Scan QR Code
Login System
Office Online
Online production system
Search
Reading Guide
Display Method:
,
Available online
, doi: 10.7541/2023.2023.0126
Abstract:
Piscivorous fish species play a crucial role as top predators in the aquatic food webs, contributing significantly to the structure and functioning of ecosystem. Qiandaohu Lake (QDH) has mainly focused on stocking-based aquaculture, particularly with filter-feeding fish such as silver carp and bighead carp, which have become a model for large-scale ecological aquaculture in China. However, little attention has been given to piscivorous fish species in this important ecosystem. Therefore, this study aimed to investigate Culter mongolicus, which is one of the dominant piscivorous fish in QDH. Samples were collected monthly from March 2021 to September 2022, and the population’s biological characteristics such as age, growth, reproduction, mortality, and stock resources were evaluated. The results indicated that the age structure of the C. mongolicus population in QDH was complete, with the 2—3 years age group being the most prevalent and exhibiting slow ageing phenomena. The relationship between standard length and body weight followed a power function indicating positive allometric growth. By fitting the Von Bertalanffy growth equation, this population belonged to the fast-growing type and had a growth coefficient (k=0.33) that was higher than that of other populations in previous research. Different growth stages correlated before and after the inflection point, which occurred at 3.23 years old. The population of C. mongolicus has a long breeding time, high population fecundity, and a unimodal distribution of oocyte diameter, which conforms to the characteristics of a single batch of spawning, and shows a periodic reproductive strategy as a whole. The exploitation of C. mongolicus population rate was evaluated to be 0.86 which showed an over-exploited phenomenon. Finally, we provided suggestions for the fisheries management of piscivores fishes in QDH based on the findings.
Piscivorous fish species play a crucial role as top predators in the aquatic food webs, contributing significantly to the structure and functioning of ecosystem. Qiandaohu Lake (QDH) has mainly focused on stocking-based aquaculture, particularly with filter-feeding fish such as silver carp and bighead carp, which have become a model for large-scale ecological aquaculture in China. However, little attention has been given to piscivorous fish species in this important ecosystem. Therefore, this study aimed to investigate Culter mongolicus, which is one of the dominant piscivorous fish in QDH. Samples were collected monthly from March 2021 to September 2022, and the population’s biological characteristics such as age, growth, reproduction, mortality, and stock resources were evaluated. The results indicated that the age structure of the C. mongolicus population in QDH was complete, with the 2—3 years age group being the most prevalent and exhibiting slow ageing phenomena. The relationship between standard length and body weight followed a power function indicating positive allometric growth. By fitting the Von Bertalanffy growth equation, this population belonged to the fast-growing type and had a growth coefficient (k=0.33) that was higher than that of other populations in previous research. Different growth stages correlated before and after the inflection point, which occurred at 3.23 years old. The population of C. mongolicus has a long breeding time, high population fecundity, and a unimodal distribution of oocyte diameter, which conforms to the characteristics of a single batch of spawning, and shows a periodic reproductive strategy as a whole. The exploitation of C. mongolicus population rate was evaluated to be 0.86 which showed an over-exploited phenomenon. Finally, we provided suggestions for the fisheries management of piscivores fishes in QDH based on the findings.
,
Available online
, doi: 10.7541/2023.2023.0091
Abstract:
The construction of ecological corridor in lakeside zone is a a novel approach to restoring the ecology of the lakeside, but little attention has been paid to the effects of corridor on the distribution and diversity of aquatic communities in this zone. In this study, we investigate the changes in fish community characteristics in different types of bays (S-type and L-type) before and after the construction of the ecological corridor in Erhai Lake. The results showed that: 1) The construction of ecological corridor caused decrease of fish dominance in S-type bays, but an increase in L-type. 2) The fish diversity index in L-type increased significantly after construction, with the H′ showing a significant difference compared to before (P<0.05), however, the diversity index decreased in S-type. 3) The fish density decreased in S-type, but the biomass increased due to an increase in the abundance of medium and large-sized fish, while the abundance of small-sized fish increased in L-type. The fish abundance biomass comparison curve showed that the S-type was a moderate disturbance after construction, while, the disturbance of L-type was mild and the fish community structure was more stable. 4) RDA analysis showed that water transparency, pH and water depth were the main environmental factors affecting fish biomass in both S-type and L-type bays, and silver carp was the dominant fish. In conclusion, the construction of ecological corridor has a significant impact on the structure of fish community, particularly in S-type where it leads to a rapid change in fish composition community. Therefore, it is suggested that ecological corridor construction should focus on the transformation of L-type. This study provides a theoretical basis for the protection of fish diversity and habitat restoration.
The construction of ecological corridor in lakeside zone is a a novel approach to restoring the ecology of the lakeside, but little attention has been paid to the effects of corridor on the distribution and diversity of aquatic communities in this zone. In this study, we investigate the changes in fish community characteristics in different types of bays (S-type and L-type) before and after the construction of the ecological corridor in Erhai Lake. The results showed that: 1) The construction of ecological corridor caused decrease of fish dominance in S-type bays, but an increase in L-type. 2) The fish diversity index in L-type increased significantly after construction, with the H′ showing a significant difference compared to before (P<0.05), however, the diversity index decreased in S-type. 3) The fish density decreased in S-type, but the biomass increased due to an increase in the abundance of medium and large-sized fish, while the abundance of small-sized fish increased in L-type. The fish abundance biomass comparison curve showed that the S-type was a moderate disturbance after construction, while, the disturbance of L-type was mild and the fish community structure was more stable. 4) RDA analysis showed that water transparency, pH and water depth were the main environmental factors affecting fish biomass in both S-type and L-type bays, and silver carp was the dominant fish. In conclusion, the construction of ecological corridor has a significant impact on the structure of fish community, particularly in S-type where it leads to a rapid change in fish composition community. Therefore, it is suggested that ecological corridor construction should focus on the transformation of L-type. This study provides a theoretical basis for the protection of fish diversity and habitat restoration.
,
Available online
, doi: 10.7541/2023.2023.0067
Abstract:
In this study, we downloaded complete mitochondrial genome sequences of 27 Acipenseriformes species, with Polypteriformes species as outgroups, to construct molecular phylogenetic trees. Based on these trees, we analyzed macroevolutionary pattern of 12 morphological and ecological traits with the phylogenetic comparative methods (PCMs), such as reconstructing ancestral character states, analyzing character phylogenetic constraints and testing the character correlations. The results showed that 8 traits such as habitat, body size, dorsal fin rays, anal fin rays, posterior dorsal fin scutes, posterior anal fin scutes, gill rakers and egg size, were phylogenetically constrained, indicating that the evolution of these characters were associated with phylogeny and strongly affected by natural selection. Four traits including diets, female first maturity age, male first maturity age and spawning interval, showed no phylogenetic signals, indicating their adaptations to the environments. Reconstruction of ancestral character states showed that many Acipenseriformes species exhibited a pattern of evolution from the intermediate state of ancestral species evolving to two directions: becoming larger and smaller respectively. For example, body size, dorsal fin rays, anal fin rays, first maturity age all showed this pattern. For the adaptive strategies, the Acipenserformes showed the constraints of some morphological characters such as gill rakers, egg size, and the flexible adaptations to different environments for the coordinating ecological characters such as diets, first maturity age, egg size, spawning interval. Results of this study can provide valuable information for understanding macroevolutionary pattern of the Acipenseriformes and give hints for species conservation.
In this study, we downloaded complete mitochondrial genome sequences of 27 Acipenseriformes species, with Polypteriformes species as outgroups, to construct molecular phylogenetic trees. Based on these trees, we analyzed macroevolutionary pattern of 12 morphological and ecological traits with the phylogenetic comparative methods (PCMs), such as reconstructing ancestral character states, analyzing character phylogenetic constraints and testing the character correlations. The results showed that 8 traits such as habitat, body size, dorsal fin rays, anal fin rays, posterior dorsal fin scutes, posterior anal fin scutes, gill rakers and egg size, were phylogenetically constrained, indicating that the evolution of these characters were associated with phylogeny and strongly affected by natural selection. Four traits including diets, female first maturity age, male first maturity age and spawning interval, showed no phylogenetic signals, indicating their adaptations to the environments. Reconstruction of ancestral character states showed that many Acipenseriformes species exhibited a pattern of evolution from the intermediate state of ancestral species evolving to two directions: becoming larger and smaller respectively. For example, body size, dorsal fin rays, anal fin rays, first maturity age all showed this pattern. For the adaptive strategies, the Acipenserformes showed the constraints of some morphological characters such as gill rakers, egg size, and the flexible adaptations to different environments for the coordinating ecological characters such as diets, first maturity age, egg size, spawning interval. Results of this study can provide valuable information for understanding macroevolutionary pattern of the Acipenseriformes and give hints for species conservation.
,
Available online
, doi: 10.7541/2023.2023.0024
Abstract:
The sustainable development of the aquaculture industry for yellow catfish (Tachysurus fulvidraco) in China has been hindered by a shortage of females and inadequate scientific feeding, as well as the shortage of raw aquatic feed materials. Studies have shown that wheat germ, which containes plant functional nutrient with antioxidant, anticancer, hypolipidemic, and gonad-development promoting effects, could be a potential feed material. This study evaluated the effects of wheat germ on the survival rate, liver antioxidant capacity, plasma physiology and biochemistry, and reproductive performance of 825 female broodstock of yellow catfish, and determined the feasibility of wheat germ as feed material by feeding different wheat germ addition 0, 5%, 10%, 15% and 20% (w/w). The results showed that wheat germ could significantly improve survival rate and liver antioxidant capacity of the female broodstock (P<0.05). Wheat germ significantly improved the enzyme activity of the female broodstock (P<0.05). The activity of superoxide dismutase (SOD), catalase (CAT), and total antioxidant capacity (T-AOC) enzyme was the highest in the 10% wheat germ addition diet, with which the content of malondialdehyde (MDA) was the lowest. The polynomial curve equation showed that the wheat germ addition of 11.57%—14.0% in the diet had the highest antioxidant activity. When the addition amount of wheat germ reached 10%, it did not significantly affect plasma glucose (GLU) (P>0.05). It caused a significant increase in the content of high-density lipoprotein cholesterol (HDL-C) (P<0.05), and a significant decrease in the ratio of low-density lipoprotein cholesterol to high-density lipoprotein cholesterol (LDL-C/HDL-C) (P<0.05). In conclusion, wheat germ can be a beneficial feed material for female parents of yellow catfish, particularly during the pre-spawning period with an addition amount of 10%—15% of diet quality and during the post-spawning period with an addition amount of 5%—10%. The present study provides an important foundation for further broodstock feed development and cultivation.
The sustainable development of the aquaculture industry for yellow catfish (Tachysurus fulvidraco) in China has been hindered by a shortage of females and inadequate scientific feeding, as well as the shortage of raw aquatic feed materials. Studies have shown that wheat germ, which containes plant functional nutrient with antioxidant, anticancer, hypolipidemic, and gonad-development promoting effects, could be a potential feed material. This study evaluated the effects of wheat germ on the survival rate, liver antioxidant capacity, plasma physiology and biochemistry, and reproductive performance of 825 female broodstock of yellow catfish, and determined the feasibility of wheat germ as feed material by feeding different wheat germ addition 0, 5%, 10%, 15% and 20% (w/w). The results showed that wheat germ could significantly improve survival rate and liver antioxidant capacity of the female broodstock (P<0.05). Wheat germ significantly improved the enzyme activity of the female broodstock (P<0.05). The activity of superoxide dismutase (SOD), catalase (CAT), and total antioxidant capacity (T-AOC) enzyme was the highest in the 10% wheat germ addition diet, with which the content of malondialdehyde (MDA) was the lowest. The polynomial curve equation showed that the wheat germ addition of 11.57%—14.0% in the diet had the highest antioxidant activity. When the addition amount of wheat germ reached 10%, it did not significantly affect plasma glucose (GLU) (P>0.05). It caused a significant increase in the content of high-density lipoprotein cholesterol (HDL-C) (P<0.05), and a significant decrease in the ratio of low-density lipoprotein cholesterol to high-density lipoprotein cholesterol (LDL-C/HDL-C) (P<0.05). In conclusion, wheat germ can be a beneficial feed material for female parents of yellow catfish, particularly during the pre-spawning period with an addition amount of 10%—15% of diet quality and during the post-spawning period with an addition amount of 5%—10%. The present study provides an important foundation for further broodstock feed development and cultivation.
,
Available online
, doi: 10.7541/2023.2023.0093
Abstract:
In this experiment, gibel carp (Carassius gibelio var. CAS V) with initial weight of (12.71±0.11) g was selected as the research object. Based on the essential amino acids requirements of gibel carp, we investigated the effects of supplementaed with essential amino acids in low protein diet on the growth, digestion and protein synthesis of gibel carp. Three isoenergetic diets were designed: CON group (35% crude protein), LP group (28% crude protein) and LP+EAA group (28% crude protein+crystalline amino acids). The results showed that supplementing the low protein diet with essential amino acids significantly improved the growth performance of gibel carp (P<0.05), and there was no significant difference compared with the CON group (P>0.05); The activity of aspartate transaminase (AST) in liver of LP+EAA group was significantly higher than that of LP group (P<0.05), but there was no significant difference in alanine transaminase (ALT) activity among all groups (P>0.05). Supplementation with essential amino acids had significant effects on the activities of trypsin and amylase in the intestinal (P<0.05), but had no significant effects on chymotrypsin and lipase (P>0.05). The relative expression levels of three amino acids transporters cat2, asct2 and b0at1 in intestinal were significantly up-regulated (P<0.05), while the relative expressions of b0,+at in LP group were significantly down-regulated (P<0.05), and there was no significant difference in the relative expression of pept1 among all groups (P>0.05). The relative expression level of tor in liver of LP group was significantly decreased (P<0.05), while the relative expression level of s6k1 in LP+EAA group was significantly up-regulated (P<0.05), however, the relative expression levels of 4ebp2 and eif4e were no significant difference among all groups (P>0.05). In dorsal muscle, the relative expression of tor in LP+EAA group was significantly up-regulated (P<0.05), and eif4e expression in LP group was significantly down-regulated (P<0.05), but there were no significant differences in the relative expression levels of s6k1 and 4ebp2 among all groups (P>0.05). In conclusion, reducing the diet protein level from 35% to 28% of juvenile gibel carp (Carassius gibelio var.CAS V) is possible without negative effects on growth, through supplemented with essential amino acids.
In this experiment, gibel carp (Carassius gibelio var. CAS V) with initial weight of (12.71±0.11) g was selected as the research object. Based on the essential amino acids requirements of gibel carp, we investigated the effects of supplementaed with essential amino acids in low protein diet on the growth, digestion and protein synthesis of gibel carp. Three isoenergetic diets were designed: CON group (35% crude protein), LP group (28% crude protein) and LP+EAA group (28% crude protein+crystalline amino acids). The results showed that supplementing the low protein diet with essential amino acids significantly improved the growth performance of gibel carp (P<0.05), and there was no significant difference compared with the CON group (P>0.05); The activity of aspartate transaminase (AST) in liver of LP+EAA group was significantly higher than that of LP group (P<0.05), but there was no significant difference in alanine transaminase (ALT) activity among all groups (P>0.05). Supplementation with essential amino acids had significant effects on the activities of trypsin and amylase in the intestinal (P<0.05), but had no significant effects on chymotrypsin and lipase (P>0.05). The relative expression levels of three amino acids transporters cat2, asct2 and b0at1 in intestinal were significantly up-regulated (P<0.05), while the relative expressions of b0,+at in LP group were significantly down-regulated (P<0.05), and there was no significant difference in the relative expression of pept1 among all groups (P>0.05). The relative expression level of tor in liver of LP group was significantly decreased (P<0.05), while the relative expression level of s6k1 in LP+EAA group was significantly up-regulated (P<0.05), however, the relative expression levels of 4ebp2 and eif4e were no significant difference among all groups (P>0.05). In dorsal muscle, the relative expression of tor in LP+EAA group was significantly up-regulated (P<0.05), and eif4e expression in LP group was significantly down-regulated (P<0.05), but there were no significant differences in the relative expression levels of s6k1 and 4ebp2 among all groups (P>0.05). In conclusion, reducing the diet protein level from 35% to 28% of juvenile gibel carp (Carassius gibelio var.CAS V) is possible without negative effects on growth, through supplemented with essential amino acids.
,
Available online
, doi: 10.7541/2023.2023.0040
Abstract:
This experiment aimed to investigate the effects of different sources and levels of dietary selenium additives on the growth, antioxidant capacity and tissue selenium contents of hybrid sturgeon juveniles. Three sources of selenium were selected as sodium selenite, selenium yeast and selenium-enriched spirulina at two different levels of 0, 0.4 and 1.2 mg/kg, to prepare control diet (C) and sodium selenite supplemented diets (S1, S2), selenium yeast supplemented diets (Y1, Y2) and selenium-enriched spirulina supplemented diets (P1, P2). Hybrid sturgeon juveniles (initial body weight at about 7.8 g) were raised for 62d using the experimental diets. The results showed that different selenium sources and levels had no significant effects on the specific growth rate and feed efficiency of juvenile hybrid sturgeon (P>0.05), however the selenium contents in the whole fish, liver, muscle and vertebra of the hybrid sturgeon in the high yeast selenium and high selenium-enriched spirulina supplemented groups were significantly higher than those in the control group (P<0.05). Sodium selenite supplementation significantly increased the selenium contents in the whole fish and liver (P<0.05), but had no significant effects on the selenium contents in muscle and vertebra (P>0.05). Muscle selenium content in sodium selenite group was significantly positively correlated with whole fish selenium content (P<0.05), and significantly negatively correlated with liver selenium content (P<0.05). Meanwhile, the plasma GSH-Px activity of the juvenile hybrid sturgeon in the high selenium supplemented groups was significantly higher than that in the control and low selenium supplemented groups (P<0.05), furthermore, the MDA contents in the selenium-enriched spirulina supplemented group were significantly lower than those in the sodium selenite supplemented groups (P<0.05). Plasma GSH-Px activity was positively correlated with muscle (P<0.01), vertebra (P<0.01) and hepatic selenium content (P<0.05). The plasma total protein (TG) and total cholesterol (TC) contents in the selenium yeast supplemented groups were significantly higher than those in the control group (P<0.05). In conclusion, high-level selenium supplementation can increase the selenium contents of whole fish and liver, but the accumulation patterns of different types of selenium in fish are inconsistent. High-level organic selenium (selenium yeast and selenium-enriched spirulina) supplementation is more likely to accumulate in muscle and vertebrae than inorganic selenium (sodium selenite). Moreover, high-level selenium supplementation could significantly improve the antioxidant capacity of hybrid sturgeon, and different selenium sources had no significant effects on antioxidant properties.
