four parasites were significantly reduced, and no hosts infected with five parasites at the same time was found. Compared with Lake Chugutso, which is also located in southern Xizang and once connected with Yamdrok Lake, although the two lakes are geographically similar, the host fish species are the same, and the intestinal helminth species composition is the same, intestinal helminths in G. waddellii from Yamdrok Lake has its own characteristics, that is, higher average abundance, and most parasitic worm populations also have higher prevalence, and the dominant species in the community are also different from Chugutso Lake. Interspecific association is used to judge whether there is coexistence or exclusion between various groups in intestinal helminths community, that is, interspecific affinity. In the intestinal helminths community of G. waddellii from Yamdrok Lake, the affinity between the undetermined species of Neoechinorhynchus sp. and Allocreadium sp. were the highest. However, this relationship is not stable and will change with the changes of water ecological environment and species composition in the community. The frequency of co-infected hosts suggests that with the increase of species in a sub community, the greater the interaction between species, the more difficult it is to maintain coexistence.
,
Available online
, doi: 10.7541/2023.2022.0158
Abstract:
In this paper, Zn-Fe layered double hydroxides (LDHs) modified quartz sand was prepared by coprecipitation method and cultivated with inoculation of Shewanella putrefaciens CN32 under aerobic, anaerobic and alternating conditions, to examine the biofilm formation process on LDHs modified matrix and its removal efficiency of BDE-47 as the target pollutant. The biotic and abiotic removal mechanisms of BDE-47 were further explored by monitoring variations of Fe2+ and H2O2 concentrations in the reaction systems. The results showed that LDHs coating would not affect the formation of biofilm on the surface of the modified quartz sand, but Zn-Fe LDHs modified matrix showed certain inhibitory effect on electron transport system activity of CN32 under aerobic condition, while the composition of extracellular polymer substance (EPS) of matrix biofilm changed with an increase in the proportion of polysaccharide under anaerobic condition. Total concentrations of EPS in the matrix biofilm reaction systems were significantly higher than those in the pure CN32system under both aerobic and anaerobic conditions.The formation of matrix biofilm significantly improved the removal efficiency of BDE-47 in the reaction system (about 25%) under aerobic and anaerobic alternating condition. Under the alternating condition, the removal of BDE-47 in the first three cycles (within 72h) depended mainly on matrix adsorption; while 72h later, biofilm adsorption and biodegradation contributed together, and LDHs modified matrix exhibited greater boost potential in the later stage. This study demonstrated the biofilm formation characteristics of LDHs modified matrix and its potential for the removal of PBDEs from the aqueous phase, and provided new ideas for enhancing the biodegradation of PBDEs in constructed wetlands.
In this paper, Zn-Fe layered double hydroxides (LDHs) modified quartz sand was prepared by coprecipitation method and cultivated with inoculation of Shewanella putrefaciens CN32 under aerobic, anaerobic and alternating conditions, to examine the biofilm formation process on LDHs modified matrix and its removal efficiency of BDE-47 as the target pollutant. The biotic and abiotic removal mechanisms of BDE-47 were further explored by monitoring variations of Fe2+ and H2O2 concentrations in the reaction systems. The results showed that LDHs coating would not affect the formation of biofilm on the surface of the modified quartz sand, but Zn-Fe LDHs modified matrix showed certain inhibitory effect on electron transport system activity of CN32 under aerobic condition, while the composition of extracellular polymer substance (EPS) of matrix biofilm changed with an increase in the proportion of polysaccharide under anaerobic condition. Total concentrations of EPS in the matrix biofilm reaction systems were significantly higher than those in the pure CN32system under both aerobic and anaerobic conditions.The formation of matrix biofilm significantly improved the removal efficiency of BDE-47 in the reaction system (about 25%) under aerobic and anaerobic alternating condition. Under the alternating condition, the removal of BDE-47 in the first three cycles (within 72h) depended mainly on matrix adsorption; while 72h later, biofilm adsorption and biodegradation contributed together, and LDHs modified matrix exhibited greater boost potential in the later stage. This study demonstrated the biofilm formation characteristics of LDHs modified matrix and its potential for the removal of PBDEs from the aqueous phase, and provided new ideas for enhancing the biodegradation of PBDEs in constructed wetlands.
,
Available online
, doi: 10.7541/2023.2022.0165
Abstract:
Cadmium is the first of the heavy metal pollutants to be controlled in water. Metallothionein is one of the key proteins that can bind to cadmium and regulate the oxidative stress response of organisms. The protozoan MT has been reported in two ciliates, Tetrahymena and Paramecium. In this study, we obtained a northeast population of Colpoda inflata with high cadmium tolerance. Metallothionein content of C. inflata showed a positive correlation with cadmium concentration and growth rate of population in five gradient concentration of cadmium stress experimental groups from 24—96h. The highest cd-tolerance concentration was 10 mg/L in 96h. Metallothionein gene of Colpoda inflata was cloned and named Col-MT1. The gene sequence and amino-acid sequence were analyzed. The results showed that Col-MT1 had high homology with the amino acid sequences of other ciliates, and contains two conserved sites XXCXX and XCCX. It was a new member of subtype 7a of metallothionein gene family. TASSER protein model predicted that the secondary structure of Col-MT1 protein was composed of α-helix, β-folding and random crimp, accounting for 67.90%, 11.11% and 20.98%, respectively. SWISS-MODEL predicted that the 3D structure of Col-MT1 protein was the most similar to that of cyanobacteria metallothionein. qRT-PCR experiment confirmed that at 60h, 84h and 108h, the expression of Col-MT1 gene was up-regulated to different concentration cadmium and showed a dose-response relationship with cadmium concentration. The molecular mechanism of gene expression still needs further study. Above results supplemented the MT gene database of protozoa and lay a foundation for revealing the mechanism of C. inflata MT gene. As well as provide reference for monitoring and remediation of cadmium pollution.
Cadmium is the first of the heavy metal pollutants to be controlled in water. Metallothionein is one of the key proteins that can bind to cadmium and regulate the oxidative stress response of organisms. The protozoan MT has been reported in two ciliates, Tetrahymena and Paramecium. In this study, we obtained a northeast population of Colpoda inflata with high cadmium tolerance. Metallothionein content of C. inflata showed a positive correlation with cadmium concentration and growth rate of population in five gradient concentration of cadmium stress experimental groups from 24—96h. The highest cd-tolerance concentration was 10 mg/L in 96h. Metallothionein gene of Colpoda inflata was cloned and named Col-MT1. The gene sequence and amino-acid sequence were analyzed. The results showed that Col-MT1 had high homology with the amino acid sequences of other ciliates, and contains two conserved sites XXCXX and XCCX. It was a new member of subtype 7a of metallothionein gene family. TASSER protein model predicted that the secondary structure of Col-MT1 protein was composed of α-helix, β-folding and random crimp, accounting for 67.90%, 11.11% and 20.98%, respectively. SWISS-MODEL predicted that the 3D structure of Col-MT1 protein was the most similar to that of cyanobacteria metallothionein. qRT-PCR experiment confirmed that at 60h, 84h and 108h, the expression of Col-MT1 gene was up-regulated to different concentration cadmium and showed a dose-response relationship with cadmium concentration. The molecular mechanism of gene expression still needs further study. Above results supplemented the MT gene database of protozoa and lay a foundation for revealing the mechanism of C. inflata MT gene. As well as provide reference for monitoring and remediation of cadmium pollution.