This experiment aimed to investigate the effects of different sources and levels of dietary selenium additives on the growth, antioxidant capacity and tissue selenium contents of hybrid sturgeon juveniles. Three sources of selenium were selected as sodium selenite, selenium yeast and selenium-enriched spirulina at two different levels of 0, 0.4 and 1.2 mg/kg, to prepare control diet (C) and sodium selenite supplemented diets (S1, S2), selenium yeast supplemented diets (Y1, Y2) and selenium-enriched spirulina supplemented diets (P1, P2). Hybrid sturgeon juveniles (initial body weight at about 7.8 g) were raised for 62d using the experimental diets. The results showed that different selenium sources and levels had no significant effects on the specific growth rate and feed efficiency of juvenile hybrid sturgeon (P>0.05), however the selenium contents in the whole fish, liver, muscle and vertebra of the hybrid sturgeon in the high yeast selenium and high selenium-enriched spirulina supplemented groups were significantly higher than those in the control group (P<0.05). Sodium selenite supplementation significantly increased the selenium contents in the whole fish and liver (P<0.05), but had no significant effects on the selenium contents in muscle and vertebra (P>0.05). Muscle selenium content in sodium selenite group was significantly positively correlated with whole fish selenium content (P<0.05), and significantly negatively correlated with liver selenium content (P<0.05). Meanwhile, the plasma GSH-Px activity of the juvenile hybrid sturgeon in the high selenium supplemented groups was significantly higher than that in the control and low selenium supplemented groups (P<0.05), furthermore, the MDA contents in the selenium-enriched spirulina supplemented group were significantly lower than those in the sodium selenite supplemented groups (P<0.05). Plasma GSH-Px activity was positively correlated with muscle (P<0.01), vertebra (P<0.01) and hepatic selenium content (P<0.05). The plasma total protein (TG) and total cholesterol (TC) contents in the selenium yeast supplemented groups were significantly higher than those in the control group (P<0.05). In conclusion, high-level selenium supplementation can increase the selenium contents of whole fish and liver, but the accumulation patterns of different types of selenium in fish are inconsistent. High-level organic selenium (selenium yeast and selenium-enriched spirulina) supplementation is more likely to accumulate in muscle and vertebrae than inorganic selenium (sodium selenite). Moreover, high-level selenium supplementation could significantly improve the antioxidant capacity of hybrid sturgeon, and different selenium sources had no significant effects on antioxidant properties.
,
Available online
, doi: 10.7541/2023.2022.0469
Abstract:
In order to study the early scale covering and primary scale development of captive Pampus argenteus, alizarin red staining and hematoxylin-eosin staining were used to observe and measure the scales of captive Pampus argenteus. The results showed that Pampus argenteus has three initial centers of scales, namely the middle region of caudal stalk, the posterior margin of gill cover and the base of pectoral fin. At water temperature of (20±1.8)℃, the scales of Pampus argenteus began to appear at (30±0.95) mm in length. The scales at the posterior edge of the gill cover and the base of the pectoral fin extend along the lateral line until they come into contact with the scales extending laterally from the center of the caudal peduncle. The scales were completely covered at the length of (45.58±0.73) mm, which spread to the head faster than to the tail, and to the back faster than to the abdomen. The whole life stage of Pampus argenteus is round scale, without the transition between round scale and comb scale. Histological results showed that the scale was formed by the aggregation of fibroblasts between the epidermis and dermis of fish, and the process included four stages: early morphogenesis, late morphogenesis, early differentiation and late differentiation. The scales of Pampus argenteus occur after metamorphosis (transition from spindle shape to adult lateral flat shape) and the fins are fully formed, which is in common with other ebony fish. These results enrich biological data of the early development of Pampus argenteus and contribute to the understanding of its systematics and functional morphology.
In order to study the early scale covering and primary scale development of captive Pampus argenteus, alizarin red staining and hematoxylin-eosin staining were used to observe and measure the scales of captive Pampus argenteus. The results showed that Pampus argenteus has three initial centers of scales, namely the middle region of caudal stalk, the posterior margin of gill cover and the base of pectoral fin. At water temperature of (20±1.8)℃, the scales of Pampus argenteus began to appear at (30±0.95) mm in length. The scales at the posterior edge of the gill cover and the base of the pectoral fin extend along the lateral line until they come into contact with the scales extending laterally from the center of the caudal peduncle. The scales were completely covered at the length of (45.58±0.73) mm, which spread to the head faster than to the tail, and to the back faster than to the abdomen. The whole life stage of Pampus argenteus is round scale, without the transition between round scale and comb scale. Histological results showed that the scale was formed by the aggregation of fibroblasts between the epidermis and dermis of fish, and the process included four stages: early morphogenesis, late morphogenesis, early differentiation and late differentiation. The scales of Pampus argenteus occur after metamorphosis (transition from spindle shape to adult lateral flat shape) and the fins are fully formed, which is in common with other ebony fish. These results enrich biological data of the early development of Pampus argenteus and contribute to the understanding of its systematics and functional morphology.
,
Available online
, doi: 10.7541/2023.2023.0086
Abstract:
Nitrogen and phosphorus nutrients are the basic components of marine phytoplankton and key factors in controlling marine primary productivity. Previous studies have focused on the determination of nutrient chemical concentrations and neglected the detection of the actual bioavailability of nutrients in the water column. In order to achieve the detection of nitrogen and phosphorus nutrient bioavailable concentrations, this study screened two efficient and specific response to nitrogen and phosphorus bioavailable promoters of Synechococcus, drove the expression of bacterial luciferase reporter genes, constructed a microalgal cell bioreporter for the direct detection of nutrient bioavailability in environmental samples, and obtained the relationship curves between bioluminescence and standard nitrogen (\begin{document}${\rm{NO}}_3^- $\end{document} ![]()
![]()
\begin{document}${\rm{PO}}_4^{3-} $\end{document} ![]()
![]()
Nitrogen and phosphorus nutrients are the basic components of marine phytoplankton and key factors in controlling marine primary productivity. Previous studies have focused on the determination of nutrient chemical concentrations and neglected the detection of the actual bioavailability of nutrients in the water column. In order to achieve the detection of nitrogen and phosphorus nutrient bioavailable concentrations, this study screened two efficient and specific response to nitrogen and phosphorus bioavailable promoters of Synechococcus, drove the expression of bacterial luciferase reporter genes, constructed a microalgal cell bioreporter for the direct detection of nutrient bioavailability in environmental samples, and obtained the relationship curves between bioluminescence and standard nitrogen (
,
Available online
, doi: 10.7541/2023.2023.0080
Abstract:
Yeast culture is a micro-ecological product formed by anaerobic fermentation of yeast, containing a variety of active substances. In order to investigate the effects of yeast culture supplementation on growth performance, intestinal health, immunity and cumulative survival rate after bacteria challenge in largemouth bass (Micropterus salmoides), 1 g/kg (S1 diet) and 3 g/kg (S2 diet) of yeast culture supplementation were added to the control diet (Con diet), respectively. The three experimental diets were formulated with the same nutritional contents of protein (52%) and lipid (8.5%). The growth experiment was conducted in the pond cage (the size of 2 m×2 m×2 m). The 360 largemouth bass with the similar initial body weight of (32.37±0.15) g were divided into 3 dietary treatments, each with 3 replicates cages. 40 fish were stocked in each cage, and the growth experiment period was 11 weeks. At the end of growth experiment, the samples were taken from each cages 7h after the last feeding. The results showed that the final body weight (FBW), weight gain rate (WGR) and specific growth rate (SGR) of supplemented yeast culture groups had no significant difference compared with the control group (P>0.05). The condition factor (CF), hepatosomatic index (HSI) of supplemented yeast culture groups had no significant difference compared with the control group (P>0.05), while S2 group had the lowest value of HSI. In terms of intestinal structure, the villus length of S2 group and the depth of crypts were significantly increased compared with the control group (P<0.05). For intestinal microbes, S1 and S2 group both reduced the contents of Cyanobacteria and Staphylococcus in the intestine and increased the intestinal content of Clostridiales compared with the control group. Compared to the control group, the activities of head kidney superoxide dismutase (SOD), catalase (CAT), alkaline phosphatase (AKP) and lysozyme (LZM) in S2 group increased significantly (P<0.05). The contents of head kidney malondialdehyde (MDA) in yeast culture supplementation groups showed no significant difference compared with the control group (P>0.05). The S1 group significantly increased the activity of plasma SOD (P<0.05) compared to the control group, and S2 group significantly reduced the plasma malondialdehyde (MDA) content (P<0.05) compared to the control group. The yeast culture supplementation group increased the plasma lysozyme activities compared to the control group and showed no significant difference (P>0.05). The cumulative survival rate of S1 and S2 groups was significantly higher than that of the control group after 252h changed with Aeromonas hydrophila (P<0.05). The results indicated that dietary supplementation of 0.1%—0.3% yeast culture had positive effects on intestinal health, antioxidant capacity, immunity and disease resistance in largemouth bass.
Yeast culture is a micro-ecological product formed by anaerobic fermentation of yeast, containing a variety of active substances. In order to investigate the effects of yeast culture supplementation on growth performance, intestinal health, immunity and cumulative survival rate after bacteria challenge in largemouth bass (Micropterus salmoides), 1 g/kg (S1 diet) and 3 g/kg (S2 diet) of yeast culture supplementation were added to the control diet (Con diet), respectively. The three experimental diets were formulated with the same nutritional contents of protein (52%) and lipid (8.5%). The growth experiment was conducted in the pond cage (the size of 2 m×2 m×2 m). The 360 largemouth bass with the similar initial body weight of (32.37±0.15) g were divided into 3 dietary treatments, each with 3 replicates cages. 40 fish were stocked in each cage, and the growth experiment period was 11 weeks. At the end of growth experiment, the samples were taken from each cages 7h after the last feeding. The results showed that the final body weight (FBW), weight gain rate (WGR) and specific growth rate (SGR) of supplemented yeast culture groups had no significant difference compared with the control group (P>0.05). The condition factor (CF), hepatosomatic index (HSI) of supplemented yeast culture groups had no significant difference compared with the control group (P>0.05), while S2 group had the lowest value of HSI. In terms of intestinal structure, the villus length of S2 group and the depth of crypts were significantly increased compared with the control group (P<0.05). For intestinal microbes, S1 and S2 group both reduced the contents of Cyanobacteria and Staphylococcus in the intestine and increased the intestinal content of Clostridiales compared with the control group. Compared to the control group, the activities of head kidney superoxide dismutase (SOD), catalase (CAT), alkaline phosphatase (AKP) and lysozyme (LZM) in S2 group increased significantly (P<0.05). The contents of head kidney malondialdehyde (MDA) in yeast culture supplementation groups showed no significant difference compared with the control group (P>0.05). The S1 group significantly increased the activity of plasma SOD (P<0.05) compared to the control group, and S2 group significantly reduced the plasma malondialdehyde (MDA) content (P<0.05) compared to the control group. The yeast culture supplementation group increased the plasma lysozyme activities compared to the control group and showed no significant difference (P>0.05). The cumulative survival rate of S1 and S2 groups was significantly higher than that of the control group after 252h changed with Aeromonas hydrophila (P<0.05). The results indicated that dietary supplementation of 0.1%—0.3% yeast culture had positive effects on intestinal health, antioxidant capacity, immunity and disease resistance in largemouth bass.
,
Available online
, doi: 10.7541/2023.2023.0047
Abstract:
As a national second-class protected animal, Gymnocypris przewalskii is a unique indigenous fish that plays an extremely important role in maintaining the biodiversity and ecosystem stability of Qinghai Lake. After long-term adaptation to plateau extreme environment, Gymnocypris przewalskii has formed the characteristics of tolerance to hypoxia, low temperature, high salt and poor nutrition, however, due to the global temperature rises, the temperature of Qinghai Lake has been gradually increasing year by year, which causing changes of the habitat of fish. In this study, scanning electron microscopy and hematoxylin-eosin staining (HE) were used to observe the intestinal microstructure of Gymnocypris przewalskii, and its dietary characteristics were analyzed by DNA metabarcoding. The results showed that the histological structure of the foregut, midgut and hindgut of Gymnocypris przewalskii was clear and the difference was obvious. From the inside to the outside, it was composed of four layers: mucous membrane layer, submucosa layer, muscularis and serosa layer, however, due to the lack of muscularis mucosae, only three layers of membrane structure were visible under the light microscope. The researchers observed that intestinal cavity gradually decreased from the foregut to the hindgut. The height of mucosal fold was significantly decreased (P<0.05), and the width of mucosa fold was significantly increased (P<0.05). The number of goblet cells, secretory pores and secretory granules also decreased. The results of 18S rDNA and rbcL gene DNA metabarcoding sequencing showed that 51656 OTU were obtained from the intestinal contents of Gymnocypris przewalskii. After removing the sequences of fish, bacteria, archaea and fungi, a total of 39031 OTU were identified, representing 43 phyla, 114 classes, 282 orders and 435 families. At the phylum level, the main phyla are Streptophyta (53.73%), Bacillariophyta (23.19%), p__ unclassified_ d__ Eukaryota (11.14%), Cercozoa (6.67%), p__ unclassified (1.93%) and Rotifera (0.67%). At the class level, the main classes were Bryopsida (35.79%), Bacillariophyceae (23.05%), Magnoliopsida (18.03%) and Chrysophyceae (3.36%). At the order level, the main orders were Cymbellales (22.60%), Hypnales (17.97%), Rosales (17.97%) and Pottiales (17.92%). At the family level, the main families are f__unclassified_o__Cymbellales (22.46%), Rosaceae (18.03%), Pottiaceae (17.99%), Amblystegiaceae (17.63%) and Chrysocapsaaceae (2.91%). It could be seen that the main food components of Gymnocypris przewalskii are Bryopsida, Bacillariophyceae, Magnoliopsida, Chrysophyceae, Cercozoa, Rotifera and unidentified species. In all food groups, Streptophyta, Bacillariophyta and Cercozoa species are the majority, accounting for a relatively large number. To sum up, the intestinal structure of Gymnocypris przewalskii has its own specificity and the common characteristics of omnivorous fish, and the DNA metabarcoding feeding analysis results also confirmed that Gymnocypris przewalskii belongs to omnivorous fish. Phytoplankton, zooplankton, benthic animals and many currently unknown species of food could be used as its food, feeding range is extremely wide, which is mutually adapted with its intestinal structure. This study provides a scientific basis for artificial breeding and further protection of Gymnocypris przewalskii by elucidating its intestinal structure and feeding characteristics.
As a national second-class protected animal, Gymnocypris przewalskii is a unique indigenous fish that plays an extremely important role in maintaining the biodiversity and ecosystem stability of Qinghai Lake. After long-term adaptation to plateau extreme environment, Gymnocypris przewalskii has formed the characteristics of tolerance to hypoxia, low temperature, high salt and poor nutrition, however, due to the global temperature rises, the temperature of Qinghai Lake has been gradually increasing year by year, which causing changes of the habitat of fish. In this study, scanning electron microscopy and hematoxylin-eosin staining (HE) were used to observe the intestinal microstructure of Gymnocypris przewalskii, and its dietary characteristics were analyzed by DNA metabarcoding. The results showed that the histological structure of the foregut, midgut and hindgut of Gymnocypris przewalskii was clear and the difference was obvious. From the inside to the outside, it was composed of four layers: mucous membrane layer, submucosa layer, muscularis and serosa layer, however, due to the lack of muscularis mucosae, only three layers of membrane structure were visible under the light microscope. The researchers observed that intestinal cavity gradually decreased from the foregut to the hindgut. The height of mucosal fold was significantly decreased (P<0.05), and the width of mucosa fold was significantly increased (P<0.05). The number of goblet cells, secretory pores and secretory granules also decreased. The results of 18S rDNA and rbcL gene DNA metabarcoding sequencing showed that 51656 OTU were obtained from the intestinal contents of Gymnocypris przewalskii. After removing the sequences of fish, bacteria, archaea and fungi, a total of 39031 OTU were identified, representing 43 phyla, 114 classes, 282 orders and 435 families. At the phylum level, the main phyla are Streptophyta (53.73%), Bacillariophyta (23.19%), p__ unclassified_ d__ Eukaryota (11.14%), Cercozoa (6.67%), p__ unclassified (1.93%) and Rotifera (0.67%). At the class level, the main classes were Bryopsida (35.79%), Bacillariophyceae (23.05%), Magnoliopsida (18.03%) and Chrysophyceae (3.36%). At the order level, the main orders were Cymbellales (22.60%), Hypnales (17.97%), Rosales (17.97%) and Pottiales (17.92%). At the family level, the main families are f__unclassified_o__Cymbellales (22.46%), Rosaceae (18.03%), Pottiaceae (17.99%), Amblystegiaceae (17.63%) and Chrysocapsaaceae (2.91%). It could be seen that the main food components of Gymnocypris przewalskii are Bryopsida, Bacillariophyceae, Magnoliopsida, Chrysophyceae, Cercozoa, Rotifera and unidentified species. In all food groups, Streptophyta, Bacillariophyta and Cercozoa species are the majority, accounting for a relatively large number. To sum up, the intestinal structure of Gymnocypris przewalskii has its own specificity and the common characteristics of omnivorous fish, and the DNA metabarcoding feeding analysis results also confirmed that Gymnocypris przewalskii belongs to omnivorous fish. Phytoplankton, zooplankton, benthic animals and many currently unknown species of food could be used as its food, feeding range is extremely wide, which is mutually adapted with its intestinal structure. This study provides a scientific basis for artificial breeding and further protection of Gymnocypris przewalskii by elucidating its intestinal structure and feeding characteristics.
,
Available online
, doi: 10.7541/2023.2023.0043
Abstract:
In order to explore the key resistance molecules of grass carp, the study was conducted to compare the serum protein expression profiles of the candidate resistant grass carps and the control grass carps using 4D label-free quantitative proteomics. A total of 858 proteins were identified in the grass carp serum, and 329 proteins were differentially expressed in the candidate resistant grass carps and the control grass carps, with 163 up-regulated and 166 down-regulated in the former. The differentially expressed proteins were mainly related to humoral immune response regulation, including complement coagulation cascade, cell adhesion, iron death and other immune-related signaling pathways. Analysis of differentially expressed immune-related proteins showed that the expression levels of humoral immune molecules such as MASP2, C4a, C4b, C7b, C8b, C8g, C9, CFI, C3a.1, C3a.2, C3a.3 and C3a.6 and antigen presentation related immune molecules including MHC1UBA and IGL4V8, were significantly higher in the serum of candidate resistant grass carps than that in the control grass carps, however, the T cell immunity-related molecules, such as TRAV, IGHV1-1, IGHV2-1, IGHV6-1, IGHV3-2 and IGHV11-2, showed lower expression levels in the serum of candidate resistant grass carps. Notably, Western Blot analysis confirmed that humoral immune molecules, represented by C3 and IgM, were highly expressed in the serum of candidate resistant grass carps, which may be associated with the disease resistance of grass carp. The results may provide theoretical basis and molecular reference for the study of disease-related molecules of grass carp and provide molecular resources for the selective breeding of disease-resistant grass carp.
In order to explore the key resistance molecules of grass carp, the study was conducted to compare the serum protein expression profiles of the candidate resistant grass carps and the control grass carps using 4D label-free quantitative proteomics. A total of 858 proteins were identified in the grass carp serum, and 329 proteins were differentially expressed in the candidate resistant grass carps and the control grass carps, with 163 up-regulated and 166 down-regulated in the former. The differentially expressed proteins were mainly related to humoral immune response regulation, including complement coagulation cascade, cell adhesion, iron death and other immune-related signaling pathways. Analysis of differentially expressed immune-related proteins showed that the expression levels of humoral immune molecules such as MASP2, C4a, C4b, C7b, C8b, C8g, C9, CFI, C3a.1, C3a.2, C3a.3 and C3a.6 and antigen presentation related immune molecules including MHC1UBA and IGL4V8, were significantly higher in the serum of candidate resistant grass carps than that in the control grass carps, however, the T cell immunity-related molecules, such as TRAV, IGHV1-1, IGHV2-1, IGHV6-1, IGHV3-2 and IGHV11-2, showed lower expression levels in the serum of candidate resistant grass carps. Notably, Western Blot analysis confirmed that humoral immune molecules, represented by C3 and IgM, were highly expressed in the serum of candidate resistant grass carps, which may be associated with the disease resistance of grass carp. The results may provide theoretical basis and molecular reference for the study of disease-related molecules of grass carp and provide molecular resources for the selective breeding of disease-resistant grass carp.
,
Available online
, doi: 10.7541/2023.2023.0012
Abstract:
Abstract: The main economic fish species in Liaoning Province of China, the resource of Coilia nasus has sharply declined in recent years, and currently only small-scale fishing flooding can be seen in the Dayang River.In order to reconstruct C. nasus habitat history, an electron probe microanalyzer (EPMA) was used to analyze the Sr and Ca microchemistry patterns in otoliths of 20 C. nasus collected from the lower reaches of Dayang River in July and September 2020. Results of line transect analysis showed that the samples of C. nasus were of freshwater origin, and the Sr/Ca ratio of freshwater habitats were (1.49±0.61—2.75±0.53). The value of freshwater coefficient (Fc) in the C. nasus is between 0.08 and 0.52, and the diameter of the freshwater area is between 150 and 900 μ m. After entering the second change stage, the habitat history fluctuates significantly. The change of Sr/Ca ratio divided C. nasus in Dayang River into three types: (1) C. nasus overwintering in medium and high Sr/Ca ratio areas (brackish water or seawater), and migrates upstream to low Sr/Ca ratio areas (freshwater) during breeding season; (2) C. nasus live in medium and high Sr/Ca ratio areas for a long time without anadromous migration; (3) C. nasus were transformed for many times in the middle high Sr/Ca ratio areas and low Sr/Ca ratio areas, and DYH05 and 19 individuals completed the transformation for up to 9 times. The Sr content analysis result is also the same as the Sr/Ca ratio above. These three types intuitively reflect the upstream migration habits and habitat history characteristics of the Dayang River C. nasus population in natural water bodies with different salinity levels, in order to provide a theoretical basis for scientifically and accurately grasping the living habits of C. nasus from the Dayang River, formulating strategies for protecting C. nasus from the Dayang River s resources, and habitats restoration Strategy.
Abstract: The main economic fish species in Liaoning Province of China, the resource of Coilia nasus has sharply declined in recent years, and currently only small-scale fishing flooding can be seen in the Dayang River.In order to reconstruct C. nasus habitat history, an electron probe microanalyzer (EPMA) was used to analyze the Sr and Ca microchemistry patterns in otoliths of 20 C. nasus collected from the lower reaches of Dayang River in July and September 2020. Results of line transect analysis showed that the samples of C. nasus were of freshwater origin, and the Sr/Ca ratio of freshwater habitats were (1.49±0.61—2.75±0.53). The value of freshwater coefficient (Fc) in the C. nasus is between 0.08 and 0.52, and the diameter of the freshwater area is between 150 and 900 μ m. After entering the second change stage, the habitat history fluctuates significantly. The change of Sr/Ca ratio divided C. nasus in Dayang River into three types: (1) C. nasus overwintering in medium and high Sr/Ca ratio areas (brackish water or seawater), and migrates upstream to low Sr/Ca ratio areas (freshwater) during breeding season; (2) C. nasus live in medium and high Sr/Ca ratio areas for a long time without anadromous migration; (3) C. nasus were transformed for many times in the middle high Sr/Ca ratio areas and low Sr/Ca ratio areas, and DYH05 and 19 individuals completed the transformation for up to 9 times. The Sr content analysis result is also the same as the Sr/Ca ratio above. These three types intuitively reflect the upstream migration habits and habitat history characteristics of the Dayang River C. nasus population in natural water bodies with different salinity levels, in order to provide a theoretical basis for scientifically and accurately grasping the living habits of C. nasus from the Dayang River, formulating strategies for protecting C. nasus from the Dayang River s resources, and habitats restoration Strategy.
,
Available online
, doi: 10.7541/2023.2022.0389
Abstract:
In this study, a survey of the germplasm resources of Chinese soft-shelled turtle (Pelodiscus sinensis) was carried out in the drainage area of Dongting Lake and Yuanjiang River in Hunan Province. P. sinensis with nine pairs of ribs was found. In order to reveal its resource distribution, morphological characteristics and genetic characteristics, a comparative study of morphological markers, mitochondrial DNA, and polymorphisms of genes related to bone development was conducted in P. sinensis with nine pairs of ribs (R9) and P. sinensis with eight pairs of ribs (R8). As a result, a total of 331 R9 were obtained from 12222 cultured P. sinensis in Yuanjiang, Yiyang, Changde and Yueyang, accounting for 2.2%—3.1% of the total population. There are 11 thoracic vertebraes and nine pairs of ribs in the carapace of the R9, which is one thoracic vertebra and one pair of ribs more than the R8. Besides, the carapace width/carapace length, rear side skirt width/carapace length of the R9 were significantly smaller than those of the R8, and the body height/carapace length was significantly larger than that of the R8. Genes including CO I, Cytb, and 12S rRNA in the R9 and P. sinensis shared more than 99% homology. The phylogenetic analysis showed that the R9 and the P. sinensis clustered into one branch, there are shared haplotypes with the geographical populations of the Pelodiscus sinensis, and no population-specific markers were found. A total of 4 mutation sites were detected on the exons of RUNX2 and VRTN between R9 and R8, namely g.977380 C>T, g.6014427C>T, g.6015734A>C and g.6015864A>C. What’s more, there was a significant correlation between the g.6015864A>C mutation of VRTN gene and the number of thoracic vertebrae of P. sinensis (P<0.05). The above studies showed that R9 belongs to the P. sinensis, and its morphological structure differs from that of the R8 in which R9 has one more thoracic vertebra and one pair of ribs. The mutation site g.6015864A>C of VRTN gene may be related to the polyvertebrae trait of the P. sinensis. This study has important theoretical reference value for understanding the germplasm characteristics and seed industry innovation of P. sinensis.
In this study, a survey of the germplasm resources of Chinese soft-shelled turtle (Pelodiscus sinensis) was carried out in the drainage area of Dongting Lake and Yuanjiang River in Hunan Province. P. sinensis with nine pairs of ribs was found. In order to reveal its resource distribution, morphological characteristics and genetic characteristics, a comparative study of morphological markers, mitochondrial DNA, and polymorphisms of genes related to bone development was conducted in P. sinensis with nine pairs of ribs (R9) and P. sinensis with eight pairs of ribs (R8). As a result, a total of 331 R9 were obtained from 12222 cultured P. sinensis in Yuanjiang, Yiyang, Changde and Yueyang, accounting for 2.2%—3.1% of the total population. There are 11 thoracic vertebraes and nine pairs of ribs in the carapace of the R9, which is one thoracic vertebra and one pair of ribs more than the R8. Besides, the carapace width/carapace length, rear side skirt width/carapace length of the R9 were significantly smaller than those of the R8, and the body height/carapace length was significantly larger than that of the R8. Genes including CO I, Cytb, and 12S rRNA in the R9 and P. sinensis shared more than 99% homology. The phylogenetic analysis showed that the R9 and the P. sinensis clustered into one branch, there are shared haplotypes with the geographical populations of the Pelodiscus sinensis, and no population-specific markers were found. A total of 4 mutation sites were detected on the exons of RUNX2 and VRTN between R9 and R8, namely g.977380 C>T, g.6014427C>T, g.6015734A>C and g.6015864A>C. What’s more, there was a significant correlation between the g.6015864A>C mutation of VRTN gene and the number of thoracic vertebrae of P. sinensis (P<0.05). The above studies showed that R9 belongs to the P. sinensis, and its morphological structure differs from that of the R8 in which R9 has one more thoracic vertebra and one pair of ribs. The mutation site g.6015864A>C of VRTN gene may be related to the polyvertebrae trait of the P. sinensis. This study has important theoretical reference value for understanding the germplasm characteristics and seed industry innovation of P. sinensis.
,
Available online
, doi: 10.7541/2023.2022.0261
Abstract:
In order to explore the genetic diversity of the selective breeding population of Chinese mitten crab Eriocheir sinensis, 20 microsatellite markers were used to analyze the genetic diversity of 3 consecutive generations of strain A and strain B of “Changdang Lake 1” Chinese mitten crab. The results are presented in the following, a total of 551 alleles were detected from 20 microsatellite markers for 6 populations. The average number of alleles (Na) were 27.55, the average number of effective alleles (Ne) was 13.61, the average observed heterozygosity (Ho) was 0.72, the average expected heterozygosity (He) was 0.90, the average Shannon information index (I) was 2.73, and the average polymorphic information content (PIC) was 0.89. In the process of breeding, PIC of strain A and strain B had a downward trend, and He and Ho of each population maintained a high level. The effective population size (Ne) in G1 and G2 of strain A were 72.7 and 111.8, and the Ne in G1 and G2 of strain B were 67.7 and 115.8, maintaining a high level. The Hardy-Weinber balance test showed that 72.5% of the data deviated from Hardy-Weinber balance, indicating that the genetic structure of the breeding population was relatively unstable. The genetic distance between G0 and G1 of strain A was 0.2455, and it increased to 0.2607 between G1 and G2. The genetic distance between G0 and G1 of strain B was 0.1736, and it increased to 0.1751 between G1 and G2. The genetic differentiation coefficients (Fst) ranged from 0.0026 to 0.0125, indicating that the genetic differentiations among populations was light. The results of molecular variance analysis (AMOVA) analysis showed that only 0.87% of the variation originated from different populations of “Changdang Lake 1”, while 99.13% variation occurred among individuals within the population. In conclusion, the genetic diversity and the effective population size were maintained high in each population of “Changdang Lake 1” Chinese mitten crab, but the genetic structure was unstable, so enough breeding parents and genetic diversity should be maintained to prevent inbreeding depression in the future breeding of “Changdang Lake 1”. This study may provide practical reference for the breeding of new strain of Chinese mitten crab, and accumulate data onto the continuous breeding and promotion of “Changdang Lake 1”.
In order to explore the genetic diversity of the selective breeding population of Chinese mitten crab Eriocheir sinensis, 20 microsatellite markers were used to analyze the genetic diversity of 3 consecutive generations of strain A and strain B of “Changdang Lake 1” Chinese mitten crab. The results are presented in the following, a total of 551 alleles were detected from 20 microsatellite markers for 6 populations. The average number of alleles (Na) were 27.55, the average number of effective alleles (Ne) was 13.61, the average observed heterozygosity (Ho) was 0.72, the average expected heterozygosity (He) was 0.90, the average Shannon information index (I) was 2.73, and the average polymorphic information content (PIC) was 0.89. In the process of breeding, PIC of strain A and strain B had a downward trend, and He and Ho of each population maintained a high level. The effective population size (Ne) in G1 and G2 of strain A were 72.7 and 111.8, and the Ne in G1 and G2 of strain B were 67.7 and 115.8, maintaining a high level. The Hardy-Weinber balance test showed that 72.5% of the data deviated from Hardy-Weinber balance, indicating that the genetic structure of the breeding population was relatively unstable. The genetic distance between G0 and G1 of strain A was 0.2455, and it increased to 0.2607 between G1 and G2. The genetic distance between G0 and G1 of strain B was 0.1736, and it increased to 0.1751 between G1 and G2. The genetic differentiation coefficients (Fst) ranged from 0.0026 to 0.0125, indicating that the genetic differentiations among populations was light. The results of molecular variance analysis (AMOVA) analysis showed that only 0.87% of the variation originated from different populations of “Changdang Lake 1”, while 99.13% variation occurred among individuals within the population. In conclusion, the genetic diversity and the effective population size were maintained high in each population of “Changdang Lake 1” Chinese mitten crab, but the genetic structure was unstable, so enough breeding parents and genetic diversity should be maintained to prevent inbreeding depression in the future breeding of “Changdang Lake 1”. This study may provide practical reference for the breeding of new strain of Chinese mitten crab, and accumulate data onto the continuous breeding and promotion of “Changdang Lake 1”.
,
Available online
, doi: 10.7541/2023.2022.0296
Abstract:
Largemouth bass (Micropterus salmoides) has been introduced approximately for forty years, and it becomes an economically important cultured fish in China. However, there is a lack of natural population supply in breeding and a risk of genetic degradation in the utilization progress. The imbalance between large industrial demand and shortage of improved varieties of M. salmoides are arisen in China. Genetic evolution is the baseline for genetic improvement and selection breeding programs. The microsatellites with multiplex PCR method is popularity applied for genetic analyses in fish species. In this study, we developed six multiplex PCR panels based on 18 polymorphic microsatellites, and subsequently used in genetic analyses for three populations of M. salmoides, i.e., original population of American (USA), “Youlu No. 1” variety (YLO), and their hybrid population (HYB). The results showed that, the parameters of number of alleles (Na), effective number of alleles (Ne), observed heterozygosity (Ho), expected heterozygosity (He) and polymorphism information content (PIC) for 18 loci were ranged from 3 to 14, 1.622 to 5.841, 0.333 to 0.806, 0.361 to 0.810, mean with 7.722, 3.056, 0.577 and 0.579, respectively. Excluding two loci deviated from Hardy-Weinberg equilibrium, the lowest values of all diversity parameters were observed in YLO, while the highest Ho was detected in HYB (0.743), and the highest values of other diversity parameters were detected in USA. The farthest Nei’s genetic distance was evaluated between USA and YLO (0.362); meanwhile, similar Nei’s genetic distances were evaluated between HYB with other two populations (i.e., 0.112 and 0.179 for USA and YLO, respectively). Extremely significant genetic differentiations were revealed among all pairwise populations (P<0.01), and the highest fixation index was detected between USA and YLO (FST=0.209). According to the genetic structure analysis based on the allele frequency, relatively independent genetic structures were presented within USA and YLO, while admixture in genetic structure was generally showed in HYB. Additionally, the distinct distributions of individuals from three populations were visualized by using scatter plots of discriminant analysis of principal component (DAPC), and HYB showed with interval distribution between USA and YLO. In brief, six multiplex PCR panels of 18 microsatellites were developed firstly in M. salmoides, relatively high polymorphisms were detected among these loci, and the effective application in genetic analyses was evaluated in this study. That provided valuable tools for genetic and breeding researches in M. salmoides.
Largemouth bass (Micropterus salmoides) has been introduced approximately for forty years, and it becomes an economically important cultured fish in China. However, there is a lack of natural population supply in breeding and a risk of genetic degradation in the utilization progress. The imbalance between large industrial demand and shortage of improved varieties of M. salmoides are arisen in China. Genetic evolution is the baseline for genetic improvement and selection breeding programs. The microsatellites with multiplex PCR method is popularity applied for genetic analyses in fish species. In this study, we developed six multiplex PCR panels based on 18 polymorphic microsatellites, and subsequently used in genetic analyses for three populations of M. salmoides, i.e., original population of American (USA), “Youlu No. 1” variety (YLO), and their hybrid population (HYB). The results showed that, the parameters of number of alleles (Na), effective number of alleles (Ne), observed heterozygosity (Ho), expected heterozygosity (He) and polymorphism information content (PIC) for 18 loci were ranged from 3 to 14, 1.622 to 5.841, 0.333 to 0.806, 0.361 to 0.810, mean with 7.722, 3.056, 0.577 and 0.579, respectively. Excluding two loci deviated from Hardy-Weinberg equilibrium, the lowest values of all diversity parameters were observed in YLO, while the highest Ho was detected in HYB (0.743), and the highest values of other diversity parameters were detected in USA. The farthest Nei’s genetic distance was evaluated between USA and YLO (0.362); meanwhile, similar Nei’s genetic distances were evaluated between HYB with other two populations (i.e., 0.112 and 0.179 for USA and YLO, respectively). Extremely significant genetic differentiations were revealed among all pairwise populations (P<0.01), and the highest fixation index was detected between USA and YLO (FST=0.209). According to the genetic structure analysis based on the allele frequency, relatively independent genetic structures were presented within USA and YLO, while admixture in genetic structure was generally showed in HYB. Additionally, the distinct distributions of individuals from three populations were visualized by using scatter plots of discriminant analysis of principal component (DAPC), and HYB showed with interval distribution between USA and YLO. In brief, six multiplex PCR panels of 18 microsatellites were developed firstly in M. salmoides, relatively high polymorphisms were detected among these loci, and the effective application in genetic analyses was evaluated in this study. That provided valuable tools for genetic and breeding researches in M. salmoides.