,
Available online
, doi: 10.7541/2023.2022.0201
Abstract:
This experiment was conducted to investigate the effects of dietary black soldier fly (Hermetia illucens) larvae meal on growth performance, non-specific immunity and lipid metabolism of Litopenaeus vannamei. The control diet (FM) contained 25% fishmeal and then 10% (BSF10), 20% (BSF20) and 30% (BSF30) of fishmeal protein were replaced by black soldier fly larvae meal to formulate four isonitrogenous and isolipidic diets. Shrimps with an initial body weight of (0.88±0.01) g were fed four times daily for 7 weeks. Results showed that there were no significant differences in growth performance of shrimp fed BSF10 and BSF20 diets compared to FM group (P>0.05), but the growth performance of the shrimp in the BSF30 group significantly reduced (P<0.05). The whole shrimp crude lipid content was significantly lower in the BSF20 and BSF30 groups, and the hemolymph triglyceride and total cholesterol levels were significantly lower in the BSF30 group compared to FM group (P<0.05), but there were no significantly different in crude lipid of hepatopancreas among the four groups (P>0.05). The activities of hemolymph alanine aminotransferase and aspartate aminotransferase significantly decreased in the BSF10, BSF20 and BSF30 groups compared to FM group (P<0.05). The total antioxidant capacity of BSF20 group was significantly higher than that of the other groups, and superoxide dismutase activity of BSF10 group was significantly higher than that of FM group (P<0.05). The hepatopancreas acid phosphatase and alkaline phosphatase activities were significantly lower in the BSF30 group than in the FM group (P<0.05). The lipase activity of BSF30 group was significantly lower than BSF10 group (P<0.05). The fatty acid synthase activity in BSF10 and BSF20 groups was significantly higher than that in FM group, the carnitine palmitoyl transferase activity in BSF20 group was significantly higher than the other three groups, and the activity of isocitrate dehydrogenase in BSF30 group was significantly higher than that in FM group (P<0.05). The activities of hemolymph lipid triglyceride lipase and α-ketoglutarate dehydrogenase in BSF10, BSF20 and BSF30 groups were significantly higher than those in FM group (P<0.05). To conclude, replacing 10% or 20% of fishmeal with black soldier fly larvae meal had no negative effect on the growth performance of Litopenaeus vannamei, improved the antioxidant capacity of shrimp and reduced the hemolymph glutamate transaminase and glutamic acid transaminase activities. The crude lipid of whole shrimp significantly reduced in BSF20 group, and when the replacing level reached to 30%, the activity of enzymes related to lipid catabolism and tricarboxylic acid cycle was significantly increased, which further promoted the lipid metabolism of shrimp.
This experiment was conducted to investigate the effects of dietary black soldier fly (Hermetia illucens) larvae meal on growth performance, non-specific immunity and lipid metabolism of Litopenaeus vannamei. The control diet (FM) contained 25% fishmeal and then 10% (BSF10), 20% (BSF20) and 30% (BSF30) of fishmeal protein were replaced by black soldier fly larvae meal to formulate four isonitrogenous and isolipidic diets. Shrimps with an initial body weight of (0.88±0.01) g were fed four times daily for 7 weeks. Results showed that there were no significant differences in growth performance of shrimp fed BSF10 and BSF20 diets compared to FM group (P>0.05), but the growth performance of the shrimp in the BSF30 group significantly reduced (P<0.05). The whole shrimp crude lipid content was significantly lower in the BSF20 and BSF30 groups, and the hemolymph triglyceride and total cholesterol levels were significantly lower in the BSF30 group compared to FM group (P<0.05), but there were no significantly different in crude lipid of hepatopancreas among the four groups (P>0.05). The activities of hemolymph alanine aminotransferase and aspartate aminotransferase significantly decreased in the BSF10, BSF20 and BSF30 groups compared to FM group (P<0.05). The total antioxidant capacity of BSF20 group was significantly higher than that of the other groups, and superoxide dismutase activity of BSF10 group was significantly higher than that of FM group (P<0.05). The hepatopancreas acid phosphatase and alkaline phosphatase activities were significantly lower in the BSF30 group than in the FM group (P<0.05). The lipase activity of BSF30 group was significantly lower than BSF10 group (P<0.05). The fatty acid synthase activity in BSF10 and BSF20 groups was significantly higher than that in FM group, the carnitine palmitoyl transferase activity in BSF20 group was significantly higher than the other three groups, and the activity of isocitrate dehydrogenase in BSF30 group was significantly higher than that in FM group (P<0.05). The activities of hemolymph lipid triglyceride lipase and α-ketoglutarate dehydrogenase in BSF10, BSF20 and BSF30 groups were significantly higher than those in FM group (P<0.05). To conclude, replacing 10% or 20% of fishmeal with black soldier fly larvae meal had no negative effect on the growth performance of Litopenaeus vannamei, improved the antioxidant capacity of shrimp and reduced the hemolymph glutamate transaminase and glutamic acid transaminase activities. The crude lipid of whole shrimp significantly reduced in BSF20 group, and when the replacing level reached to 30%, the activity of enzymes related to lipid catabolism and tricarboxylic acid cycle was significantly increased, which further promoted the lipid metabolism of shrimp.
,
Available online
, doi: 10.7541/2023.2022.0179
Abstract:
VP39 is a protein encoded by S9 gene of type Ⅲ grass carp reovirus (GCRV-Ⅲ). In order to study the biological function of VP39 protein in the process of GCRV infection of grass carp cells, the sequence of VP39 gene was cloned and the prokaryotic expression vector PET32A-VP39 was constructed. The fusion protein VP39-HIS was obtained by using prokaryotic expression method. Mouse anti-VP39 polyclonal antibody was prepared by immunizing mice with VP39solution protein, and the antibody was evaluated by Western Blot. The polyclonal antibody was used to investigate the expression dynamics of VP39 protein in GCRV infected cells. The results of SDS-PAGE showed that the fusion protein of vp39-his was well soluble in PBS and the protein size was about 39kDa. Western Blot analysis showed that the prepared VP39 polyclonal antibody could recognize both the prokaryotic expression of VP39-HIS fusion protein and the expression of VP39 protein after GCRV infection with CIK cells at the dilution ratio of 1:10000, showing good titer and specificity. In the process of virus infection, the expression of VP39 was low in the early stage and high in the middle and late stage. Two peptides were screened by phage display technology for specific binding to VP39 protein, and further bioinformatics analysis also found that 7 genes in grass carp genome had homology with the peptide, indicating that these genes may interact with VP39. In this study, mouse anti-VP39 polyclonal antibody was prepared, which provided a new immunological method for GCRV-Ⅲ detection. The screening of binding peptides also laid a foundation for the study of the biological function of VP39 in the process of GCRV infection.
VP39 is a protein encoded by S9 gene of type Ⅲ grass carp reovirus (GCRV-Ⅲ). In order to study the biological function of VP39 protein in the process of GCRV infection of grass carp cells, the sequence of VP39 gene was cloned and the prokaryotic expression vector PET32A-VP39 was constructed. The fusion protein VP39-HIS was obtained by using prokaryotic expression method. Mouse anti-VP39 polyclonal antibody was prepared by immunizing mice with VP39solution protein, and the antibody was evaluated by Western Blot. The polyclonal antibody was used to investigate the expression dynamics of VP39 protein in GCRV infected cells. The results of SDS-PAGE showed that the fusion protein of vp39-his was well soluble in PBS and the protein size was about 39kDa. Western Blot analysis showed that the prepared VP39 polyclonal antibody could recognize both the prokaryotic expression of VP39-HIS fusion protein and the expression of VP39 protein after GCRV infection with CIK cells at the dilution ratio of 1:10000, showing good titer and specificity. In the process of virus infection, the expression of VP39 was low in the early stage and high in the middle and late stage. Two peptides were screened by phage display technology for specific binding to VP39 protein, and further bioinformatics analysis also found that 7 genes in grass carp genome had homology with the peptide, indicating that these genes may interact with VP39. In this study, mouse anti-VP39 polyclonal antibody was prepared, which provided a new immunological method for GCRV-Ⅲ detection. The screening of binding peptides also laid a foundation for the study of the biological function of VP39 in the process of GCRV infection.