,
Available online
, doi: 10.7541/2023.2023.0011
Abstract:
Schizopygopsis malacanthus is a highly specialized schizothoracine fish. Affected by changes in the external environment and human factors, the population size of S. malacanthus has declined sharply and has been listed as a vulnerable species (VU). Otolith microstructure is now regarded as a widespread phenomenon in teleost fishes and is widely accepted as a powerful tool for studying population dynamics during different stages of the life cycle. Therefore, studies on the characteristics of otolith in S. malacanthus will be helpful for better understanding the characteristics of otolith microstructure deposition, increasing the accuracy of growth characteristics, more fully reflecting the relationship between growth and environmental changes, and providing references for population dynamics research and fishery management policy formulation. In the present study, we analyzed the morphological changes of lapilli and sagittae, confirmed the deposition regularity of otolith daily increment and annuli by lapilli, calculated the formation time of the first annulus of the lapillus, and explored the relationship between its daily increment and annulus. It was found that the morphology of the lapilli was more stable than that of the sagittae, and it was more suitable for the age identification material of S. malacanthus. The breeding experiment confirmed that the first daily increment of lapillus was formed on the second day after hatching under the conditions of this experiment, the increment deposition had a daily periodicity in the larval period, and the growth increments were increments. The lapilli have an annual deposition pattern in the cultured adult fish, with an increase of one ring every year. The width of the increments in the annuli increased first and then decreased. The growth increments in width of cultured fish otoliths were larger than those of wild fish otoliths. Based on the otolith increment technique, it is calculated that the first annulus formation time of farmed and wild is from 28 Jan. to 13 Mar., 2021 (n=40) and from 8 Mar. to 10 May, 2017 (n=75) respectively. At the same time, analysis of otolith growth increments in farmed and wild samples over several years found that the number of growth increments and the annual growth width of lapilli decreased with increasing age and the annual growth area increased with increasing age. These results are helpful to improve the accuracy of age identification and provide references for the study of fish population dynamics and the formulation of fishery management policies.
Schizopygopsis malacanthus is a highly specialized schizothoracine fish. Affected by changes in the external environment and human factors, the population size of S. malacanthus has declined sharply and has been listed as a vulnerable species (VU). Otolith microstructure is now regarded as a widespread phenomenon in teleost fishes and is widely accepted as a powerful tool for studying population dynamics during different stages of the life cycle. Therefore, studies on the characteristics of otolith in S. malacanthus will be helpful for better understanding the characteristics of otolith microstructure deposition, increasing the accuracy of growth characteristics, more fully reflecting the relationship between growth and environmental changes, and providing references for population dynamics research and fishery management policy formulation. In the present study, we analyzed the morphological changes of lapilli and sagittae, confirmed the deposition regularity of otolith daily increment and annuli by lapilli, calculated the formation time of the first annulus of the lapillus, and explored the relationship between its daily increment and annulus. It was found that the morphology of the lapilli was more stable than that of the sagittae, and it was more suitable for the age identification material of S. malacanthus. The breeding experiment confirmed that the first daily increment of lapillus was formed on the second day after hatching under the conditions of this experiment, the increment deposition had a daily periodicity in the larval period, and the growth increments were increments. The lapilli have an annual deposition pattern in the cultured adult fish, with an increase of one ring every year. The width of the increments in the annuli increased first and then decreased. The growth increments in width of cultured fish otoliths were larger than those of wild fish otoliths. Based on the otolith increment technique, it is calculated that the first annulus formation time of farmed and wild is from 28 Jan. to 13 Mar., 2021 (n=40) and from 8 Mar. to 10 May, 2017 (n=75) respectively. At the same time, analysis of otolith growth increments in farmed and wild samples over several years found that the number of growth increments and the annual growth width of lapilli decreased with increasing age and the annual growth area increased with increasing age. These results are helpful to improve the accuracy of age identification and provide references for the study of fish population dynamics and the formulation of fishery management policies.
,
Available online
, doi: 10.7541/2023.2022.0437
Abstract:
Estuarine tapertail anchovy Coilia nasus is believed as a “flagship species” “indicator species” and “umbrella species” for protection of the Changjiang River ecological system. In order to reveal the otolith morphological characteristics and population delineation/identification of C. nasus in Anhui section of the Changjiang River, the landmark-based geometric morphometric analysis was utilized to comparatively study the sagittal otoliths of two ecomorphotypes (i.e., the long supermaxilla C. nasus and short supermaxilla C. brachygnathus) and five populations of the anchovy in Anqing and Tongling sections of the Changjiang River in Anhui Province. The left sagittal otolith of each specimen was used in the present study. A Leica M205A stereo microscope was used to photograph the otolith samples. Subsequently, tpsDig2 software was used to establish and measure the landmark points on the otolith photos. Based on 12 landmarks, the coordinates were analyzed by relative distortion component analysis and discriminant analysis. The morphological variation vectors were then visualized through thin plate spline analysis and mesh deformation. The results show that most of the extracted landmarks are type Ⅱ landmarks, and their contribution rate is 69.48% in the analysis of relative distorted main components, indicating that type Ⅱ landmarks were the main source of otolith morphological differences. The general discriminant accuracy of the five populations was 95.6%, indicating that significant differences in otolith morphology were generally existed among the populations of C. nasus. Especially, 100% classification accuracies were achieved for the variation between long supermaxilla C. nasus and short supermaxilla C. brachygnathus, as well as among 3 populations of long supermaxilla C. nasus. Therefore, it will be reasonable to believe that the differences of otolith morphometrics particularly observed in the long vs. short supermaxilla ecomorphotypes and 3 populations of long supermaxilla C. nasus could reflect the evidences of ecomorphotype differentiation and high/low level population connectivity. The aforementioned findings can provide theoretic basis and supports for objective evaluations of resource composition and population difference of C. nasus in Anhui section of the Changjiang River before and after the 10-year fishing ban policy. Furthermore, this study provides an important reference case for population delineation or identification of different ecomorphotype C. nasus in other waters and other commercial fish resources the Changjiang River Basin.
Estuarine tapertail anchovy Coilia nasus is believed as a “flagship species” “indicator species” and “umbrella species” for protection of the Changjiang River ecological system. In order to reveal the otolith morphological characteristics and population delineation/identification of C. nasus in Anhui section of the Changjiang River, the landmark-based geometric morphometric analysis was utilized to comparatively study the sagittal otoliths of two ecomorphotypes (i.e., the long supermaxilla C. nasus and short supermaxilla C. brachygnathus) and five populations of the anchovy in Anqing and Tongling sections of the Changjiang River in Anhui Province. The left sagittal otolith of each specimen was used in the present study. A Leica M205A stereo microscope was used to photograph the otolith samples. Subsequently, tpsDig2 software was used to establish and measure the landmark points on the otolith photos. Based on 12 landmarks, the coordinates were analyzed by relative distortion component analysis and discriminant analysis. The morphological variation vectors were then visualized through thin plate spline analysis and mesh deformation. The results show that most of the extracted landmarks are type Ⅱ landmarks, and their contribution rate is 69.48% in the analysis of relative distorted main components, indicating that type Ⅱ landmarks were the main source of otolith morphological differences. The general discriminant accuracy of the five populations was 95.6%, indicating that significant differences in otolith morphology were generally existed among the populations of C. nasus. Especially, 100% classification accuracies were achieved for the variation between long supermaxilla C. nasus and short supermaxilla C. brachygnathus, as well as among 3 populations of long supermaxilla C. nasus. Therefore, it will be reasonable to believe that the differences of otolith morphometrics particularly observed in the long vs. short supermaxilla ecomorphotypes and 3 populations of long supermaxilla C. nasus could reflect the evidences of ecomorphotype differentiation and high/low level population connectivity. The aforementioned findings can provide theoretic basis and supports for objective evaluations of resource composition and population difference of C. nasus in Anhui section of the Changjiang River before and after the 10-year fishing ban policy. Furthermore, this study provides an important reference case for population delineation or identification of different ecomorphotype C. nasus in other waters and other commercial fish resources the Changjiang River Basin.
,
Available online
, doi: 10.7541/2023.2022.0329
Abstract:
Mariculture conservation is an important initiative to complement the life history of Chinese sturgeon (Acipenser sinensis) and implement land-sea relay conservation. In order to investigate the potential bait resources of Chinese sturgeon in offshore marine pastures and the ability of marine enclosures, we conducted an annual survey of the Bailong island marine ranch off the coast of Wenzhou, Zhejiang Province, and assessed the amount of benthic and lower-middle biological resources in the marine ranch. Through the analysis of the feeding and growth status of the Chinese sturgeon and the contents of the digestive tract, the types of food that the Chinese sturgeon can eat in the marine pasture were obtained and verified, and the maximum resource carrying capacity of the Chinese sturgeon was estimated. The results showed that a total of 47 species of prey organisms were collected from the Bailong island marine ranch, belonging to 5 phyla and 8 classes, including 38 species of benthic animals and 9 species of lower-middle organisms. According to historical literature data, all of them could be eaten by Chinese sturgeon; According to the analysis of the contents of the digestive tract, the stocked Chinese sturgeon was adapted to the marine ranch and feed on their own. It is verified that it has ingested a total of 16 species of prey organisms collected from 4 phyla and 5 classes. The food composition was arranged according to the relative importance index (IRI): Crustacea (mainly shrimp and crabs)>Gastropoda>Fish>Pleurobranchia>Polychaete, and the feeding preference was arranged according to the size of the feeding selection coefficient: Crustacea>Belly Foot class>Petalbranch class>Polychaete>Fish. The annual maximum sustainable yield of potential bait resources of Chinese sturgeon in Bailong island marine ranch is about 811.389 kg, which can be used for 69 Chinese sturgeon juveniles to grow to sexual maturity. The results of this study indicate that the offshore fenced marine ranch is a potential model for marine conservation of Chinese sturgeon. In the next step, it is necessary to further study how to improve the scale and effect of marine fence conservation under the mode of artificial supplementation of natural bait, so as to provide basic data for the formation of Chinese sturgeon land-sea relay conservation.
Mariculture conservation is an important initiative to complement the life history of Chinese sturgeon (Acipenser sinensis) and implement land-sea relay conservation. In order to investigate the potential bait resources of Chinese sturgeon in offshore marine pastures and the ability of marine enclosures, we conducted an annual survey of the Bailong island marine ranch off the coast of Wenzhou, Zhejiang Province, and assessed the amount of benthic and lower-middle biological resources in the marine ranch. Through the analysis of the feeding and growth status of the Chinese sturgeon and the contents of the digestive tract, the types of food that the Chinese sturgeon can eat in the marine pasture were obtained and verified, and the maximum resource carrying capacity of the Chinese sturgeon was estimated. The results showed that a total of 47 species of prey organisms were collected from the Bailong island marine ranch, belonging to 5 phyla and 8 classes, including 38 species of benthic animals and 9 species of lower-middle organisms. According to historical literature data, all of them could be eaten by Chinese sturgeon; According to the analysis of the contents of the digestive tract, the stocked Chinese sturgeon was adapted to the marine ranch and feed on their own. It is verified that it has ingested a total of 16 species of prey organisms collected from 4 phyla and 5 classes. The food composition was arranged according to the relative importance index (IRI): Crustacea (mainly shrimp and crabs)>Gastropoda>Fish>Pleurobranchia>Polychaete, and the feeding preference was arranged according to the size of the feeding selection coefficient: Crustacea>Belly Foot class>Petalbranch class>Polychaete>Fish. The annual maximum sustainable yield of potential bait resources of Chinese sturgeon in Bailong island marine ranch is about 811.389 kg, which can be used for 69 Chinese sturgeon juveniles to grow to sexual maturity. The results of this study indicate that the offshore fenced marine ranch is a potential model for marine conservation of Chinese sturgeon. In the next step, it is necessary to further study how to improve the scale and effect of marine fence conservation under the mode of artificial supplementation of natural bait, so as to provide basic data for the formation of Chinese sturgeon land-sea relay conservation.
,
Available online
, doi: 10.7541/2023.2022.0117
Abstract:
Hydrological connection plays an important role in maintaining biodiversity and ecosystem function. In order to explain the effect of internal hydrological disconnection and response of fish communities, we selected a typical hydrological disconnection lake in middle reaches of Yangtze River-Bao’an Lake as the study object. Field sampling was conducted in Xiaosihai Lake (part of Bao’an Lake, complete disconnection), Biandantang Lake (part of Bao’an Lake, semi-disconnection), Qiaodun Lake (part of Bao’an Lake, semi-disconnection) and the main lake in both summer and autumn from 2019 to 2020. We compared and analyzed the differences of fish communities and functional diversity among those lakes using the multiple statistical methods. Result showed that the fish community structure in the complete disconnection lake had been changed significantly, which species number (15±3) was significantly lower than that in the semi- disconnection lake (22±3) and the main lake (23±3; P<0.05); abundance increased while the biomass decreased; the species richness index, the Shannon index and the Simpson index were significantly lower; and functional richness index, functional dispersion index and functional evenness index were also significantly lower the other lakes (P<0.05). However, the fish community structure in the semi-disconnection lake had no significant difference with that in the main lake. The Permutational multivariate analysis of variance and non-metric multidimensional scaling analysis also showed that the fish community in the complete disconnection lake significantly distinguished from the semi-disconnection lakes and the main lake (P<0.05), while there was no significant difference between the fish communities of semi-disconnection lakes and main lake was closer. Our study found that the internal hydrological disconnection in lake also has an important impact on the composition of fish communities, and restoring the free hydrological connectivity within lake was crucial to ecological management and biodiversity conservation.
Hydrological connection plays an important role in maintaining biodiversity and ecosystem function. In order to explain the effect of internal hydrological disconnection and response of fish communities, we selected a typical hydrological disconnection lake in middle reaches of Yangtze River-Bao’an Lake as the study object. Field sampling was conducted in Xiaosihai Lake (part of Bao’an Lake, complete disconnection), Biandantang Lake (part of Bao’an Lake, semi-disconnection), Qiaodun Lake (part of Bao’an Lake, semi-disconnection) and the main lake in both summer and autumn from 2019 to 2020. We compared and analyzed the differences of fish communities and functional diversity among those lakes using the multiple statistical methods. Result showed that the fish community structure in the complete disconnection lake had been changed significantly, which species number (15±3) was significantly lower than that in the semi- disconnection lake (22±3) and the main lake (23±3; P<0.05); abundance increased while the biomass decreased; the species richness index, the Shannon index and the Simpson index were significantly lower; and functional richness index, functional dispersion index and functional evenness index were also significantly lower the other lakes (P<0.05). However, the fish community structure in the semi-disconnection lake had no significant difference with that in the main lake. The Permutational multivariate analysis of variance and non-metric multidimensional scaling analysis also showed that the fish community in the complete disconnection lake significantly distinguished from the semi-disconnection lakes and the main lake (P<0.05), while there was no significant difference between the fish communities of semi-disconnection lakes and main lake was closer. Our study found that the internal hydrological disconnection in lake also has an important impact on the composition of fish communities, and restoring the free hydrological connectivity within lake was crucial to ecological management and biodiversity conservation.
,
Available online
, doi: 10.7541/2023.2022.0427
Abstract:
Biodiversity is not only the key factor to maintain the stability of the ecosystem, but also the basis of human survival and sustainable development. Both dominant and key species play important roles in maintaining biodiversity and ecosystem stability. Therefore, the selection of key species is the basis of biodiversity conservation and one of the beneficial methods to analyze and explore the structure of the ecosystem. As a typical nearshore island in the north of China, Miaodao Archipelago has important value in ecosystem services and biodiversity maintenance. Phica largha pallas and Neophocaena Asiaeorientalis sunameri are representative flagship species. In the past, researchers have carried out a systematic and comprehensive investigation of the ecological environment, vegetation status, and plankton distribution in the adjacent waters of the region, but there are few reports on the scientific research on the fishery resources in the adjacent waters. In recent decades, the structure of fishery resources in the Bohai Sea and the North Yellow Sea, which are important fishery waters in northern China, has changed to some extent due to the influence of human activities and climate change. The adjacent sea area of Miaodao Archipelago plays an important role in maintaining fishery resource structure and biodiversity in the Bohai Sea and the North Yellow Sea as an important migration channel and habitat. Therefore, it is urgent to carry out systematic research on fishery communities in this area to make up for the lack of relevant data. This study focuses on the key species of the bottom fishery community in this area. Since there are many small benthic invertebrates and small fishes in the bottom fishery community in the adjacent waters of Miaodao Islands, it is impossible to obtain feeding data by traditional gastric content method and published literature. Therefore, important and dominant species with IRI>100 were selected as the research objects for this key species screening. Remove the interference of a smaller number of redundant species. Based on the feeding relationship between important species and dominant species (IRI>100) in bottom fishery organisms in the adjacent waters of Miaodao Islands, this study calculated the topological index of the structure based on the topological structure of food web and network analysis method, and screened key species. The results showed that the study area contains a total of 37 important and dominant species (IRI>100), 223 feeding relationships, node density of 0.17, connection density of 6.03, connection complexity index of 12.21, and interspecific association degree. The index is 0.16, the feature path length is 2.10, and the average clustering coefficient is 0.30. Comprehensive topological index ranking (D, Dout, Din, BC, CC, IC, TI1, TI3, TI5, K, Kb, Kt, F and DF), screening for export mantis shrimp (Oratosquilla oratoria), Japanese drum shrimp (Alpheus japonicus), Pennahia argentata, Chaemrichthys stigmatias, Glossaulax didyma are the main key species in the study area. Among them, mantis shrimp and white jellyfish are the key predators, gobies are the key intermediate species, and the platy snail is the key bait species, while the Japanese drum shrimp is between the key intermediate species and the key bait species. Most species in the regional food web are likely to be very close “neighbors”, and negative impacts can spread rapidly and widely throughout the food web. For example, the effects of disturbances such as overfishing may be more widespread in this marine ecosystem. However, rich interaction networks quantified by high connectivity and low path lengths may also suggest that strong effects can spread rapidly throughout the marine food web, reducing the overall impact of any particular fluctuation. The results can provide basic data and a scientific basis for further understanding of the marine food web structure in the adjacent waters of the Miaodao Islands and the protection of biodiversity. In the future, more methods should be combined to carry out a more systematic study on the seasonal and interannual changes of key species in this area, to provide information for the adjacent islands in my country. The related research on the structure of the marine food web provides a more scientific and valuable reference.
Biodiversity is not only the key factor to maintain the stability of the ecosystem, but also the basis of human survival and sustainable development. Both dominant and key species play important roles in maintaining biodiversity and ecosystem stability. Therefore, the selection of key species is the basis of biodiversity conservation and one of the beneficial methods to analyze and explore the structure of the ecosystem. As a typical nearshore island in the north of China, Miaodao Archipelago has important value in ecosystem services and biodiversity maintenance. Phica largha pallas and Neophocaena Asiaeorientalis sunameri are representative flagship species. In the past, researchers have carried out a systematic and comprehensive investigation of the ecological environment, vegetation status, and plankton distribution in the adjacent waters of the region, but there are few reports on the scientific research on the fishery resources in the adjacent waters. In recent decades, the structure of fishery resources in the Bohai Sea and the North Yellow Sea, which are important fishery waters in northern China, has changed to some extent due to the influence of human activities and climate change. The adjacent sea area of Miaodao Archipelago plays an important role in maintaining fishery resource structure and biodiversity in the Bohai Sea and the North Yellow Sea as an important migration channel and habitat. Therefore, it is urgent to carry out systematic research on fishery communities in this area to make up for the lack of relevant data. This study focuses on the key species of the bottom fishery community in this area. Since there are many small benthic invertebrates and small fishes in the bottom fishery community in the adjacent waters of Miaodao Islands, it is impossible to obtain feeding data by traditional gastric content method and published literature. Therefore, important and dominant species with IRI>100 were selected as the research objects for this key species screening. Remove the interference of a smaller number of redundant species. Based on the feeding relationship between important species and dominant species (IRI>100) in bottom fishery organisms in the adjacent waters of Miaodao Islands, this study calculated the topological index of the structure based on the topological structure of food web and network analysis method, and screened key species. The results showed that the study area contains a total of 37 important and dominant species (IRI>100), 223 feeding relationships, node density of 0.17, connection density of 6.03, connection complexity index of 12.21, and interspecific association degree. The index is 0.16, the feature path length is 2.10, and the average clustering coefficient is 0.30. Comprehensive topological index ranking (D, Dout, Din, BC, CC, IC, TI1, TI3, TI5, K, Kb, Kt, F and DF), screening for export mantis shrimp (Oratosquilla oratoria), Japanese drum shrimp (Alpheus japonicus), Pennahia argentata, Chaemrichthys stigmatias, Glossaulax didyma are the main key species in the study area. Among them, mantis shrimp and white jellyfish are the key predators, gobies are the key intermediate species, and the platy snail is the key bait species, while the Japanese drum shrimp is between the key intermediate species and the key bait species. Most species in the regional food web are likely to be very close “neighbors”, and negative impacts can spread rapidly and widely throughout the food web. For example, the effects of disturbances such as overfishing may be more widespread in this marine ecosystem. However, rich interaction networks quantified by high connectivity and low path lengths may also suggest that strong effects can spread rapidly throughout the marine food web, reducing the overall impact of any particular fluctuation. The results can provide basic data and a scientific basis for further understanding of the marine food web structure in the adjacent waters of the Miaodao Islands and the protection of biodiversity. In the future, more methods should be combined to carry out a more systematic study on the seasonal and interannual changes of key species in this area, to provide information for the adjacent islands in my country. The related research on the structure of the marine food web provides a more scientific and valuable reference.
,
Available online
, doi: 10.7541/2023.2022.0448
Abstract:
The East Island is the second largest island of Xisha Islands, which is a typical coral reef island, and the coral reef is known as the tropical rain forest in the ocean and high biodiversity. In order to better protect and manage the coral reef fish resources in East Island, we investigated the coral reef fish through underwater video and underwater diving fishing, and systematically discussed the species composition and historical evolution characteristics of coral reef fish in combination with historical research in 2021 and 2022. The results were as follows, at present, 235 species of coral reef fish were found in the East Island, belonging to Osteichthys (222 species) and Chondrichthyes (13 species), which were composed of 16 orders and 55 families, of which Perciformes had the largest number of 181 species, and Chaetodontidae and Scaridae had the largest number of 22 species. The correlation between the number of fish species in the coral reef of East Island and its corresponding maximum total length index decreased significantly with the increase of the maximum total length. Small-sized fish was the most common in East Island, accounting for 38.72% of the total species; the second was medium-sized fish, 34.47%; 26.81% of large-sized fish. According to the type of feeding habits, East Island had the largest number of carnivorous fish, 133 species, accounting for 56.60% of the total species; there was little difference between omnivorous and herbivorous fishes, which were 52 and 50 species respectively. From the perspective of similarity, the similarity index between different time periods was low, which confirmed that fish had undergone great succession changes. The comparison between this study and the historical survey shows that there were 103 species of fish that had not been found, especially carnivorous fish, accounting for 74.76% of the undiscovered fish; in this study, 40 species of undiscovered large-sized fish were almost all carnivorous fish, both of which indicate that fish are overfishing. At the same time, 14 species of fish in the coral reef of East Island were listed in the IUCN Red List. Except for one species, others were not found in this study, and all were large fish, which supported the theory that large fish were easy to be extinct. 70.97% of the undiscovered small fish species were reef fish, and long spined starfish were found, both of which indicate that the coral reef waters of East Island were also affected by habitat degradation. The results of this study provide a basic reference for the succession trend of coral reef fish and basic data for the restoration, protection and management of coral reef ecosystem.
The East Island is the second largest island of Xisha Islands, which is a typical coral reef island, and the coral reef is known as the tropical rain forest in the ocean and high biodiversity. In order to better protect and manage the coral reef fish resources in East Island, we investigated the coral reef fish through underwater video and underwater diving fishing, and systematically discussed the species composition and historical evolution characteristics of coral reef fish in combination with historical research in 2021 and 2022. The results were as follows, at present, 235 species of coral reef fish were found in the East Island, belonging to Osteichthys (222 species) and Chondrichthyes (13 species), which were composed of 16 orders and 55 families, of which Perciformes had the largest number of 181 species, and Chaetodontidae and Scaridae had the largest number of 22 species. The correlation between the number of fish species in the coral reef of East Island and its corresponding maximum total length index decreased significantly with the increase of the maximum total length. Small-sized fish was the most common in East Island, accounting for 38.72% of the total species; the second was medium-sized fish, 34.47%; 26.81% of large-sized fish. According to the type of feeding habits, East Island had the largest number of carnivorous fish, 133 species, accounting for 56.60% of the total species; there was little difference between omnivorous and herbivorous fishes, which were 52 and 50 species respectively. From the perspective of similarity, the similarity index between different time periods was low, which confirmed that fish had undergone great succession changes. The comparison between this study and the historical survey shows that there were 103 species of fish that had not been found, especially carnivorous fish, accounting for 74.76% of the undiscovered fish; in this study, 40 species of undiscovered large-sized fish were almost all carnivorous fish, both of which indicate that fish are overfishing. At the same time, 14 species of fish in the coral reef of East Island were listed in the IUCN Red List. Except for one species, others were not found in this study, and all were large fish, which supported the theory that large fish were easy to be extinct. 70.97% of the undiscovered small fish species were reef fish, and long spined starfish were found, both of which indicate that the coral reef waters of East Island were also affected by habitat degradation. The results of this study provide a basic reference for the succession trend of coral reef fish and basic data for the restoration, protection and management of coral reef ecosystem.
,
Available online
, doi: 10.7541/2023.2022.0464
Abstract:
Feed attractants have been widely used to improve the palatability of aquatic animal feeds, but there are few studies on the effects of feed attractants on growth and health of Litopenaeus vannamei. This study aims to investigate the effects of betaine supplementations on growth performance, feed utilization, lipid metabolism, and immune response of Litopenaeus vannamei fed two levels of raw feed attractants (8%, 0). Juvenile shrimp [initial body weight (0.71±0.00) g] were randomly distributed into four groups, each group included four fiberglass tanks [30 shrimp in each tank (0.3 m³)]. The shrimp were fed with raw feed attractants group (P), soybean meal replacing feed attractants in P (N), raw feed attractants + betaine group (PB) and betaine supplementation group (NB) for 7 weeks, respectively. Results showed that the raw feed attractants enhanced the expression levels of fas, acc, sod, dorsal, relish in hepatopancreas, as well as toll and sod in the intestine of shrimp, while the expression levels of relish in the intestine were reversed. Betaine increased ash content in muscle, upregulated fas, acc, sod, and dorsal in hepatopancreas, as well as sod expression in the intestine, while it decreased feed intake, muscle crude lipid, low density lipoprotein cholesterol, malondialdehyde contents and total nitric oxide synthase activity in hepatopancreas, as well as the expression levels of acox, cpt-1, myd88 and relish in hepatopancreas. The interaction of raw feed attractants and betaine had significant effects on feed conversion ratio, hepatopancreas total nitric oxide synthase activity, ampk, acc, cpt-1, sod, myd88 and relish. In conclusion, a diet with 1.30% yeast extract +4.80% squid viscera powder+1.90% fish soluble improves the immunity and antioxidant capacity of shrimp. Dietary 0.6% betaine reduces feed intake and promotes lipid utilization, and up-regulates the expression of immune-related genes of shrimp. This study showed that two dietary betaine supplementations on growth, feed utilization, lipid metabolism, and immune response of white shrimp (Litopenaeus vannamei) fed two levels of compound attractants, which provides reference value for white shrimp culture.
Feed attractants have been widely used to improve the palatability of aquatic animal feeds, but there are few studies on the effects of feed attractants on growth and health of Litopenaeus vannamei. This study aims to investigate the effects of betaine supplementations on growth performance, feed utilization, lipid metabolism, and immune response of Litopenaeus vannamei fed two levels of raw feed attractants (8%, 0). Juvenile shrimp [initial body weight (0.71±0.00) g] were randomly distributed into four groups, each group included four fiberglass tanks [30 shrimp in each tank (0.3 m³)]. The shrimp were fed with raw feed attractants group (P), soybean meal replacing feed attractants in P (N), raw feed attractants + betaine group (PB) and betaine supplementation group (NB) for 7 weeks, respectively. Results showed that the raw feed attractants enhanced the expression levels of fas, acc, sod, dorsal, relish in hepatopancreas, as well as toll and sod in the intestine of shrimp, while the expression levels of relish in the intestine were reversed. Betaine increased ash content in muscle, upregulated fas, acc, sod, and dorsal in hepatopancreas, as well as sod expression in the intestine, while it decreased feed intake, muscle crude lipid, low density lipoprotein cholesterol, malondialdehyde contents and total nitric oxide synthase activity in hepatopancreas, as well as the expression levels of acox, cpt-1, myd88 and relish in hepatopancreas. The interaction of raw feed attractants and betaine had significant effects on feed conversion ratio, hepatopancreas total nitric oxide synthase activity, ampk, acc, cpt-1, sod, myd88 and relish. In conclusion, a diet with 1.30% yeast extract +4.80% squid viscera powder+1.90% fish soluble improves the immunity and antioxidant capacity of shrimp. Dietary 0.6% betaine reduces feed intake and promotes lipid utilization, and up-regulates the expression of immune-related genes of shrimp. This study showed that two dietary betaine supplementations on growth, feed utilization, lipid metabolism, and immune response of white shrimp (Litopenaeus vannamei) fed two levels of compound attractants, which provides reference value for white shrimp culture.
,
Available online
, doi: 10.7541/2023.2022.0496
Abstract:
In order to explore the effects of fermented feed on growth performance, antioxidant capacity and intestinal microorganisms of Macrobrachium nipponense, five experimental groups were designed as follow: L1 group (100% basal feed), L2 group (87.5% basal feed +12.5% fermented feed), L3 group (75% basal feed +25% fermented feed), L4 group (50% basal feed +50% fermented feed) and L5 group (100% fermented feed). M. nipponense of (0.09±0.01) g with similar size was selected for 56d culture experiment. The results showed that the contents of soluble protein and small peptide in the compound feed were significantly increased after feed fermentation (P<0.05), the number of beneficial bacteria was significantly increased, and the number of mold was inhibited after feed fermentation. The results of culture experiment showed that the survival rate of all groups was above 80%, and there was no significant difference (P>0.05). The weight gain rate was increased first and then decreased. The weight gain rate of L3 and L4 group was significantly higher than that of the control group (P<0.05), and the feed conversion ratio of L3 group was significantly lower than that of control group (P<0.05). The SOD activity of L3, L4 and L5 groups was significantly higher than that of L1 group (P<0.05), the MDA content of L2, L3 and L4 groups was significantly lower than that of L1 group (P<0.05), the superoxide anion clearance rate of L2 and L5 was significantly higher than L1 group (P<0.05), and the superoxide anion clearance rate of L4 group was significantly lower than that of L1 group (P<0.05). The contents of serum ALT, AST and ALB were significantly lower than that of control group (P<0.05), and the content of RUEA in L1 and L2 groups was significantly higher than that of other groups (P<0.05). GLU content in L2, L3 and L4 groups was significantly higher than that of L1 group (P<0.05). There were no significant differences in the contents of total triglyceride (TG), total cholesterol (TC) and total protein (TP) among all groups (P>0.05). The intestinal microbial results showed that the OTU number, Observed species index, Shannon index, and Chao1 index of group L3 were higher than that of group L1(P<0.05). PCA results showed that the community structure between group L1 and L3 was significantly different. At the genus level, the abundance of Aeromonas in group L1 was significantly higher than that in group L3 (P<0.05), and the abundance of Diverbacter and Bacillus in group L3 was significantly higher than that of group L1 (P<0.05). These results indicated that fermented diet could increase nutrient content, weight gain rate, reduce feed conversion ratio, improve antioxidant capacity and intestinal microbial community structure, and inhibit pathogenic bacteria in prawns. The suitable addition ratio of fermented feed is about 25%.
In order to explore the effects of fermented feed on growth performance, antioxidant capacity and intestinal microorganisms of Macrobrachium nipponense, five experimental groups were designed as follow: L1 group (100% basal feed), L2 group (87.5% basal feed +12.5% fermented feed), L3 group (75% basal feed +25% fermented feed), L4 group (50% basal feed +50% fermented feed) and L5 group (100% fermented feed). M. nipponense of (0.09±0.01) g with similar size was selected for 56d culture experiment. The results showed that the contents of soluble protein and small peptide in the compound feed were significantly increased after feed fermentation (P<0.05), the number of beneficial bacteria was significantly increased, and the number of mold was inhibited after feed fermentation. The results of culture experiment showed that the survival rate of all groups was above 80%, and there was no significant difference (P>0.05). The weight gain rate was increased first and then decreased. The weight gain rate of L3 and L4 group was significantly higher than that of the control group (P<0.05), and the feed conversion ratio of L3 group was significantly lower than that of control group (P<0.05). The SOD activity of L3, L4 and L5 groups was significantly higher than that of L1 group (P<0.05), the MDA content of L2, L3 and L4 groups was significantly lower than that of L1 group (P<0.05), the superoxide anion clearance rate of L2 and L5 was significantly higher than L1 group (P<0.05), and the superoxide anion clearance rate of L4 group was significantly lower than that of L1 group (P<0.05). The contents of serum ALT, AST and ALB were significantly lower than that of control group (P<0.05), and the content of RUEA in L1 and L2 groups was significantly higher than that of other groups (P<0.05). GLU content in L2, L3 and L4 groups was significantly higher than that of L1 group (P<0.05). There were no significant differences in the contents of total triglyceride (TG), total cholesterol (TC) and total protein (TP) among all groups (P>0.05). The intestinal microbial results showed that the OTU number, Observed species index, Shannon index, and Chao1 index of group L3 were higher than that of group L1(P<0.05). PCA results showed that the community structure between group L1 and L3 was significantly different. At the genus level, the abundance of Aeromonas in group L1 was significantly higher than that in group L3 (P<0.05), and the abundance of Diverbacter and Bacillus in group L3 was significantly higher than that of group L1 (P<0.05). These results indicated that fermented diet could increase nutrient content, weight gain rate, reduce feed conversion ratio, improve antioxidant capacity and intestinal microbial community structure, and inhibit pathogenic bacteria in prawns. The suitable addition ratio of fermented feed is about 25%.