,
Available online
, doi: 10.7541/2023.2022.0172
Abstract:
The apparent digestibility coefficients (ADCs) of Tenebrio molitor meal (TMM), Hermetia illucens meal (HIM), Clostridium autoethanogenum protein (CAP), Methylococcus capsulatus meal (MCM), Chlorella vullgaris meal (CVM), Cottonseed protein concentrate (CPC) and Peruvian fishmeal (PFM) were determined in juvenile hybrid grouper (Epinephelus fuscoguttatus♀×Epinephelus lanceolatu♂). A basal diet (including 50% fishmeal) and seven test diets (700 g/kg of the basal diet and 300 g/kg of each test ingredient) were formulated with 0.1% yttrium oxide (Y2O3) as an inert marker. The juvenile hybrid groupers, with initial average body weight of (9.95±0.50) g, were randomly distributed into 0.3 m³ fiberglass tanks, each tank with 30 fish. The faeces samples were collected twice-daily by siphoning following feeding fish after five days of domestication. The ADCs of dry matter of seven test ingredients were ranked as CVM>TMM=CAP=CPC>HIM=MCM=PFM (P<0.05). CVM showed the highest ADCs of dry matter (DM), crude protein (CP) and most amino acids (including methionine and threonine) except crude lipids (CL), whereas HIM had the relatively lower ADCs of DM, CP and most amino acids except CL. CAP had a higher lysine digestibility than the other six test ingredients, and was only lower than CVM in the ADC of CP. The ADC of DM in PFM was significantly lower than that in CVM (P<0.05), and showed no differences with that in CAP (P>0.05). Besides, PFM showed a lower ADC of CP than the ADCs of CP in CVM, CAP and MCM (P<0.05), and showed a lower ADC of lysine than that in CAP as well as a lower ADC of threonine than those in CAP and CVM (P<0.05). Overall, this study showed the advantage of CVM and CAP among the seven protein sources on the digestibility of feed available in hybrid grouper.
The apparent digestibility coefficients (ADCs) of Tenebrio molitor meal (TMM), Hermetia illucens meal (HIM), Clostridium autoethanogenum protein (CAP), Methylococcus capsulatus meal (MCM), Chlorella vullgaris meal (CVM), Cottonseed protein concentrate (CPC) and Peruvian fishmeal (PFM) were determined in juvenile hybrid grouper (Epinephelus fuscoguttatus♀×Epinephelus lanceolatu♂). A basal diet (including 50% fishmeal) and seven test diets (700 g/kg of the basal diet and 300 g/kg of each test ingredient) were formulated with 0.1% yttrium oxide (Y2O3) as an inert marker. The juvenile hybrid groupers, with initial average body weight of (9.95±0.50) g, were randomly distributed into 0.3 m³ fiberglass tanks, each tank with 30 fish. The faeces samples were collected twice-daily by siphoning following feeding fish after five days of domestication. The ADCs of dry matter of seven test ingredients were ranked as CVM>TMM=CAP=CPC>HIM=MCM=PFM (P<0.05). CVM showed the highest ADCs of dry matter (DM), crude protein (CP) and most amino acids (including methionine and threonine) except crude lipids (CL), whereas HIM had the relatively lower ADCs of DM, CP and most amino acids except CL. CAP had a higher lysine digestibility than the other six test ingredients, and was only lower than CVM in the ADC of CP. The ADC of DM in PFM was significantly lower than that in CVM (P<0.05), and showed no differences with that in CAP (P>0.05). Besides, PFM showed a lower ADC of CP than the ADCs of CP in CVM, CAP and MCM (P<0.05), and showed a lower ADC of lysine than that in CAP as well as a lower ADC of threonine than those in CAP and CVM (P<0.05). Overall, this study showed the advantage of CVM and CAP among the seven protein sources on the digestibility of feed available in hybrid grouper.
,
Available online
, doi: 10.7541/2023.2022.0129
Abstract:
Chinese sturgeon (Acipenser sinensis) is a large anadromous migratory fish. In order to understand the immune characteristics of freshwater cultured Chinese sturgeon in seawater, a 5-month mariculture trial was conducted with 4-year-old Chinese sturgeons, and the adaptive changes of blood physiology, biochemistry and immune tissue were explored. The results showed that the white blood cell counts were significantly increased (P<0.05), and there was no significant difference on red blood cell count. But the hemoglobin and hematocrit increased significantly in the seawater from (46.50±10.59) g/L, (13.7±3.23)%, (9.19±1.10)×109/L to (74.5±1.10) 11.05) g/L, (21.80±3.33)% and (10.88±3.73)×109/L, respectively. In the differential count of white blood cells, lymphocytes accounted for the largest proportion, followed by neutrophils, and there was no significant difference in the percentages of various types of white blood cells. Blood biochemical indexes such as SOD, MDA, LZM, IgM, AKP and ACP have no significant changes in freshwater and seawater. Observation of immune tissue structure showed that there was no obvious change in the thymus in seawater, but the cells were aggregated, the shape distribution was more orderly and the center of melanin macrophages increased in the head kidney tissue; Lymphocytes and red blood cells are more densely distributed in the spleen tissue. The results showed that marine aquaculture can enhance the immunity and hematopoietic function of Chinese sturgeon to a certain extent, and maintain a good physiological state.
Chinese sturgeon (Acipenser sinensis) is a large anadromous migratory fish. In order to understand the immune characteristics of freshwater cultured Chinese sturgeon in seawater, a 5-month mariculture trial was conducted with 4-year-old Chinese sturgeons, and the adaptive changes of blood physiology, biochemistry and immune tissue were explored. The results showed that the white blood cell counts were significantly increased (P<0.05), and there was no significant difference on red blood cell count. But the hemoglobin and hematocrit increased significantly in the seawater from (46.50±10.59) g/L, (13.7±3.23)%, (9.19±1.10)×109/L to (74.5±1.10) 11.05) g/L, (21.80±3.33)% and (10.88±3.73)×109/L, respectively. In the differential count of white blood cells, lymphocytes accounted for the largest proportion, followed by neutrophils, and there was no significant difference in the percentages of various types of white blood cells. Blood biochemical indexes such as SOD, MDA, LZM, IgM, AKP and ACP have no significant changes in freshwater and seawater. Observation of immune tissue structure showed that there was no obvious change in the thymus in seawater, but the cells were aggregated, the shape distribution was more orderly and the center of melanin macrophages increased in the head kidney tissue; Lymphocytes and red blood cells are more densely distributed in the spleen tissue. The results showed that marine aquaculture can enhance the immunity and hematopoietic function of Chinese sturgeon to a certain extent, and maintain a good physiological state.
,
Available online
, doi: 10.7541/2023.2022.0075
Abstract:
This experiment was conducted to investigate the effect of purging time on muscle quality and nutritional value of yellow catfish (Pelteobagrus fulvidraco) under open flowing water mode. Yellow catfish of (15.69±2.28) g at the rapid growth stage were randomly divided into 4 groups with 3 replicates in each group. The yellow catfish were temporarily fed for 0 (control), 20, 30 and 40 days respectively. During the experiment, Pelteobagrus fulvidraco were fed with a compound diet, and the water quality was regularly measured during the breeding process. After the experiment, the growth performance and serum biochemical indexes were measured; the composition of amino acids, fatty acids and textural properties in muscle were compared. The results showed as follows: 1) During the purging time period, the content of ammonia nitrogen in the water of the test tank was between 0.03—0.05 mg/L, the content of nitrite nitrogen was 0.01 mg/L, and the dissolved oxygen level exceeded 9.0 mg/L. 2) With the extension of purging time, the final body weight (Wt) and weight gain rate (WGR) of yellow catfish showed an increasing trend, while the specific growth rate (SGR) showed a decreasing trend, with significant differences among groups (P<0.05). There were no significant differences in survival rate (SR), condition factor (CF), hepatosomatic index (HSI) and viscerosomatic index (VSI) of purging time groups for 20, 30 and 40 days (P>0.05). 3) The contents of albumin (ALB) and total protein (TP) in serum of purging time 30 and 40 days group were significantly higher than those of control group and purging time of 20 days group (P<0.05), but the activities of gamma-glutamyltransferase (γ-GGT), alkaline phosphatase (ALP), the contents of total cholesterol (TC) and total bile acids (TBA) were significantly lower than those of the control group and the purging time of 20 days group; serum total bilirubin (TBIL) content and aspartate aminotransferase (AST) activity in the control group, the purging time of 20 days and 30 days groups were significantly higher than those of the purging time group for 40 days (P<0.05). The content of serum creatinine (CRE) and urine creatinine ratio (UCR) of Pelteobagrus fulvidraco in the purging time groups for 30 and 40 days were significantly lower than those in the control group and the purging time for 20 days group (P<0.05). 4) The crude protein content in muscle of purging time groups for 30 and 40 days was significantly higher than that of control group and purging time group for 20 days (P<0.05), but the crude lipid content was significantly lower than that of control group and purging time group for 20 days (P<0.05). 5) The total amount of amino acids (ΣAA), total essential amino acids (ΣEAA), total non-essential amino acids (ΣNEAA), total umami amino acids (ΣDAA) and essential amino acid index (EAAI) in the 30d and 40d purging time groups were significantly higher than those in the control group and the 20d purging time group (P<0.05). The first limiting amino acid in muscle of four groups was all phenylalanine+tyrosine. 6) The contents of C20:5n-3+C22:6n-3 (EPA+DHA), monounsaturated fatty acid (MUFA) and polyunsaturated fatty acid (PUFA) in muscle of yellow catfish in purging time group for 40 days were significantly higher than those in other groups (P<0.05). 7) The muscle hardness and gumminess properties of purging time group for 40d was significantly higher than those in other groups (P<0.05), and the muscle springiness, chewiness and resilience were significantly higher than those of control group and purging time group for 20d (P<0.05). In this experiment, under the conditions of temporary cultivation, purging time for 40 days can improve the muscle quality and nutritional value of yellow catfish, increase the contents of amino acids and fatty acids, reduce the earthen smell of pond cultured fish, and increase the aquaculture benefit of Pelteobagrus fulvidraco.