,
Available online
, doi: 10.7541/2023.2022.0381
Abstract:
Rainbow trout (Oncorhynchus mykiss) is an important cold-water fish with high nutritional and economic value in China, however, less researches of high-quality rainbow trout germplasm resources populations were reported. This study aimed to provide essential data for assessing the nutrient composition of rainbow trout muscle, trait screening and the breeding process of new species by comprehensively evaluating the muscle nutritional components and quality of representative breeding populations of rainbow trout in six different regions. The 2—3 years old rainbow trout originally from Mudanjiang, Heilongjiang (HM), Ningan, Heilongjiang (HN), Gansu (GL), Xinjiang (XY), Jilin (JB) and Liaoning (LB). Thirty fish from each population were divided equally into three replicates, and the composition and content of moisture, crude protein, crude fat, ash content, amino acids and fatty acids in muscle were measured according to the national standard. The results showed that there were significant differences (P<0.05) in moisture (66.50%—77.00%), ash (1.12%—1.43%), crude protein (19.00%—21.84%) and crude fat (2.04%—9.08%) among the breeding groups, and the crude protein content of HN (21.26%) and GL (21.84%) was significantly higher than the other populations (P<0.05). In addition, the protein content of arious groups was greater than 16.00% and met the Food and Agriculture Organization of the United Nations (FAO)/Word Health Organization (WHO) Standard (2013). Seventeen amino acids were detected in the six breeding populations with a total amino acid contents (TAA) were 15.27%—18.90%. The total amino acid components were significantly higher in LB and JB than those in the other four breeding populations (P<0.05), and also had higher essential amino acid index scores (EAAI). Among the 17 amino acids, Glu had the highest content (2.64%—2.88%), followed by Asp (1.58%—2.03%). The content of fresh amino acids was as high as 11.25%—11.79%, indicating that rainbow trout muscles were fresh and tender, and the amino acid index (AAS), chemical index (CS) and EAAI of all populations were higher than the standard of FAO. Twenty-three fatty acids were detected in the six breeding populations, containing eight saturated fatty acid (SFA), four monounsaturated fatty acids (MUFA) and eleven polyunsaturated fatty acids (PUFA), with contents of 17.81%—31.75%, 27.86%—30.35% and 40.25%—54.32%. The PUFA to SFA ratio was between 1.34 to 3.05. HN and XY had higher SFA than other populations, while HM and GL had higher PUFA than other populations. Additionally, JB and LB had relatively higher MUFA than other populations. Taken together, six representative breeding groups of rainbow trout have balanced muscular nutrients and meet the FAO/WHO standard, which provides germplasm resources for rainbow trout breeding.
Rainbow trout (Oncorhynchus mykiss) is an important cold-water fish with high nutritional and economic value in China, however, less researches of high-quality rainbow trout germplasm resources populations were reported. This study aimed to provide essential data for assessing the nutrient composition of rainbow trout muscle, trait screening and the breeding process of new species by comprehensively evaluating the muscle nutritional components and quality of representative breeding populations of rainbow trout in six different regions. The 2—3 years old rainbow trout originally from Mudanjiang, Heilongjiang (HM), Ningan, Heilongjiang (HN), Gansu (GL), Xinjiang (XY), Jilin (JB) and Liaoning (LB). Thirty fish from each population were divided equally into three replicates, and the composition and content of moisture, crude protein, crude fat, ash content, amino acids and fatty acids in muscle were measured according to the national standard. The results showed that there were significant differences (P<0.05) in moisture (66.50%—77.00%), ash (1.12%—1.43%), crude protein (19.00%—21.84%) and crude fat (2.04%—9.08%) among the breeding groups, and the crude protein content of HN (21.26%) and GL (21.84%) was significantly higher than the other populations (P<0.05). In addition, the protein content of arious groups was greater than 16.00% and met the Food and Agriculture Organization of the United Nations (FAO)/Word Health Organization (WHO) Standard (2013). Seventeen amino acids were detected in the six breeding populations with a total amino acid contents (TAA) were 15.27%—18.90%. The total amino acid components were significantly higher in LB and JB than those in the other four breeding populations (P<0.05), and also had higher essential amino acid index scores (EAAI). Among the 17 amino acids, Glu had the highest content (2.64%—2.88%), followed by Asp (1.58%—2.03%). The content of fresh amino acids was as high as 11.25%—11.79%, indicating that rainbow trout muscles were fresh and tender, and the amino acid index (AAS), chemical index (CS) and EAAI of all populations were higher than the standard of FAO. Twenty-three fatty acids were detected in the six breeding populations, containing eight saturated fatty acid (SFA), four monounsaturated fatty acids (MUFA) and eleven polyunsaturated fatty acids (PUFA), with contents of 17.81%—31.75%, 27.86%—30.35% and 40.25%—54.32%. The PUFA to SFA ratio was between 1.34 to 3.05. HN and XY had higher SFA than other populations, while HM and GL had higher PUFA than other populations. Additionally, JB and LB had relatively higher MUFA than other populations. Taken together, six representative breeding groups of rainbow trout have balanced muscular nutrients and meet the FAO/WHO standard, which provides germplasm resources for rainbow trout breeding.
,
Available online
, doi: 10.7541/2022.2022.0405
Abstract:
Finding inexpensive and high-quality protein sources to replace fish meal is currently a thorny issue for the feed industry due to the decline in fishery resources and the increased demand for fishmeal, which has led to a significant increase in fishmeal prices. In this study, we selected five new non-grain protein sources, Clostridium autoethanogenum protein (CAP), Chlorell meal (CM), Hermetia illucens meal (HM), Tenebrio molitor meal (TM), and cottonseed protein concentrate (CPC). This study was conducted to evaluate the apparent digestibility of dry matter, crude protein, crude lipid, gross energy, and amino acid of these five protein sources by large yellow croakers ( Larimichthys crocea) to provide a theoretical basis for the design of artificial compound feed formulations for large yellow croakers. Triplicate groups of fish [initial weight=(154.0±5.3)g] were fed the test diets to apparent satiation two times daily for eight weeks. The test diets consisted of 70% basal diet and 30% test ingredients, and 0.1% yttrium oxide (Y 2O 3) was used as an indicator. The results showed that dry matter coefficients of five test ingredients ranged from 56.77% to 75.53%(CAP>TM>CM>HM>CPC); The apparent digestibility of the crude protein ranged from 69.93% to 89.59%(CAP>CM>CPC>HM>TM); The apparent digestibility of crude lipid ranged from 58.58% to 93.77%(CAP>CM>TM>CPC>HM); The apparent digestibility of the gross energy ranged from 63.39% to 84.33%(CAP>HM>CM>TM>CPC); The apparent digestibility of the total amino acids ranged from 76.62% to 93.24%(CAP>CM>CPC>HM>TM). In conclusion, CAP is the optimum protein source of the five ingredients. However, CM, TM, and CPC require supplementation of deficient nutrients in their diets, and HM involves the addition of a defatting process to improve raw material nutrient levels. Additionally, comparative feeding experiments are required to determine the optimum amount of these five protein sources to be added to the large yellow croaker feed.
Finding inexpensive and high-quality protein sources to replace fish meal is currently a thorny issue for the feed industry due to the decline in fishery resources and the increased demand for fishmeal, which has led to a significant increase in fishmeal prices. In this study, we selected five new non-grain protein sources, Clostridium autoethanogenum protein (CAP), Chlorell meal (CM), Hermetia illucens meal (HM), Tenebrio molitor meal (TM), and cottonseed protein concentrate (CPC). This study was conducted to evaluate the apparent digestibility of dry matter, crude protein, crude lipid, gross energy, and amino acid of these five protein sources by large yellow croakers ( Larimichthys crocea) to provide a theoretical basis for the design of artificial compound feed formulations for large yellow croakers. Triplicate groups of fish [initial weight=(154.0±5.3)g] were fed the test diets to apparent satiation two times daily for eight weeks. The test diets consisted of 70% basal diet and 30% test ingredients, and 0.1% yttrium oxide (Y 2O 3) was used as an indicator. The results showed that dry matter coefficients of five test ingredients ranged from 56.77% to 75.53%(CAP>TM>CM>HM>CPC); The apparent digestibility of the crude protein ranged from 69.93% to 89.59%(CAP>CM>CPC>HM>TM); The apparent digestibility of crude lipid ranged from 58.58% to 93.77%(CAP>CM>TM>CPC>HM); The apparent digestibility of the gross energy ranged from 63.39% to 84.33%(CAP>HM>CM>TM>CPC); The apparent digestibility of the total amino acids ranged from 76.62% to 93.24%(CAP>CM>CPC>HM>TM). In conclusion, CAP is the optimum protein source of the five ingredients. However, CM, TM, and CPC require supplementation of deficient nutrients in their diets, and HM involves the addition of a defatting process to improve raw material nutrient levels. Additionally, comparative feeding experiments are required to determine the optimum amount of these five protein sources to be added to the large yellow croaker feed.
,
Available online
, doi: 10.7541/2022.2022.0361
Abstract:
In aquaculture, selenium has been shown to improve the immune and antioxidant capacity of aquatic animals. As a kind of new style protein resource, cottonseed protein concentrate plays a crucial role in aquaculture industry, however, the antinutritional factors (such as gossypol) seriously hindered the application of cottonseed protein concentrate in aquatic feed. Therefore, the purpose of this study was to investigate the effects of adding yeast selenium (YS) to the diet that containing cottonseed protein concentrate on the growth performance and muscle quality of grass carp (Ctenopharyngodon idella). Four isonitrogenous and isolipidic diets were designed: 0, 0.3, 0.6 and 0.9 mg/kg YS were added to the diet containing cottonseed protein concentrate, and corresponding named YS0, YS3, YS6 and YS9, respectively. A total of 240 healthy grass carp with similar size (initial weight: 309.74±0.36 g) were randomly distributed into 12 net cages in the pond. Each of the experimental diets was randomly fed triplicate cages for 56-day three times per day (9:00, 13:00 and 17:00). The results showed that: 1) In terms of growth performance, compared with YS0 group, there was no significant difference in growth performance between YS3 and YS6 groups (P>0.05), but the final body weight (FBW), weight gain rate (WGR) and specific growth rate (SGR) of YS9 group were significantly reduced (P<0.05); 2) In terms of muscle quality, compared with YS0 group, the crude protein content, selenium content, hydroxyproline content and hardness of grass carp muscle in YS3 group were significantly increased (P<0.05), and the fiber diameter and cohesiveness of muscle were significantly decreased (P<0.05). The study indicated that the addition of YS to the diet containing cottonseed protein concentrate (the selenium content of the diet was 0.6 mg/kg) had no significant effect on the growth performance of grass carp, and flesh quality were significantly improved. However, exceeded dietary YS had negative influence on the growth performance of grass carp. This study provides a theoretical basis for further application of cottonseed protein concentrate in aquatic feed.
In aquaculture, selenium has been shown to improve the immune and antioxidant capacity of aquatic animals. As a kind of new style protein resource, cottonseed protein concentrate plays a crucial role in aquaculture industry, however, the antinutritional factors (such as gossypol) seriously hindered the application of cottonseed protein concentrate in aquatic feed. Therefore, the purpose of this study was to investigate the effects of adding yeast selenium (YS) to the diet that containing cottonseed protein concentrate on the growth performance and muscle quality of grass carp (Ctenopharyngodon idella). Four isonitrogenous and isolipidic diets were designed: 0, 0.3, 0.6 and 0.9 mg/kg YS were added to the diet containing cottonseed protein concentrate, and corresponding named YS0, YS3, YS6 and YS9, respectively. A total of 240 healthy grass carp with similar size (initial weight: 309.74±0.36 g) were randomly distributed into 12 net cages in the pond. Each of the experimental diets was randomly fed triplicate cages for 56-day three times per day (9:00, 13:00 and 17:00). The results showed that: 1) In terms of growth performance, compared with YS0 group, there was no significant difference in growth performance between YS3 and YS6 groups (P>0.05), but the final body weight (FBW), weight gain rate (WGR) and specific growth rate (SGR) of YS9 group were significantly reduced (P<0.05); 2) In terms of muscle quality, compared with YS0 group, the crude protein content, selenium content, hydroxyproline content and hardness of grass carp muscle in YS3 group were significantly increased (P<0.05), and the fiber diameter and cohesiveness of muscle were significantly decreased (P<0.05). The study indicated that the addition of YS to the diet containing cottonseed protein concentrate (the selenium content of the diet was 0.6 mg/kg) had no significant effect on the growth performance of grass carp, and flesh quality were significantly improved. However, exceeded dietary YS had negative influence on the growth performance of grass carp. This study provides a theoretical basis for further application of cottonseed protein concentrate in aquatic feed.
,
Available online
, doi: 10.7541/2023.2022.0281
Abstract:
In recent years, the intensive breeding mode has developed rapidly, however, various problems emerge with intensive fish culture methods, especially crowding stress and increased susceptibility to disease, which will ultimately influence the growth performance, welfare, and profitability of the farmed fish. Intestinal microbes play an important role in maintaining the balance of intestinal environment and host health. We are genuinely concerned about the health of fish (via their intestinal flora) under high density culture. Therefore, the present study aimed to describe compositional and functional differences of the gut microbiome of genetically improved farmed tilapia (GIFT, Oreochromis niloticus) reared under Acanthopanax senticosus ultrafine powder, by investigating their responses to 8 weeks culture experiment. The results showed as follows: 1) adding 4‰ A. senticosus superfine powder to the diet could significantly increase the activities of intestinal amylase, lipase and trypsin, improve the growth and development of tilapia and improve the feed conversion rate. 2) adding 4‰ A. senticosus superfine powder to the diet could significantly reduce the levels of triglyceride and total cholesterol in the liver, and reduce the content of malondialdehyde and increase the activity of superoxide dismutase in the liver. 3) adding 4‰ A. senticosus superfine powder to the diet could significantly affect the composition of intestinal microorganisms and improve the alpha diversity of intestinal microorganisms. Some diversity indexes are significantly positively correlated with amylase, lipase and superoxide dismutase, and negatively correlated with triglyceride and total cholesterol. 4) Proteobacteria, Fusobacteria and Firmicutes were the dominant phyla in the intestinal tract of GIFT. The core difference genera screened were Enterovibrio, Cetobacterium and Grimontia, which were significantly enriched in the control group. In addition, Lawsonia, Acinetobacter, Pseudomonas and Brevinema were significantly enriched in 4‰ A. senticosus adding group, indicating that there may be a certain abundance of potential pathogenic bacteria in fish during the growth cycle. Functional prediction analysis with PICRUSt2 revealed that the bacterial community was active in metabolism at hierarchy level 1. The relative abundance of human diseases in the control group was significantly higher than that in 4‰ A. senticosus adding group. Further, the abundance of functional genes was similar at hierarchy level 2, implying abundant functional diversity. In conclusion, adding 4‰ A. senticosus superfine powder to the feed could affect intestinal enzyme activity, liver biochemical indices and intestinal microflora composition and function of GIFT, and promote the healthy growth of fish.
In recent years, the intensive breeding mode has developed rapidly, however, various problems emerge with intensive fish culture methods, especially crowding stress and increased susceptibility to disease, which will ultimately influence the growth performance, welfare, and profitability of the farmed fish. Intestinal microbes play an important role in maintaining the balance of intestinal environment and host health. We are genuinely concerned about the health of fish (via their intestinal flora) under high density culture. Therefore, the present study aimed to describe compositional and functional differences of the gut microbiome of genetically improved farmed tilapia (GIFT, Oreochromis niloticus) reared under Acanthopanax senticosus ultrafine powder, by investigating their responses to 8 weeks culture experiment. The results showed as follows: 1) adding 4‰ A. senticosus superfine powder to the diet could significantly increase the activities of intestinal amylase, lipase and trypsin, improve the growth and development of tilapia and improve the feed conversion rate. 2) adding 4‰ A. senticosus superfine powder to the diet could significantly reduce the levels of triglyceride and total cholesterol in the liver, and reduce the content of malondialdehyde and increase the activity of superoxide dismutase in the liver. 3) adding 4‰ A. senticosus superfine powder to the diet could significantly affect the composition of intestinal microorganisms and improve the alpha diversity of intestinal microorganisms. Some diversity indexes are significantly positively correlated with amylase, lipase and superoxide dismutase, and negatively correlated with triglyceride and total cholesterol. 4) Proteobacteria, Fusobacteria and Firmicutes were the dominant phyla in the intestinal tract of GIFT. The core difference genera screened were Enterovibrio, Cetobacterium and Grimontia, which were significantly enriched in the control group. In addition, Lawsonia, Acinetobacter, Pseudomonas and Brevinema were significantly enriched in 4‰ A. senticosus adding group, indicating that there may be a certain abundance of potential pathogenic bacteria in fish during the growth cycle. Functional prediction analysis with PICRUSt2 revealed that the bacterial community was active in metabolism at hierarchy level 1. The relative abundance of human diseases in the control group was significantly higher than that in 4‰ A. senticosus adding group. Further, the abundance of functional genes was similar at hierarchy level 2, implying abundant functional diversity. In conclusion, adding 4‰ A. senticosus superfine powder to the feed could affect intestinal enzyme activity, liver biochemical indices and intestinal microflora composition and function of GIFT, and promote the healthy growth of fish.
,
Available online
, doi: 10.7541/2023.2022.0493
Abstract:
In order to explore the effect of fermented soybean meal and soybean meal replacing part of fish meal on the growth performance, hematology, liver antioxidant activities and immune related gene mRNA expression of juvenile coho salmo (Oncorhynchus kisutch), four kinds of iso-nitrogen and iso-lipid and iso-energy feeds were set up in this experiment (crude protein is about 42% and crude lipid is about 15%). The control group was fed with 41% fish meal (FM; fish meal protein accounts for 27%); the experimental groups were replacement of partial fish meal by soybean meal in the FM diets (SM; soybean meal protein accounts for 10% and fish meal protein accounts for 17%), replacement of partial fish meal by soybean meal and fermented soybean meal in the FM diets (SM; soybean meal protein accounts for 5%, fermented soybean meal protein accounts for 5% and fish meal protein accounts for 17%) and replacement of partial fish meal by fermented soybean meal in the FM diets (FSM; fermented soybean meal protein accounts for 10% and fish meal protein accounts for 17%). Those feeds used to feed juvenile coho salmo with an initial weight of (102.25±0.24) g for 10-weeks and the results indicated that there were no significant differences in the weight gain rate (WGR), specific growth rate (SGR), daily growth rate (DGR) and condition factor (CF) between the FSM10 and FM diets (P>0.05), the WGR, SGR and DGR of the FSM5 diets were significantly lower than that of the FM control groups but significantly higher than that of the SM diets (P＜0.05) and there were no significant differences in hepatosomatic index (HSI), viscerosomatic index (VSI) and survival rate among groups (P>0.05). There was no significant difference in moisture, crude ash, crude protein among groups (P>0.05), but the crude fat of the SM diets was significantly lower than that of the FM control groups (P＜0.05). There were no significant differences in the glucose (GLU), total cholesterol (T-CHO), albumin (ALB) and total protein (TP) between the FSM10 and FM diets (P>0.05) and there were no significant differences in alkaline phosphatase (AKP), aspartate aminotransferase (GOT) and alanine aminotransferase (GPT) among groups (P>0.05), but the GLU, ALB, TP of the FSM5 diets were significantly lower than the FM control diets but higher than the SM diets. The activities of superoxide dismutase (SOD) and catalasehe (CAT) of the FSM10 diets were significantly higher than that of the FM control groups (P＜0.05) and there was no significant difference in glutathione (G-SH) between the FSM10 and FM diets (P>0.05). The malondialdehyde (MDA) of the FSM10 diets were significantly lower than that of the FM control groups (P＜0.05). The CAT and G-SH of FSM5 of diets wew higher than the SM diets but the MDA wew lower than it. The SOD of FSM5 were lower than FSM10 but have not significant differences with the FM control diets. The relative mRNA expression of gene sod-3, lyz, tlr-3 and c3α of the FSM10 diets were significantly higher than that of the FM control groups (P＜0.05), and there were no significant differences in the relative mRNA expression of gene tlr-7 between the FSM10 and FM diets (P>0.05). There were no significant differences in the relative mRNA expression of gene il-6 and hsp-70 among groups (P>0.05). The relative mRNA expression of gene lyz and tlr-3 of FSM5 diets were higher than SM diets. Overall, under the experimental conditions, using fermented soybean meal replace 10% fish meal protein had no significant differences on growth performance and hematology of juvenile coho salmo, but had positive effect on liver antioxidant capacity and immune related gene mRNA expression. Therefore, fermented soybean meal could be used instead of 10% fish meal protein in juvenile coho salmo diets.