This experiment was conducted to investigate the effect of purging time on muscle quality and nutritional value of yellow catfish (Pelteobagrus fulvidraco) under open flowing water mode. Yellow catfish of (15.69±2.28) g at the rapid growth stage were randomly divided into 4 groups with 3 replicates in each group. The yellow catfish were temporarily fed for 0 (control), 20, 30 and 40 days respectively. During the experiment, Pelteobagrus fulvidraco were fed with a compound diet, and the water quality was regularly measured during the breeding process. After the experiment, the growth performance and serum biochemical indexes were measured; the composition of amino acids, fatty acids and textural properties in muscle were compared. The results showed as follows: 1) During the purging time period, the content of ammonia nitrogen in the water of the test tank was between 0.03—0.05 mg/L, the content of nitrite nitrogen was 0.01 mg/L, and the dissolved oxygen level exceeded 9.0 mg/L. 2) With the extension of purging time, the final body weight (Wt) and weight gain rate (WGR) of yellow catfish showed an increasing trend, while the specific growth rate (SGR) showed a decreasing trend, with significant differences among groups (P<0.05). There were no significant differences in survival rate (SR), condition factor (CF), hepatosomatic index (HSI) and viscerosomatic index (VSI) of purging time groups for 20, 30 and 40 days (P>0.05). 3) The contents of albumin (ALB) and total protein (TP) in serum of purging time 30 and 40 days group were significantly higher than those of control group and purging time of 20 days group (P<0.05), but the activities of gamma-glutamyltransferase (γ-GGT), alkaline phosphatase (ALP), the contents of total cholesterol (TC) and total bile acids (TBA) were significantly lower than those of the control group and the purging time of 20 days group; serum total bilirubin (TBIL) content and aspartate aminotransferase (AST) activity in the control group, the purging time of 20 days and 30 days groups were significantly higher than those of the purging time group for 40 days (P<0.05). The content of serum creatinine (CRE) and urine creatinine ratio (UCR) of Pelteobagrus fulvidraco in the purging time groups for 30 and 40 days were significantly lower than those in the control group and the purging time for 20 days group (P<0.05). 4) The crude protein content in muscle of purging time groups for 30 and 40 days was significantly higher than that of control group and purging time group for 20 days (P<0.05), but the crude lipid content was significantly lower than that of control group and purging time group for 20 days (P<0.05). 5) The total amount of amino acids (ΣAA), total essential amino acids (ΣEAA), total non-essential amino acids (ΣNEAA), total umami amino acids (ΣDAA) and essential amino acid index (EAAI) in the 30d and 40d purging time groups were significantly higher than those in the control group and the 20d purging time group (P<0.05). The first limiting amino acid in muscle of four groups was all phenylalanine+tyrosine. 6) The contents of C20:5n-3+C22:6n-3 (EPA+DHA), monounsaturated fatty acid (MUFA) and polyunsaturated fatty acid (PUFA) in muscle of yellow catfish in purging time group for 40 days were significantly higher than those in other groups (P<0.05). 7) The muscle hardness and gumminess properties of purging time group for 40d was significantly higher than those in other groups (P<0.05), and the muscle springiness, chewiness and resilience were significantly higher than those of control group and purging time group for 20d (P<0.05). In this experiment, under the conditions of temporary cultivation, purging time for 40 days can improve the muscle quality and nutritional value of yellow catfish, increase the contents of amino acids and fatty acids, reduce the earthen smell of pond cultured fish, and increase the aquaculture benefit of Pelteobagrus fulvidraco.
,
Available online
, doi: 10.7541/2023.2022.0193
Abstract:
The hypoxia and thermal tolerances of fish are important physiological characteristics that determine their distribution, habitat change, and adaptability to climate change. While in the nature, fish are always in the process of swimming or recovery of post-exercise, whether the hypoxia and thermal tolerances change during swimming or immediately after exhaustive recovery process is unknown for fish. Thus, to study the effects of exhaustion exercise stress on fish hypoxia and thermal tolerances, we investigated three cyprinid fish species (i.e. Carassius auratus, Spinibarbus sinensis and Cyprinus carpio) living in different habitats as study cases. Hypoxia and the thermal tolerance indicators of the three fish species were measured after exhaustion exercise, respectively, to determine whether exhaustion exercise stress would affect the stress resistance of fish. In the present study, we found that body weight only affected significantly on minimal critical temperature (CTmin), and the indicators of hypoxia and thermal tolerances were different significantly between species. Moreover, exhaustion exercise stress led to a significant increase in critical oxygen tension (Pcrit) of common carp and a significant increase in critical metabolic rate (CMR) of all the three species as well, but a significant decrease in point of oxygen tension for loss of equilibrium (LOE) of qingbo. Meanwhile, it also resulted in a significant decrease in maximal critical temperature (CTmax) of goldfish and qingbo. However, there was no significant effect on the species and other related measured parameters besides the fish species and their corresponding experimental parameters mentioned above. It could be said based on the results that changes in the hypoxia and thermal tolerances of fish living in different habitats are different after exhaustion exercise stress, and that fish species vary in physiological mechanisms responding to other environmental stressors following exhaustion exercise stress, which may be related to difference in their energy metabolism patterns.
The hypoxia and thermal tolerances of fish are important physiological characteristics that determine their distribution, habitat change, and adaptability to climate change. While in the nature, fish are always in the process of swimming or recovery of post-exercise, whether the hypoxia and thermal tolerances change during swimming or immediately after exhaustive recovery process is unknown for fish. Thus, to study the effects of exhaustion exercise stress on fish hypoxia and thermal tolerances, we investigated three cyprinid fish species (i.e. Carassius auratus, Spinibarbus sinensis and Cyprinus carpio) living in different habitats as study cases. Hypoxia and the thermal tolerance indicators of the three fish species were measured after exhaustion exercise, respectively, to determine whether exhaustion exercise stress would affect the stress resistance of fish. In the present study, we found that body weight only affected significantly on minimal critical temperature (CTmin), and the indicators of hypoxia and thermal tolerances were different significantly between species. Moreover, exhaustion exercise stress led to a significant increase in critical oxygen tension (Pcrit) of common carp and a significant increase in critical metabolic rate (CMR) of all the three species as well, but a significant decrease in point of oxygen tension for loss of equilibrium (LOE) of qingbo. Meanwhile, it also resulted in a significant decrease in maximal critical temperature (CTmax) of goldfish and qingbo. However, there was no significant effect on the species and other related measured parameters besides the fish species and their corresponding experimental parameters mentioned above. It could be said based on the results that changes in the hypoxia and thermal tolerances of fish living in different habitats are different after exhaustion exercise stress, and that fish species vary in physiological mechanisms responding to other environmental stressors following exhaustion exercise stress, which may be related to difference in their energy metabolism patterns.
,
Available online
, doi: 10.7541/2023.2022.0159
Abstract:
According to the 1896samples of Sthenoteuthis oualaniensis collected by Chinese light falling-net fishery during the same months (February-May) in the northwest Indian Ocean, this study presents the differences of fisheries biological characteristics of Sthenoteuthis oualaniensis between 2019 (Ei-Niño) and 2020 (normal). The result indicated that the mantle length (ML) range and dominant ML group of 2019 were larger than that of 2020, especially for females. The ML range of females in both years were 129—347and 284—582 mm, and the dominant ML group were 171—220 and 481—530 mm, respectively. The ML range of males were 138—273 and 94—235 mm, and both of the dominant ML group were 171—220 mm. The analysis of covariance (ANCOVA) showed that the relationships between body weight (BW) and ML of Sthenoteuthis oualaniensis in different years was significantly different between the sexes. By fitting and optimizing the equations and comparing the AIC (Akaike’s information criterion), the relationship between ML and BW of males were most suitable to be expressed by exponential functions, except for the males of 2020 when the relationship between ML and BW of males was most suitable to be expressed by a exponential function. The relationships between ML and BW for both the 2019 and 2020 were the best expressed as power functions, except for the relationship between ML and BW for the 2020 males, which were the best expressed by a exponential function. The gonad maturity composition varied between different years, the females were mostly at immature stages (I and II) in 2019 but mature stages (stages III and IV) in 2020, while the males were mostly at stages II and III in 2019 but mature stages (III and IV) in 2020. The age composition and hatching characteristics differed between years, the females ranged from 97—263d and 148—267d, and dominant age groups were 171—200d and 231—260d with hatching dates from June to December and May to October, and peaked in August-September and July-August, respectively. The males age ranged from 131—253d and 133—221d, with a dominant age 171—200d for both years, and the hatching dates were from August to December and September to December, and the peak periods were September-November and October-November, respectively. This study shows that the fisheries biology of Sthenoteuthis oualaniensisthe in the northwest Indian Ocean varies from climate year to climate.
According to the 1896samples of Sthenoteuthis oualaniensis collected by Chinese light falling-net fishery during the same months (February-May) in the northwest Indian Ocean, this study presents the differences of fisheries biological characteristics of Sthenoteuthis oualaniensis between 2019 (Ei-Niño) and 2020 (normal). The result indicated that the mantle length (ML) range and dominant ML group of 2019 were larger than that of 2020, especially for females. The ML range of females in both years were 129—347and 284—582 mm, and the dominant ML group were 171—220 and 481—530 mm, respectively. The ML range of males were 138—273 and 94—235 mm, and both of the dominant ML group were 171—220 mm. The analysis of covariance (ANCOVA) showed that the relationships between body weight (BW) and ML of Sthenoteuthis oualaniensis in different years was significantly different between the sexes. By fitting and optimizing the equations and comparing the AIC (Akaike’s information criterion), the relationship between ML and BW of males were most suitable to be expressed by exponential functions, except for the males of 2020 when the relationship between ML and BW of males was most suitable to be expressed by a exponential function. The relationships between ML and BW for both the 2019 and 2020 were the best expressed as power functions, except for the relationship between ML and BW for the 2020 males, which were the best expressed by a exponential function. The gonad maturity composition varied between different years, the females were mostly at immature stages (I and II) in 2019 but mature stages (stages III and IV) in 2020, while the males were mostly at stages II and III in 2019 but mature stages (III and IV) in 2020. The age composition and hatching characteristics differed between years, the females ranged from 97—263d and 148—267d, and dominant age groups were 171—200d and 231—260d with hatching dates from June to December and May to October, and peaked in August-September and July-August, respectively. The males age ranged from 131—253d and 133—221d, with a dominant age 171—200d for both years, and the hatching dates were from August to December and September to December, and the peak periods were September-November and October-November, respectively. This study shows that the fisheries biology of Sthenoteuthis oualaniensisthe in the northwest Indian Ocean varies from climate year to climate.
,
Available online
, doi: 10.7541/2023.2022.0152
Abstract:
Female P. trituberculatus at different stages of ovarian development (stage I—V) were investigated for their color, carotenoids contents, antioxidant and non-specific immune parameters. The results indicated that: (1) the gonadosomatic index (GSI) increased significantly (P<0.05), while the hepatosomatic index (HSI) rose slightly, then declined gradually. The redness (a*) and yellowness (b*) values in ovaries showed an increasing trend, as did lightness (L*) and b* values in hepatopancreas, but L* values in ovaries showed a decreasing trend. (2) Total carotenoids, astaxanthin, zeaxanthin and β-carotene content in ovaries showed an increasing trend followed by a decreasing trend, with the highest astaxanthin content in stage IV. Astaxanthin content in hepatopancreas was on the rise, while β-carotene was on a significant decline. Regarding the content of carotenoids in different tissues, the epithelium contained the highest amount of astaxanthin. L* values in the ovary and hepatopancreas exhibited a significant negative correlation with total carotenoids, and a* and b* values in the ovary both showed a significant positive correlation with total carotenoids, astaxanthin, luteolin, echinenone and β-carotene. There was no significant correlation between a* values and various carotenoids in hepatopancreas, and b* values only showed a significant positive correlation with astaxanthin. (3) For antioxidant indexes, T-AOC in hepatopancreas showed a significant decrease in stage I—V (P<0.05), while SOD, CAT and GPX showed an "increasing and then decreasing" trend. The T-AOC in hemolymph showed a trend of "high-low-high-low". SOD and GPX showed an increasing trend and then decreasing trend, while CAT and MDA showed a "low-high-low-high" trend. In terms of immune indexes, ACP, ALP and NO in the hepatopancreas showed an overall decreasing trend during ovarian development, while ACP, ALP and Hc in the hemolymph showed an increasing trend in stage I—IV and a slight decrease in stage V. (4) Correlation analysis showed that astaxanthin content in hepatopancreas was significantly negatively correlated with T-AOC, lutein content was significantly positively correlated with GPX (P<0.01), and no significant correlation was found between the other carotenoids content and antioxidant indexes. In conclusion, the increase of total carotenoids, astaxanthin and β-carotene in the ovaries of P. trituberculatus occurred mainly in stage II-IV, while most of the carotenoids in the epithelium showed a significant decreasing trend and only astaxanthin in the hepatopancreas showed an increasing trend.
Female P. trituberculatus at different stages of ovarian development (stage I—V) were investigated for their color, carotenoids contents, antioxidant and non-specific immune parameters. The results indicated that: (1) the gonadosomatic index (GSI) increased significantly (P<0.05), while the hepatosomatic index (HSI) rose slightly, then declined gradually. The redness (a*) and yellowness (b*) values in ovaries showed an increasing trend, as did lightness (L*) and b* values in hepatopancreas, but L* values in ovaries showed a decreasing trend. (2) Total carotenoids, astaxanthin, zeaxanthin and β-carotene content in ovaries showed an increasing trend followed by a decreasing trend, with the highest astaxanthin content in stage IV. Astaxanthin content in hepatopancreas was on the rise, while β-carotene was on a significant decline. Regarding the content of carotenoids in different tissues, the epithelium contained the highest amount of astaxanthin. L* values in the ovary and hepatopancreas exhibited a significant negative correlation with total carotenoids, and a* and b* values in the ovary both showed a significant positive correlation with total carotenoids, astaxanthin, luteolin, echinenone and β-carotene. There was no significant correlation between a* values and various carotenoids in hepatopancreas, and b* values only showed a significant positive correlation with astaxanthin. (3) For antioxidant indexes, T-AOC in hepatopancreas showed a significant decrease in stage I—V (P<0.05), while SOD, CAT and GPX showed an "increasing and then decreasing" trend. The T-AOC in hemolymph showed a trend of "high-low-high-low". SOD and GPX showed an increasing trend and then decreasing trend, while CAT and MDA showed a "low-high-low-high" trend. In terms of immune indexes, ACP, ALP and NO in the hepatopancreas showed an overall decreasing trend during ovarian development, while ACP, ALP and Hc in the hemolymph showed an increasing trend in stage I—IV and a slight decrease in stage V. (4) Correlation analysis showed that astaxanthin content in hepatopancreas was significantly negatively correlated with T-AOC, lutein content was significantly positively correlated with GPX (P<0.01), and no significant correlation was found between the other carotenoids content and antioxidant indexes. In conclusion, the increase of total carotenoids, astaxanthin and β-carotene in the ovaries of P. trituberculatus occurred mainly in stage II-IV, while most of the carotenoids in the epithelium showed a significant decreasing trend and only astaxanthin in the hepatopancreas showed an increasing trend.