In order to explore the effect of fermented soybean meal and soybean meal replacing part of fish meal on the growth performance, hematology, liver antioxidant activities and immune related gene mRNA expression of juvenile coho salmo (Oncorhynchus kisutch), four kinds of iso-nitrogen and iso-lipid and iso-energy feeds were set up in this experiment (crude protein is about 42% and crude lipid is about 15%). The control group was fed with 41% fish meal (FM; fish meal protein accounts for 27%); the experimental groups were replacement of partial fish meal by soybean meal in the FM diets (SM; soybean meal protein accounts for 10% and fish meal protein accounts for 17%), replacement of partial fish meal by soybean meal and fermented soybean meal in the FM diets (SM; soybean meal protein accounts for 5%, fermented soybean meal protein accounts for 5% and fish meal protein accounts for 17%) and replacement of partial fish meal by fermented soybean meal in the FM diets (FSM; fermented soybean meal protein accounts for 10% and fish meal protein accounts for 17%). Those feeds used to feed juvenile coho salmo with an initial weight of (102.25±0.24) g for 10-weeks and the results indicated that there were no significant differences in the weight gain rate (WGR), specific growth rate (SGR), daily growth rate (DGR) and condition factor (CF) between the FSM10 and FM diets (P>0.05), the WGR, SGR and DGR of the FSM5 diets were significantly lower than that of the FM control groups but significantly higher than that of the SM diets (P＜0.05) and there were no significant differences in hepatosomatic index (HSI), viscerosomatic index (VSI) and survival rate among groups (P>0.05). There was no significant difference in moisture, crude ash, crude protein among groups (P>0.05), but the crude fat of the SM diets was significantly lower than that of the FM control groups (P＜0.05). There were no significant differences in the glucose (GLU), total cholesterol (T-CHO), albumin (ALB) and total protein (TP) between the FSM10 and FM diets (P>0.05) and there were no significant differences in alkaline phosphatase (AKP), aspartate aminotransferase (GOT) and alanine aminotransferase (GPT) among groups (P>0.05), but the GLU, ALB, TP of the FSM5 diets were significantly lower than the FM control diets but higher than the SM diets. The activities of superoxide dismutase (SOD) and catalasehe (CAT) of the FSM10 diets were significantly higher than that of the FM control groups (P＜0.05) and there was no significant difference in glutathione (G-SH) between the FSM10 and FM diets (P>0.05). The malondialdehyde (MDA) of the FSM10 diets were significantly lower than that of the FM control groups (P＜0.05). The CAT and G-SH of FSM5 of diets wew higher than the SM diets but the MDA wew lower than it. The SOD of FSM5 were lower than FSM10 but have not significant differences with the FM control diets. The relative mRNA expression of gene sod-3, lyz, tlr-3 and c3α of the FSM10 diets were significantly higher than that of the FM control groups (P＜0.05), and there were no significant differences in the relative mRNA expression of gene tlr-7 between the FSM10 and FM diets (P>0.05). There were no significant differences in the relative mRNA expression of gene il-6 and hsp-70 among groups (P>0.05). The relative mRNA expression of gene lyz and tlr-3 of FSM5 diets were higher than SM diets. Overall, under the experimental conditions, using fermented soybean meal replace 10% fish meal protein had no significant differences on growth performance and hematology of juvenile coho salmo, but had positive effect on liver antioxidant capacity and immune related gene mRNA expression. Therefore, fermented soybean meal could be used instead of 10% fish meal protein in juvenile coho salmo diets.
,
Available online
, doi: 10.7541/2023.2022.0476
Abstract:
To investigate the effects of dietary replacement fishmeal protein with Hermetia illucens larvae meal (HM) on growth performance, digestive capacity, plasma biochemical indexes and related genes expression in Hefang crucian carp (Carassis auratus), five isonitrogenous (30%), isolipidic (6%) and isoenergetic (18.50 MJ/kg) diets were formulated to contain graded levels of fishmeal protein replacement by HM (0, 20%, 40%, 60% and 80% respectively) for a 74-day feeding trial. Each treatment was randomly assigned to triplicate groups of 25 fish [initial body weight of (31.50±0.50) g] per aquarium. Fish were fed twice daily to apparent satiation. Results showed that the weight gain rate (WGR) and specific growth rate (SGR) first increased and then decreased with the increased proportion of HM in diets, with a maximum in the 20% substitution group. Feed conversion ratio (FCR) showed an initial decrease followed by an increase, and the 20% substitution group was significantly less than 60% and 80% substitution groups (P<0.05). With the increased proportion of HM in diets, condition factor (CF) and viscerosomatic index (VSI) first increased and then decreased, with a maximum in the 40% substitution group. The hepatopancreas somatic index (HSI) of 80% substitution group was significantly higher than those in 0, 20% and 60% substitution groups (P<0.05), but there was no significant difference between 40% and 80% substitution group. The moisture and ash of fish body expressed no significant difference. However, crude protein of body in 20% and 60% substitution group was significantly lower than that in 0 group (P<0.05). Crude lipid of body showed an initial increase followed by a decrease, and the highest value was seen in 20% substitution group. There was no significant difference in plasma glucose concentration, total cholesterol concentration, alanine aminotransferase and aspartate aminotransferase activity, but blood ammonia content showed an upward trend, the blood ammonia of 80% substitution group was significantly higher than that of 0 substitution group. Total plasma amino acid in the 20% substitution group was significantly higher than those in the other treatments (P<0.05). Plasma malondialdehyde was significantly lower in 60% and 80% substitution groups than that in 20% substitution group (P<0.05). The expression of lat2, pept1 and cdx2 genes in the intestine reached to the highest level in 20% substitution group, while asct2 gene showed the highest expression in 40% substitution group. The expression of tor and igf1 genes in liver was the highest in 40% substitution group, while the highest expression of gh and ghr genes were seen in 60% substitution group. These results suggested that 0—40% of fish meal in the diet of HCC could be substituted by HM, and 20% was the optimal optimum proportion.
To investigate the effects of dietary replacement fishmeal protein with Hermetia illucens larvae meal (HM) on growth performance, digestive capacity, plasma biochemical indexes and related genes expression in Hefang crucian carp (Carassis auratus), five isonitrogenous (30%), isolipidic (6%) and isoenergetic (18.50 MJ/kg) diets were formulated to contain graded levels of fishmeal protein replacement by HM (0, 20%, 40%, 60% and 80% respectively) for a 74-day feeding trial. Each treatment was randomly assigned to triplicate groups of 25 fish [initial body weight of (31.50±0.50) g] per aquarium. Fish were fed twice daily to apparent satiation. Results showed that the weight gain rate (WGR) and specific growth rate (SGR) first increased and then decreased with the increased proportion of HM in diets, with a maximum in the 20% substitution group. Feed conversion ratio (FCR) showed an initial decrease followed by an increase, and the 20% substitution group was significantly less than 60% and 80% substitution groups (P<0.05). With the increased proportion of HM in diets, condition factor (CF) and viscerosomatic index (VSI) first increased and then decreased, with a maximum in the 40% substitution group. The hepatopancreas somatic index (HSI) of 80% substitution group was significantly higher than those in 0, 20% and 60% substitution groups (P<0.05), but there was no significant difference between 40% and 80% substitution group. The moisture and ash of fish body expressed no significant difference. However, crude protein of body in 20% and 60% substitution group was significantly lower than that in 0 group (P<0.05). Crude lipid of body showed an initial increase followed by a decrease, and the highest value was seen in 20% substitution group. There was no significant difference in plasma glucose concentration, total cholesterol concentration, alanine aminotransferase and aspartate aminotransferase activity, but blood ammonia content showed an upward trend, the blood ammonia of 80% substitution group was significantly higher than that of 0 substitution group. Total plasma amino acid in the 20% substitution group was significantly higher than those in the other treatments (P<0.05). Plasma malondialdehyde was significantly lower in 60% and 80% substitution groups than that in 20% substitution group (P<0.05). The expression of lat2, pept1 and cdx2 genes in the intestine reached to the highest level in 20% substitution group, while asct2 gene showed the highest expression in 40% substitution group. The expression of tor and igf1 genes in liver was the highest in 40% substitution group, while the highest expression of gh and ghr genes were seen in 60% substitution group. These results suggested that 0—40% of fish meal in the diet of HCC could be substituted by HM, and 20% was the optimal optimum proportion.
,
Available online
, doi: 10.7541/2023.2022.0414
Abstract:
In order to investigate the effects of soyas aponins on growth, immunity and intestinal health of hybrid yellow catfish (Pelteobagrus fulvidraco♀×Pelteobagrus vachelli♂), six isonitroid and isolipid diets supplemented with 0, 0.20%, 0.40%, 0.80%, 1.60% and 4.00% soy saponin with fish meal, shrimp meal and corn protein concentrate as protein sources were fed to hybrid yellow catfish with an initial weight of (1.0±0.17) g. They were divided into D0, D0.2, D0.4, D0.8, D1.6 and D4.0, with three replicates in each group and 30 fish in each replicate. After 60-day feeding experiment, the changes of growth index, body composition, serum immunity, antioxidant enzyme activity and intestinal inflammatory factor expression levels were measured. The results showed that the weight gain rate and specific growth rate of treated groups were significantly decreased (P<0.05), the content of body composition protein and muscle fat decreased first and then increased, while the content of body fat and muscle protein increased and then decreased. With the increase of saponins level, T-AOC in serum continuously decreased, AKP, NO, CAT activities increased at first and then decreased while ACP activities decreased at first and then increased. We found that the activities of ACP in liver of D0.8, D1.6 and D4.0 groups were significantly higher than other groups and the activities of CAT in liver of D0 and D4.0 groups were significantly lower than other groups (P<0.05). Besides, the activity of liver T-AOC increased first and then decreased, while the content of liver MDA decreased with the increase of saponin level. The content of liver MDA in the treated groups with saponin were significantly lower compared to D0 group. The activity of liver T-SOD showed a tendency to decrease first and then increase. With the increasing of the level of saponins, the mRNA levels of TGF-β and Il-10 in distal intestine were reduced, while that of Il-1β, IL-8, Il-15 and TNF-α were increased first and reduced later. To sum up, the soybean saponins added to the diet had obvious negative effects on the growth performance, immunity, anti-oxidation ability and intestinal health of the hybrid yellow catfish. When the soybean saponins level exceeded 0.40%, the hybrid yellow catfish showed severe oxidative stress, immune system disorder, liver injury, up-regulation of intestinal pro-inflammatory factors and down-regulation of anti-inflammatory factors. Therefore, it is necessary to limit the content of soybean saponins to 0.40% by replacing fish meal with soybean meal.
In order to investigate the effects of soyas aponins on growth, immunity and intestinal health of hybrid yellow catfish (Pelteobagrus fulvidraco♀×Pelteobagrus vachelli♂), six isonitroid and isolipid diets supplemented with 0, 0.20%, 0.40%, 0.80%, 1.60% and 4.00% soy saponin with fish meal, shrimp meal and corn protein concentrate as protein sources were fed to hybrid yellow catfish with an initial weight of (1.0±0.17) g. They were divided into D0, D0.2, D0.4, D0.8, D1.6 and D4.0, with three replicates in each group and 30 fish in each replicate. After 60-day feeding experiment, the changes of growth index, body composition, serum immunity, antioxidant enzyme activity and intestinal inflammatory factor expression levels were measured. The results showed that the weight gain rate and specific growth rate of treated groups were significantly decreased (P<0.05), the content of body composition protein and muscle fat decreased first and then increased, while the content of body fat and muscle protein increased and then decreased. With the increase of saponins level, T-AOC in serum continuously decreased, AKP, NO, CAT activities increased at first and then decreased while ACP activities decreased at first and then increased. We found that the activities of ACP in liver of D0.8, D1.6 and D4.0 groups were significantly higher than other groups and the activities of CAT in liver of D0 and D4.0 groups were significantly lower than other groups (P<0.05). Besides, the activity of liver T-AOC increased first and then decreased, while the content of liver MDA decreased with the increase of saponin level. The content of liver MDA in the treated groups with saponin were significantly lower compared to D0 group. The activity of liver T-SOD showed a tendency to decrease first and then increase. With the increasing of the level of saponins, the mRNA levels of TGF-β and Il-10 in distal intestine were reduced, while that of Il-1β, IL-8, Il-15 and TNF-α were increased first and reduced later. To sum up, the soybean saponins added to the diet had obvious negative effects on the growth performance, immunity, anti-oxidation ability and intestinal health of the hybrid yellow catfish. When the soybean saponins level exceeded 0.40%, the hybrid yellow catfish showed severe oxidative stress, immune system disorder, liver injury, up-regulation of intestinal pro-inflammatory factors and down-regulation of anti-inflammatory factors. Therefore, it is necessary to limit the content of soybean saponins to 0.40% by replacing fish meal with soybean meal.
,
Available online
, doi: 10.7541/2023.2021.0144
Abstract:
The rapid increase of nutrients and the decline of aquaculture water quality often occur in the process of aquaculture. It is necessary to carry out systematic research on the effect of severe human and biological disturbance on the water quality of aquaculture water by using greenhouse to breed Procambarus clarkii seedlings. To explore the water quality, this study measured the dynamic changes of water quality and nutrients in surface sediment of the high-density breeding of crayfish seedlings in Greenhouse in winter. The results showed that the DO and WT of the water body varied from 5.75 mg/L to 6.33 mg/L and 12.6℃—22.9℃, respectively, and the water temperature was 5—10℃ higher than the external water temperature in the same period. The contents of TN, TP and COD were 2.091 mg/L—2.688 mg/L, 0.196 mg/L—0.480 mg/L and 42.400 mg/L—53.200 mg/L in the overlying water, respectively, which were relatively higher due to feeding and shrimp activities. The contents of TN, TP and organic matter in surface sediment ranged from 1032 mg/kg to 1279 mg/kg, 623 mg/kg to 1004 mg/kg and 12.00 mg/kg to 14.28 mg/kg, with an increase of 24%, 23% and 41%, respectively. Due to the high turbidity of the water body and the unknown number of parent shrimp in the water body, it is impossible to determine whether all the feed was consumed by shrimp and the rapid increased nutrients in the aquaculture water due to the more feed. The high nutrient content brings new requirements for the treatment of the aquaculture tail water in the later stage.
The rapid increase of nutrients and the decline of aquaculture water quality often occur in the process of aquaculture. It is necessary to carry out systematic research on the effect of severe human and biological disturbance on the water quality of aquaculture water by using greenhouse to breed Procambarus clarkii seedlings. To explore the water quality, this study measured the dynamic changes of water quality and nutrients in surface sediment of the high-density breeding of crayfish seedlings in Greenhouse in winter. The results showed that the DO and WT of the water body varied from 5.75 mg/L to 6.33 mg/L and 12.6℃—22.9℃, respectively, and the water temperature was 5—10℃ higher than the external water temperature in the same period. The contents of TN, TP and COD were 2.091 mg/L—2.688 mg/L, 0.196 mg/L—0.480 mg/L and 42.400 mg/L—53.200 mg/L in the overlying water, respectively, which were relatively higher due to feeding and shrimp activities. The contents of TN, TP and organic matter in surface sediment ranged from 1032 mg/kg to 1279 mg/kg, 623 mg/kg to 1004 mg/kg and 12.00 mg/kg to 14.28 mg/kg, with an increase of 24%, 23% and 41%, respectively. Due to the high turbidity of the water body and the unknown number of parent shrimp in the water body, it is impossible to determine whether all the feed was consumed by shrimp and the rapid increased nutrients in the aquaculture water due to the more feed. The high nutrient content brings new requirements for the treatment of the aquaculture tail water in the later stage.
,
Available online
, doi: 10.7541/2023.2023.
Abstract:
In order to investigate the effect of different culture mode on the growth index and food composition of Odontobutis obscura, and to explore the relationship between O. obscura and bait organisms, the study compared the rice-fish culture and pond culture of O. obscura, and the results showed that there was no significant effect of culture mode on the survival rate of O. obscura, but the survival rate of O. obscura in rice-fish culture was slightly higher than that of O. obscura in pond culture. The body weight gain (BWG), relative weight gain rate (RWG) and wet weight specific growth rate (SGRW) of O. obscura in rice-fish culture were all higher than that of pond-cultured O. obscura. The feeding rate and gastric congestion of rice-fish cultured O. obscura were lower than those of pond-cultured O. obscura, but their growth indicators were better. In addition, except for Macrobrachium nipponense, there were more species and occurrence of bait organisms in the digestive tract of rice-fish cultured O. obscura than pond-cultured O. obscura in all three samples. In summary, compared with pond culture of O. obscura, the growth performance of rice-fish culture of O. obscura is better, and the rice-fish culture system can provide more abundant food resources for O. obscura and effectively reduce the cost of breeding. The body length of O.obscura was related to the body weight in a power function with the equation W=3.0×10–5 L2.9183 (R²=0.8788; n=146; P<0.05), which was allometric growth. The gape width of O. obscura was linearly related to its body length and the frontal sword length of M. nipponense, and the body length of M. nipponense was also linearly correlated with its frontal sword length and the body length of O. obscura.