,
Available online
, doi: 10.7541/2023.2022.0073
Abstract:
In recent years, threat to nearshore marine ecosystems and marine organisms caused by seawater acidification and seawater warming are becoming increasingly serious. In order to study the effects of CO2-driven ocean acidification and warming on growth and energy budget of the sea cucumber Apostichopus japonicus, which is a key species in the coastal ecosystem of East Asia, four experimental treatments were set up, namely, control (seawater temperature of the Dalian coast, pCO2 400 µatm), ocean warming (OW, seawater temperature of the Dalian coast plus 3℃, pCO2 400 µatm), ocean acidification (OA, seawater temperature of the Dalian coast, pCO2 1100 µatm) and Ocean acidification and warming (OAW, seawater temperature of the Dalian coast plus 3℃, pCO2 1100 µatm). The result showed that A. japonicus in OW were not significantly affected in contrast to control. However, the specific growth rate (SGR) of A. japonicus in OA was the lowest, which decreased by 0.19 %/d compared with the control treatment, and the body weight Coefficient variations of A. japonicus in OA was the largest. The final body weight and SGR of A. japonicus in OAW showed no significantly difference with those in control, bur ingestion rate and feces production rate were both significantly higher than those in the control. The bioenergetic pattern of A. japonicus in OW and OA did not change significantly compared with that in the control, but it changed significantly in OAW, with the percentage of the FCE being significantly higher than the other three treatments. Our study suggests that seawater acidification inhibited the growth of A. japonicus versus change its energy distribution pattern. The decrease of growth in OA mainly depended on the decrease of food ingestion. The combined effect of seawater acidification and rising temperature may compensate for the negative effect of seawater acidification on growth by changing the energy distribution pattern of A. japonicus.
In recent years, threat to nearshore marine ecosystems and marine organisms caused by seawater acidification and seawater warming are becoming increasingly serious. In order to study the effects of CO2-driven ocean acidification and warming on growth and energy budget of the sea cucumber Apostichopus japonicus, which is a key species in the coastal ecosystem of East Asia, four experimental treatments were set up, namely, control (seawater temperature of the Dalian coast, pCO2 400 µatm), ocean warming (OW, seawater temperature of the Dalian coast plus 3℃, pCO2 400 µatm), ocean acidification (OA, seawater temperature of the Dalian coast, pCO2 1100 µatm) and Ocean acidification and warming (OAW, seawater temperature of the Dalian coast plus 3℃, pCO2 1100 µatm). The result showed that A. japonicus in OW were not significantly affected in contrast to control. However, the specific growth rate (SGR) of A. japonicus in OA was the lowest, which decreased by 0.19 %/d compared with the control treatment, and the body weight Coefficient variations of A. japonicus in OA was the largest. The final body weight and SGR of A. japonicus in OAW showed no significantly difference with those in control, bur ingestion rate and feces production rate were both significantly higher than those in the control. The bioenergetic pattern of A. japonicus in OW and OA did not change significantly compared with that in the control, but it changed significantly in OAW, with the percentage of the FCE being significantly higher than the other three treatments. Our study suggests that seawater acidification inhibited the growth of A. japonicus versus change its energy distribution pattern. The decrease of growth in OA mainly depended on the decrease of food ingestion. The combined effect of seawater acidification and rising temperature may compensate for the negative effect of seawater acidification on growth by changing the energy distribution pattern of A. japonicus.
,
Available online
, doi: 10.7541/2023.2022.0034
Abstract:
In order to understand the fish community structure in Juma River and its relationship with the environmental factors, 15sampling stations in Juma River were surveyed in May, August and October, 2019, August and October, 2020 and May, 2021. A total of 37 fish were collected, belonging to 11 families and 5 orders. Cypriniformes were the most, accounting for 64.86% of the total species captured. Ecologically, the fish community in Juma River is dominated by demersal and omnivores species and there are fewer carnivorous fish. Compared with the historical data, the number of fish species has decreased. Index Relative Importance (IRI) shows that 10species had IRI≥500, Carassius auratus, Pseudorasbora parva, Zacco platypus were the dominant species. C. auratus, P. parva and Micropercops swinhonis were collected in all seasons and all sampling sites. One-way analysis of variance (ANOVA) showed that the number of individuals (N), species (S), Shannon-Wiener diversity index (H') and Margalef richness index (DMa) of the fish community had significant differences between different seasons, Pielou evenness index (J') showed no significant differences. SNK multiple comparison test showed that the number of individuals and species was the highest in May 2019, Shannon-Wiener diversity index (H') and Margalef richness index (DMa)was the highest in August 2019. The numbers of individuals showed significant differences between different altitudes, an average of 143.91 fishes can be collected at sampling station above 500 meters and only 48.19 fishes can be collected at sampling station below 500 meters. Cluster analysis and Non-metric Multidimensional Scaling (NMDS) divides the source of the Juma River and the Diaojianghui into group Ⅰ, the Zijingguan Bridge and Qingliangjian into group Ⅱ, remaining sites are divided into group Ⅲ. The abundance biomass comparison curve (ABC) showed that the fish community was undisturbed only in August 2020 and was moderately disturbed in the remaining months. Redundancy analysis (RDA) showed that altitude, chlorophyll a, and temperature were the main environmental factors affecting the fish community in Juma River. Altitude is the environmental factor that greatestly affects the structure of fish communities in the Juma River, it has a great influence on Triplophysa cuneicephala, Triplophysa dalaica and Rhynchocypris oxycephalus. Chlorophyll a was highly correlated with the density of phytoplankton and it has a great influence on Micropercops swinhonis, Zacco platypus and other omnivorous fish.
In order to understand the fish community structure in Juma River and its relationship with the environmental factors, 15sampling stations in Juma River were surveyed in May, August and October, 2019, August and October, 2020 and May, 2021. A total of 37 fish were collected, belonging to 11 families and 5 orders. Cypriniformes were the most, accounting for 64.86% of the total species captured. Ecologically, the fish community in Juma River is dominated by demersal and omnivores species and there are fewer carnivorous fish. Compared with the historical data, the number of fish species has decreased. Index Relative Importance (IRI) shows that 10species had IRI≥500, Carassius auratus, Pseudorasbora parva, Zacco platypus were the dominant species. C. auratus, P. parva and Micropercops swinhonis were collected in all seasons and all sampling sites. One-way analysis of variance (ANOVA) showed that the number of individuals (N), species (S), Shannon-Wiener diversity index (H') and Margalef richness index (DMa) of the fish community had significant differences between different seasons, Pielou evenness index (J') showed no significant differences. SNK multiple comparison test showed that the number of individuals and species was the highest in May 2019, Shannon-Wiener diversity index (H') and Margalef richness index (DMa)was the highest in August 2019. The numbers of individuals showed significant differences between different altitudes, an average of 143.91 fishes can be collected at sampling station above 500 meters and only 48.19 fishes can be collected at sampling station below 500 meters. Cluster analysis and Non-metric Multidimensional Scaling (NMDS) divides the source of the Juma River and the Diaojianghui into group Ⅰ, the Zijingguan Bridge and Qingliangjian into group Ⅱ, remaining sites are divided into group Ⅲ. The abundance biomass comparison curve (ABC) showed that the fish community was undisturbed only in August 2020 and was moderately disturbed in the remaining months. Redundancy analysis (RDA) showed that altitude, chlorophyll a, and temperature were the main environmental factors affecting the fish community in Juma River. Altitude is the environmental factor that greatestly affects the structure of fish communities in the Juma River, it has a great influence on Triplophysa cuneicephala, Triplophysa dalaica and Rhynchocypris oxycephalus. Chlorophyll a was highly correlated with the density of phytoplankton and it has a great influence on Micropercops swinhonis, Zacco platypus and other omnivorous fish.
,
Available online
, doi: 10.7541/2022.2021.0217
Abstract:
Acute hepatopancreatic necrosis disease (AHPND) is an important limiting factor affecting the healthy cultivation of shrimp in recent years, which has brought huge economic losses to the global shrimp industry. In order to explore the relationship between the occurrence of AHPND and environment, pathogen and shrimp immunity factors, the pond cultured Litopenaeus vannamei systems were continuously monitored. Based on the 35 days continuously monitoring showed that, the air temperature, water temperature, dissolved oxygen (DO), pH, salinity, ammonia nitrogen (NH4-N) and nitrite (NO2-N) were fluctuated in the range of 21—29℃, 24.8—31℃, 1.4—8.32 mg/L, 8—8.91, 34—50, 0.01—0.26 mg/L and 0.005—0.212 mg/L, respectively; the culturable bacteria and Vibrio sp. in water and shrimp hepatopancreas were fluctuated in the range of 3×103—2.4×105 CFU/mL, 2×102—1.8×104 CFU/mL, 9.8×104—8.8×106 and 3.9×103—3.61×106 CFU/g, respectively; 135 isolates of Vibrio sp. were detected based on 16S rDNA, and the main Vibrio species was V. owensii, V. campbellii, V. parahaemolyticus, V. alginolyticus and V. harveyi; the activities of ACP, AKP, SOD, LZM and PO were 7.5—75, 1.0—8.5, 2.4—11.07, 1.3—43 and 23—28 U/mg, respectively. Combined the physical and chemical factors before and after the occurrence of AHPND, the results showed that, water temperature, culturable bacteria and Vibrio sp. in hepatopancreas, DO, LZM and PO could be used as the early warning candidate factors for the occurrence of AHPND in pond culture. The results provide a scientific basis for the healthy culture of L. vannamei and the prevention and control of AHPND disease.
Acute hepatopancreatic necrosis disease (AHPND) is an important limiting factor affecting the healthy cultivation of shrimp in recent years, which has brought huge economic losses to the global shrimp industry. In order to explore the relationship between the occurrence of AHPND and environment, pathogen and shrimp immunity factors, the pond cultured Litopenaeus vannamei systems were continuously monitored. Based on the 35 days continuously monitoring showed that, the air temperature, water temperature, dissolved oxygen (DO), pH, salinity, ammonia nitrogen (NH4-N) and nitrite (NO2-N) were fluctuated in the range of 21—29℃, 24.8—31℃, 1.4—8.32 mg/L, 8—8.91, 34—50, 0.01—0.26 mg/L and 0.005—0.212 mg/L, respectively; the culturable bacteria and Vibrio sp. in water and shrimp hepatopancreas were fluctuated in the range of 3×103—2.4×105 CFU/mL, 2×102—1.8×104 CFU/mL, 9.8×104—8.8×106 and 3.9×103—3.61×106 CFU/g, respectively; 135 isolates of Vibrio sp. were detected based on 16S rDNA, and the main Vibrio species was V. owensii, V. campbellii, V. parahaemolyticus, V. alginolyticus and V. harveyi; the activities of ACP, AKP, SOD, LZM and PO were 7.5—75, 1.0—8.5, 2.4—11.07, 1.3—43 and 23—28 U/mg, respectively. Combined the physical and chemical factors before and after the occurrence of AHPND, the results showed that, water temperature, culturable bacteria and Vibrio sp. in hepatopancreas, DO, LZM and PO could be used as the early warning candidate factors for the occurrence of AHPND in pond culture. The results provide a scientific basis for the healthy culture of L. vannamei and the prevention and control of AHPND disease.
,
Available online
, doi: 10.7541/2023.2022.0171
Abstract:
The extensive use and accumulation of sulfamethoxazole (SMX) in the aquaculture contributed to its residues in aquaculture water, which may cause various negative impacts on the aquatic ecological environment. Furthermore, periphyton is a common micro-ecosystem in water bodies composed of autotrophs and heterotrophs, including algae, fungi, bacteria, protozoa, metazoans, extracellular polymers (EPS) and debris, etc. Nevertheless, there is a lack of research on the impact of SMX on the growth and development of periphyton and its purification function in aquaculture water. In this survey, the effect of SMX on periphyton was researched in simulating aquaculture water, and the response of periphyton to SMX was explored through the biomass and total antioxidant capacity of the periphyton. The removal effect and the main degradation intermediates of SMX by periphyton were investigated by high-performance liquid chromatography (HPLC) and ultra-performance liquid chromatography quadrupole-time-of-flight mass spectrometry (UPLC-QTOF-MS). This research demonstrated that under 5 and 10 mg/L SMX, the secretion of extracellular polymer (EPS) of the periphyton increased by 31.3% and 21.5% compared with the control group, and the antioxidant capacity diminished by 20.6% and 31.8%, but there was no significant difference in biomass accumulation. And it showed that SMX decreased the total antioxidant capacity of the mature periphyton, their oxidative systems were damaged, and more extracellular polymers were secreted to enhance tolerance to SMX. The results of the removal experiment indicated that the periphyton would promote the reduction of SMX, and the removal rate of SMX at 1 g/L was 25.10% on the 14th day. It is supposed that SMX was used by periphyton as a carbon source to promote biodegradation and shorten the half-life of SMX degradation. Thus, periphyton had a certain potential for SMX bioremediation in aquaculture water. The main routes of SMX biodegradation by the periphyton are the cleavage and activation of the sulfonamide group (N-S bond) and the amine group (-NH2) on the benzene ring. The primary degradation intermediates were N4-acetyl-SMX, p-Benzoquinoneimine, Desulphone-SMX and Desamino-SMX. Among these degradation products, N4-acetyl-SMX, p-Benzoquinoneimide and Desamino-SMX were fewer toxic than SMX, and Desulphone-SMX was somewhat more toxic than SMX. The research provides theoretical support for assessing the ecological risk of SMX in aquaculture water and the engineering application of periphyton to remove SMX.
The extensive use and accumulation of sulfamethoxazole (SMX) in the aquaculture contributed to its residues in aquaculture water, which may cause various negative impacts on the aquatic ecological environment. Furthermore, periphyton is a common micro-ecosystem in water bodies composed of autotrophs and heterotrophs, including algae, fungi, bacteria, protozoa, metazoans, extracellular polymers (EPS) and debris, etc. Nevertheless, there is a lack of research on the impact of SMX on the growth and development of periphyton and its purification function in aquaculture water. In this survey, the effect of SMX on periphyton was researched in simulating aquaculture water, and the response of periphyton to SMX was explored through the biomass and total antioxidant capacity of the periphyton. The removal effect and the main degradation intermediates of SMX by periphyton were investigated by high-performance liquid chromatography (HPLC) and ultra-performance liquid chromatography quadrupole-time-of-flight mass spectrometry (UPLC-QTOF-MS). This research demonstrated that under 5 and 10 mg/L SMX, the secretion of extracellular polymer (EPS) of the periphyton increased by 31.3% and 21.5% compared with the control group, and the antioxidant capacity diminished by 20.6% and 31.8%, but there was no significant difference in biomass accumulation. And it showed that SMX decreased the total antioxidant capacity of the mature periphyton, their oxidative systems were damaged, and more extracellular polymers were secreted to enhance tolerance to SMX. The results of the removal experiment indicated that the periphyton would promote the reduction of SMX, and the removal rate of SMX at 1 g/L was 25.10% on the 14th day. It is supposed that SMX was used by periphyton as a carbon source to promote biodegradation and shorten the half-life of SMX degradation. Thus, periphyton had a certain potential for SMX bioremediation in aquaculture water. The main routes of SMX biodegradation by the periphyton are the cleavage and activation of the sulfonamide group (N-S bond) and the amine group (-NH2) on the benzene ring. The primary degradation intermediates were N4-acetyl-SMX, p-Benzoquinoneimine, Desulphone-SMX and Desamino-SMX. Among these degradation products, N4-acetyl-SMX, p-Benzoquinoneimide and Desamino-SMX were fewer toxic than SMX, and Desulphone-SMX was somewhat more toxic than SMX. The research provides theoretical support for assessing the ecological risk of SMX in aquaculture water and the engineering application of periphyton to remove SMX.
,
Available online
, doi: 10.7541/2022.2021.0214
Abstract:
The winged pearl oyster, Pteria penguin, is a widely distributed large pearl oyster species, which can produce large-sized mabé (half-pearl), and exhibit strong tolerance to severe environment. However, genetic improvement of P. penguin was still in its infancy. In this study, the correlation between five microsatellite loci and four growth traits (shell height, shell length, shell width and total weight) of 500 winged pearl oysters were analyzed by One-way ANOVA. Multiple comparisons between different genotypes of microsatellite markers and growth traits were performed. It was shown that the 5 loci in this study are all highly polymorphic loci. Among them, QEB-D15 and CL-232 were extremely significantly associated with the shell width of the winged pearl oyster (P<0.01). The individuals with genotype 239/263 and 239/273 at QEB-D15had the maximum and the minimum shell width, respectively. The 263bp allele might positively correlate with the shell width, while the 273bp allele might negatively correlate with the shell width. The average values of shell length, shell width and total weight of individuals with genotype 157/174 at locus CL-232 were larger than that of other genotypes, suggested that this genotype was the dominant genotype. Individuals with genotype of 177/192 at locus CL-232had the smallest shell length, shell width, shell height and total weight, indicated that the 177/192 may be an inferior genotype. In addition, the shell width is correlated with two SSR loci, which indicates that the shell width is a phenotypic trait that may not be controlled by a single gene. This study could provide valuable information for molecular marker-assisted selection of P. penguin.
The winged pearl oyster, Pteria penguin, is a widely distributed large pearl oyster species, which can produce large-sized mabé (half-pearl), and exhibit strong tolerance to severe environment. However, genetic improvement of P. penguin was still in its infancy. In this study, the correlation between five microsatellite loci and four growth traits (shell height, shell length, shell width and total weight) of 500 winged pearl oysters were analyzed by One-way ANOVA. Multiple comparisons between different genotypes of microsatellite markers and growth traits were performed. It was shown that the 5 loci in this study are all highly polymorphic loci. Among them, QEB-D15 and CL-232 were extremely significantly associated with the shell width of the winged pearl oyster (P<0.01). The individuals with genotype 239/263 and 239/273 at QEB-D15had the maximum and the minimum shell width, respectively. The 263bp allele might positively correlate with the shell width, while the 273bp allele might negatively correlate with the shell width. The average values of shell length, shell width and total weight of individuals with genotype 157/174 at locus CL-232 were larger than that of other genotypes, suggested that this genotype was the dominant genotype. Individuals with genotype of 177/192 at locus CL-232had the smallest shell length, shell width, shell height and total weight, indicated that the 177/192 may be an inferior genotype. In addition, the shell width is correlated with two SSR loci, which indicates that the shell width is a phenotypic trait that may not be controlled by a single gene. This study could provide valuable information for molecular marker-assisted selection of P. penguin.
,
Available online
, doi: 10.7541/2023.2022.0170
Abstract:
As an emerging pollutant, microplastics have spread all over the marine environment. Studies have shown that the marine sedimentary environment is the sink for marine microplastics, The Changshan Archipelago (Changdao) are located at the throat of the Bohai Sea and belong to a typical island ecosystem. In recent years, the coastal area of Long Island has been affected by human factors such as the construction of breeding ponds and port terminals, and the ecological environment is relatively fragile. In this study, the sediments of Changshan Archipelago were collected, and the microplastics in these sediments were analyzed by microscope observation and fourier transform infrared spectroscopy. The results showed that the abundance of microplastics in the Changshan Archipelago sediments ranged from 133.14 to 499.82 N/kg, with an average abundance of 252.59 N/kg. The size of microplastics is mainly <500 μm, accounting for more than 70% of the total number of microplastics; the shape of microplastics is mainly granular, followed by fragments, fibers and small spheres; the color of microplastics is mainly transparent. The polymer type of plastic is mainly cellophane, followed by polyethylene, polyethylene terephthalate, cellulose, etc. Because Changdao is located at the intersection of the Yellow Sea and the Bohai Sea, the overall hydrodynamic exchange capacity is well. Although the water mobility of the southern waters of Changdao is weaker than that of the northern waters, and the southern waters are closer to the rivers entering the sea, and are more affected by the input of land sources, the abundance of microplastics in the sediments of the southern water of Changdao is not significantly higher than that of the northern water. This study provides a scientific basis for the scientific assessment and management of microplastic pollution in the marine ecological environment of Long Island.
As an emerging pollutant, microplastics have spread all over the marine environment. Studies have shown that the marine sedimentary environment is the sink for marine microplastics, The Changshan Archipelago (Changdao) are located at the throat of the Bohai Sea and belong to a typical island ecosystem. In recent years, the coastal area of Long Island has been affected by human factors such as the construction of breeding ponds and port terminals, and the ecological environment is relatively fragile. In this study, the sediments of Changshan Archipelago were collected, and the microplastics in these sediments were analyzed by microscope observation and fourier transform infrared spectroscopy. The results showed that the abundance of microplastics in the Changshan Archipelago sediments ranged from 133.14 to 499.82 N/kg, with an average abundance of 252.59 N/kg. The size of microplastics is mainly <500 μm, accounting for more than 70% of the total number of microplastics; the shape of microplastics is mainly granular, followed by fragments, fibers and small spheres; the color of microplastics is mainly transparent. The polymer type of plastic is mainly cellophane, followed by polyethylene, polyethylene terephthalate, cellulose, etc. Because Changdao is located at the intersection of the Yellow Sea and the Bohai Sea, the overall hydrodynamic exchange capacity is well. Although the water mobility of the southern waters of Changdao is weaker than that of the northern waters, and the southern waters are closer to the rivers entering the sea, and are more affected by the input of land sources, the abundance of microplastics in the sediments of the southern water of Changdao is not significantly higher than that of the northern water. This study provides a scientific basis for the scientific assessment and management of microplastic pollution in the marine ecological environment of Long Island.
,
Available online
, doi: 10.7541/2023.2022.0164
Abstract:
In this study, a total of 13379 fish specimens were collected from 20sections using gill nets in June (summer) and November (autumn), 2021 to reveal the fish species resources formed in five backbone artificial rivers of Shanghai Huangpu River in the past half-century. Sixty fish species were identified, belonging to 45 genera, 17 families, and 8 orders, comprising 41species of Cypriniformes belonging to 28 genera and 2 families, 8species of Perciformes belonging to 8 genera and 7 families, 2species of Migratory fish, 8species of estuarine fish, and freshwater species. There were 9 dominant species with IRI≥1000 in total, and Coilia nasus was the dominant species in all 5 rivers. ABC curve demonstrated that except for the Jinhui River, small and medium-sized fishes dominated other rivers, and fish communities were severely disturbed. ΒC index and ΒR index reflected that the Chuanyang River and the Dazhi River in Pudong had the highest difference in fish composition; the difference in fish composition between the Jinhui River and the Longquan River in Punan was the least. The 20sections were divided into three groups; group I ( D1 and Z2sections), group II (the Jinhui River, the Longquan River, and the Dazhi River except for the Z2section), and group III (the Chuanyang River and the Dianpu River except for the D1section). Pseudobrama simony, Coilia nasus, Carassius auratus, and Hemiculter leucisculus were the main diverging species causing the differences in fish community structure among groups. As suggested in the study, more fish species were preserved in these five artificial backbone tributaries than in the headstream, mainstream, and natural tributaries of the Huangpu River, and population density would be a crucial reason for the significant spatial differences in fish community structure in these rivers.
In this study, a total of 13379 fish specimens were collected from 20sections using gill nets in June (summer) and November (autumn), 2021 to reveal the fish species resources formed in five backbone artificial rivers of Shanghai Huangpu River in the past half-century. Sixty fish species were identified, belonging to 45 genera, 17 families, and 8 orders, comprising 41species of Cypriniformes belonging to 28 genera and 2 families, 8species of Perciformes belonging to 8 genera and 7 families, 2species of Migratory fish, 8species of estuarine fish, and freshwater species. There were 9 dominant species with IRI≥1000 in total, and Coilia nasus was the dominant species in all 5 rivers. ABC curve demonstrated that except for the Jinhui River, small and medium-sized fishes dominated other rivers, and fish communities were severely disturbed. ΒC index and ΒR index reflected that the Chuanyang River and the Dazhi River in Pudong had the highest difference in fish composition; the difference in fish composition between the Jinhui River and the Longquan River in Punan was the least. The 20sections were divided into three groups; group I ( D1 and Z2sections), group II (the Jinhui River, the Longquan River, and the Dazhi River except for the Z2section), and group III (the Chuanyang River and the Dianpu River except for the D1section). Pseudobrama simony, Coilia nasus, Carassius auratus, and Hemiculter leucisculus were the main diverging species causing the differences in fish community structure among groups. As suggested in the study, more fish species were preserved in these five artificial backbone tributaries than in the headstream, mainstream, and natural tributaries of the Huangpu River, and population density would be a crucial reason for the significant spatial differences in fish community structure in these rivers.