In order to investigate the effect of different culture mode on the growth index and food composition of Odontobutis obscura, and to explore the relationship between O. obscura and bait organisms, the study compared the rice-fish culture and pond culture of O. obscura, and the results showed that there was no significant effect of culture mode on the survival rate of O. obscura, but the survival rate of O. obscura in rice-fish culture was slightly higher than that of O. obscura in pond culture. The body weight gain (BWG), relative weight gain rate (RWG) and wet weight specific growth rate (SGRW) of O. obscura in rice-fish culture were all higher than that of pond-cultured O. obscura. The feeding rate and gastric congestion of rice-fish cultured O. obscura were lower than those of pond-cultured O. obscura, but their growth indicators were better. In addition, except for Macrobrachium nipponense, there were more species and occurrence of bait organisms in the digestive tract of rice-fish cultured O. obscura than pond-cultured O. obscura in all three samples. In summary, compared with pond culture of O. obscura, the growth performance of rice-fish culture of O. obscura is better, and the rice-fish culture system can provide more abundant food resources for O. obscura and effectively reduce the cost of breeding. The body length of O.obscura was related to the body weight in a power function with the equation W=3.0×10–5 L2.9183 (R²=0.8788; n=146; P<0.05), which was allometric growth. The gape width of O. obscura was linearly related to its body length and the frontal sword length of M. nipponense, and the body length of M. nipponense was also linearly correlated with its frontal sword length and the body length of O. obscura.
,
Available online
, doi: 10.7541/2023.2023.0052
Abstract:
To understand the status and the spatial distribution pattern of fish multidimensional biodiversity, we conducted a survey on fish resources in Longyangxia Reservoir in June 2022. Three types of data, including the presence or absence of fish species, the number and biomass of individuals, were used to analyze the status and spatial distribution of species diversity, phylogenetic and functional diversity of fish in Longyangxia Reservoir. A total of 2416specimens weighing 94.24 kg belonging to 4 orders, 7 families, 17 genera, 19species were collected. Among these, 8species were native, while 11species were exotic. Compared to historical research, the native species in Longyangxia Reservoir decreased, while the number of exotic species increased significantly. There are differences in the distribution of species diversity, phylogenetic diversity, and functional diversity calculated based on the three data types. Specifically, the species richness was the highest in the head region of the reservoir, followed by the tail region and the middle region, while the number of individuals and biomass gradually decreased from the tail region to the head region. The phylogenetic diversity based on the three data types was the highest in the middle region. The functional diversity calculated based on the presence or absence of species and the number of individuals was the highest in the tail region, while the functional diversity calculated based on biomass data was the highest in the head region. The regression analysis showed that the phylogenetic diversity of fish in Longyangxia Reservoir was significantly affected by exotic species, while the changes in species diversity and functional diversity were not correlated with the distance from the dam and the number of exotic species.
To understand the status and the spatial distribution pattern of fish multidimensional biodiversity, we conducted a survey on fish resources in Longyangxia Reservoir in June 2022. Three types of data, including the presence or absence of fish species, the number and biomass of individuals, were used to analyze the status and spatial distribution of species diversity, phylogenetic and functional diversity of fish in Longyangxia Reservoir. A total of 2416specimens weighing 94.24 kg belonging to 4 orders, 7 families, 17 genera, 19species were collected. Among these, 8species were native, while 11species were exotic. Compared to historical research, the native species in Longyangxia Reservoir decreased, while the number of exotic species increased significantly. There are differences in the distribution of species diversity, phylogenetic diversity, and functional diversity calculated based on the three data types. Specifically, the species richness was the highest in the head region of the reservoir, followed by the tail region and the middle region, while the number of individuals and biomass gradually decreased from the tail region to the head region. The phylogenetic diversity based on the three data types was the highest in the middle region. The functional diversity calculated based on the presence or absence of species and the number of individuals was the highest in the tail region, while the functional diversity calculated based on biomass data was the highest in the head region. The regression analysis showed that the phylogenetic diversity of fish in Longyangxia Reservoir was significantly affected by exotic species, while the changes in species diversity and functional diversity were not correlated with the distance from the dam and the number of exotic species.
,
Available online
, doi: 10.7541/2023.2023.0076
Abstract:
Antibacterial peptides (AMPs) are the main effector molecules of the innate immune system of invertebrates, and their understanding can aid in discovering new drugs and preventing diseases. In the present study, two type I Crustin genes were cloned and identified from the mitten crab Eriocheir sinensis, and they were named as Escrus3 and Escrus4 following the nomenclature formed in this field. The cDNA sequence of EsCrus3 was 567 bp, with an Open Reading Frame (ORF) of 351 bp that encode 116 amino acids (aa). EsCrus4 sequence was 743 bp in length with an ORF of 288 bp that encode a putative protein of 95 aa. The domain structure of these two amino acid sequences was further predicted, and they were found to have a N-terminal signal peptide, a C-terminal WAP (Whey acid protein) domain, and a cysteine-rich region (CRR) between them. An evolutionary tree was constructed based on the BLASTP results and the reported Crustin sequences. The results showed that EsCrus3had the closest evolutionary relationship with Scylla tranquebarica StCrus (AFI56572), while EsCrus4 displayed the closest evolutionary relationship with Portunus trituberculus PtCrus2 (AFU61578). The two molecules were located at different branches with taxonomic significance, suggesting that they might have different biological functions. The tissue distribution showed that both EsCrus3 and EsCrus4 were highly expressed in the ovary with a similar expression level, while the expression level in other tissues was very low or even not detected. When challenged by Staphylococcus aureus or Aeromonas hydrophila, both EsCrus3 and EsCrus4 were up-regulated. EsCrus3 responded faster and significantly up-regulated at 2h after bacterial challenges, while EsCrus4 was significantly up-regulated at 12—24h after bacterial challenges, suggesting that these two genes may play an important role in the antibacterial immune system of the mitten crab. Recombinant proteins EsCrus3 and EsCrus4 were obtained by expression in E. coli system and purification by affinity column. The results of the microbe-binding assay showed that the recombinant proteins EsCrus3 and EsCrus4 exhibited different binding activities to gram-positive bacteria, gram-negative bacteria and fungi, and their binding activities to polysaccharides were significantly different as well. EsCrus3showed high binding activities to peptidoglycan (PGN) and lipoteichoic acid (LTA) of gram-positive bacteria, and low binding activities to lipopolysaccharide (LPS) of gram-negative bacteria and β-Glucan fungal; EsCrus4 only has a significant binding activity to PGN. The above research results show that EsCrus3 responds faster to bacterial challenges and has stronger binding abilities to polysaccharide components of pathogens, suggesting that it plays a more important role in the immune defense system of ovary. In addition, the differences in the expression and function of EsCrus3 and EsCrus4 also provide basic data for the mining of new drugs.
Antibacterial peptides (AMPs) are the main effector molecules of the innate immune system of invertebrates, and their understanding can aid in discovering new drugs and preventing diseases. In the present study, two type I Crustin genes were cloned and identified from the mitten crab Eriocheir sinensis, and they were named as Escrus3 and Escrus4 following the nomenclature formed in this field. The cDNA sequence of EsCrus3 was 567 bp, with an Open Reading Frame (ORF) of 351 bp that encode 116 amino acids (aa). EsCrus4 sequence was 743 bp in length with an ORF of 288 bp that encode a putative protein of 95 aa. The domain structure of these two amino acid sequences was further predicted, and they were found to have a N-terminal signal peptide, a C-terminal WAP (Whey acid protein) domain, and a cysteine-rich region (CRR) between them. An evolutionary tree was constructed based on the BLASTP results and the reported Crustin sequences. The results showed that EsCrus3had the closest evolutionary relationship with Scylla tranquebarica StCrus (AFI56572), while EsCrus4 displayed the closest evolutionary relationship with Portunus trituberculus PtCrus2 (AFU61578). The two molecules were located at different branches with taxonomic significance, suggesting that they might have different biological functions. The tissue distribution showed that both EsCrus3 and EsCrus4 were highly expressed in the ovary with a similar expression level, while the expression level in other tissues was very low or even not detected. When challenged by Staphylococcus aureus or Aeromonas hydrophila, both EsCrus3 and EsCrus4 were up-regulated. EsCrus3 responded faster and significantly up-regulated at 2h after bacterial challenges, while EsCrus4 was significantly up-regulated at 12—24h after bacterial challenges, suggesting that these two genes may play an important role in the antibacterial immune system of the mitten crab. Recombinant proteins EsCrus3 and EsCrus4 were obtained by expression in E. coli system and purification by affinity column. The results of the microbe-binding assay showed that the recombinant proteins EsCrus3 and EsCrus4 exhibited different binding activities to gram-positive bacteria, gram-negative bacteria and fungi, and their binding activities to polysaccharides were significantly different as well. EsCrus3showed high binding activities to peptidoglycan (PGN) and lipoteichoic acid (LTA) of gram-positive bacteria, and low binding activities to lipopolysaccharide (LPS) of gram-negative bacteria and β-Glucan fungal; EsCrus4 only has a significant binding activity to PGN. The above research results show that EsCrus3 responds faster to bacterial challenges and has stronger binding abilities to polysaccharide components of pathogens, suggesting that it plays a more important role in the immune defense system of ovary. In addition, the differences in the expression and function of EsCrus3 and EsCrus4 also provide basic data for the mining of new drugs.
,
Available online
, doi: 10.7541/2023.2023.0058
Abstract:
Although the pond captive model has several practical advantages, such as being ecologically friendly, resource conserving, and economic effective, research on the treatment mode of pond-cultivated tailwater is still relatively insufficient. In order to reduce the pollution load of captive tailwater and improve the environmental quality of cultured water, this study systematically investigated the characteristics of contaminant content in pond-cultivated tailwater during the middle period (August October) of pond circle cultivation. The study evaluated the treatment capacity of a solid-liquid separation tower and vertical flow constructed wetland unit for pond captive tailwater, and analyzed the effect of the solid-liquid separation tower vertical flow artificial wetland process to purify cultured tailwater bodies. The results showed that after settling for 1h using a solid-liquid separation tower, the average removal rates of TN and TP in pond-cultivated tailwater were 35.05% and 62.85%, respectively. After settling in a combined vertical flow constructed wetland and improving the intermittent aerated constructed wetland by adjusting the influent COD/N, the DO concentration was improved and the average concentrations of\begin{document}${\rm{NH}}^+_4 $\end{document} ![]()
![]()
\begin{document}${\rm{NO}}^-_2 $\end{document} ![]()
![]()
\begin{document}${\rm{PO}}^{3-}_4 $\end{document} ![]()
![]()
Although the pond captive model has several practical advantages, such as being ecologically friendly, resource conserving, and economic effective, research on the treatment mode of pond-cultivated tailwater is still relatively insufficient. In order to reduce the pollution load of captive tailwater and improve the environmental quality of cultured water, this study systematically investigated the characteristics of contaminant content in pond-cultivated tailwater during the middle period (August October) of pond circle cultivation. The study evaluated the treatment capacity of a solid-liquid separation tower and vertical flow constructed wetland unit for pond captive tailwater, and analyzed the effect of the solid-liquid separation tower vertical flow artificial wetland process to purify cultured tailwater bodies. The results showed that after settling for 1h using a solid-liquid separation tower, the average removal rates of TN and TP in pond-cultivated tailwater were 35.05% and 62.85%, respectively. After settling in a combined vertical flow constructed wetland and improving the intermittent aerated constructed wetland by adjusting the influent COD/N, the DO concentration was improved and the average concentrations of
,
Available online
, doi: 10.7541/2023.2023.0037
Abstract:
Feeding and locomotion are two important physiological activities that occur simultaneously in their life history. Their exercise behavior varies according to different meal size, which is the result of long-term evolution and adaptation to different living environments. In order to investigate the effects of meal size on locomotion ability and energy metabolic of amphibians, we selected the juvenile Andrias davidianus as experimental subjects. We measured the induction velocity, burst swimming speed and excess post-exercise oxygen consumption (EPOC) at different meal sizes (0, 1%, 4%, and 10% of body weight). The induction velocity (20.78, 21.52, 23.67, 21.79 cm/s and 2.4, 2.49, 2.77, 2.56 bl/s, respectively) and burst swimming speed (32.65, 32.92, 35.42, 33.02 cm/s and 3.80, 3.81, 4.15, 3.85 bl/s, respectively) of juvenile A. davidianus were not significantly different among different meal sizes. With increasing meal size, the pre-exercise metabolic rate [66.88, 82.51, 95.57, 106.32 mg O2/(kg·h), respectively] and the peak post-exercise metabolic rate [148.21, 155.08, 166.93, 167.63 mg O2/(kg·h), respectively] increased gradually and were significantly higher in the 4% and 10% meal size groups than those in the control group (P<0.05). The increment of metabolic rate [81.33, 72.57, 71.36, 61.31 mg O2/(kg·h), respectively], factorial scope (2.26, 1.89, 1.76, 1.58, respectively), duration (55.00min, 49.60min, 38.80min, 32.10min, respectively) and EPOC magnitude (27.48, 23.68, 21.42, 15.36 mg O2/kg, respectively) declined progressively, and these indexes in 4% and 10% meal size groups were lower than that in the control group (P<0.05). Our results suggested that the swimming performance of juvenile A. davidianus is not affected by feeding. These movement characteristics of this species should be fully considered in the practice of habitat protection and release in wild. The maintenance of swimming ability, the increase of aerobic metabolism and the shortening of recovery time after feeding may be beneficial for juvenile A. davidianus to hunt and escape from predators, resulting in better adaptation to the complex stream habitat and improved survival fitness.
Feeding and locomotion are two important physiological activities that occur simultaneously in their life history. Their exercise behavior varies according to different meal size, which is the result of long-term evolution and adaptation to different living environments. In order to investigate the effects of meal size on locomotion ability and energy metabolic of amphibians, we selected the juvenile Andrias davidianus as experimental subjects. We measured the induction velocity, burst swimming speed and excess post-exercise oxygen consumption (EPOC) at different meal sizes (0, 1%, 4%, and 10% of body weight). The induction velocity (20.78, 21.52, 23.67, 21.79 cm/s and 2.4, 2.49, 2.77, 2.56 bl/s, respectively) and burst swimming speed (32.65, 32.92, 35.42, 33.02 cm/s and 3.80, 3.81, 4.15, 3.85 bl/s, respectively) of juvenile A. davidianus were not significantly different among different meal sizes. With increasing meal size, the pre-exercise metabolic rate [66.88, 82.51, 95.57, 106.32 mg O2/(kg·h), respectively] and the peak post-exercise metabolic rate [148.21, 155.08, 166.93, 167.63 mg O2/(kg·h), respectively] increased gradually and were significantly higher in the 4% and 10% meal size groups than those in the control group (P<0.05). The increment of metabolic rate [81.33, 72.57, 71.36, 61.31 mg O2/(kg·h), respectively], factorial scope (2.26, 1.89, 1.76, 1.58, respectively), duration (55.00min, 49.60min, 38.80min, 32.10min, respectively) and EPOC magnitude (27.48, 23.68, 21.42, 15.36 mg O2/kg, respectively) declined progressively, and these indexes in 4% and 10% meal size groups were lower than that in the control group (P<0.05). Our results suggested that the swimming performance of juvenile A. davidianus is not affected by feeding. These movement characteristics of this species should be fully considered in the practice of habitat protection and release in wild. The maintenance of swimming ability, the increase of aerobic metabolism and the shortening of recovery time after feeding may be beneficial for juvenile A. davidianus to hunt and escape from predators, resulting in better adaptation to the complex stream habitat and improved survival fitness.
,
Available online
, doi: 10.7541/2023.2023.0020
Abstract:
In order to study the physiological dynamic change process of hungry mandarin fish under low water temperature, 270 mandarin fish with body weight of (84.13±0.14) g were selected and randomly divided into 6 groups with 3 replicates in each group and 15 fish in each replicate. The fish were starved for 0, 3d, 6d, 9d, 12d and 15d at low water temperature (13±1)℃. The relevant physiological and biochemical indexes were measured every three days. The results showed as follows: (1) With the extension of hunger time, the body weight, fullness, ratio of liver to body, ratio of viscera to body, protein and fat content of muscle of mandarin fish decreased gradually. The body weight decreased by a larger margin with with a reduction of 3.03%, 3.82%, 5.55%, 7.68% and 8.39% after 3d, 6d, 9d, 12d and 15d of starvation, respectively. (2) The activities of alanine aminotransferase and asoxal aminotransferase in the blood of mandarin fish decreased first and then increased with the extension of starvation time, reaching the minimum value on the third day. Blood glucose content increased significantly on the 6th day of starvation (P<0.05), and then remained in a certain range. Alkaline phosphatase activity, triglyceride, total cholesterol and high density lipoprotein cholesterol contents showed an overall decreasing trend. (3) The activities of pepsin, H+-K+-ATPase in stomach, trypsin and lipase in intestinal tract and pyloric blind cyst of mandarin fish showed an overall decreasing trend with the extension of starvation time, and all reached the minimum value on the 15th day of starvation, among which the decrease of H+-K+-ATPase activity in stomach was the most significant. The activity of amylase was stable in early starvation period and decreased in late starvation period. 4) The antioxidant capacity of the liver of mandarin fish first increased and then decreased with the extension of starvation time, and reached the lowest value on the 15th day. The results indicate that the short-term starvation of mandarin fish shows negative growth of body mass, slimming of body size and relatively smaller of liver under low water temperature. During the first 3d of starvation, muscle fat was preferentially used for energy, and muscle protein was preferentially used for energy in the later period. On the sixth day of starvation, the antioxidant capacity of the liver of the mandarin fish was improved, but the digestive and antioxidant function of the mandarin fish decreased significantly after prolonged starvation, and the feed inhibited the secretion of gastric acid, which may be related to the protection of gastric mucosa.
In order to study the physiological dynamic change process of hungry mandarin fish under low water temperature, 270 mandarin fish with body weight of (84.13±0.14) g were selected and randomly divided into 6 groups with 3 replicates in each group and 15 fish in each replicate. The fish were starved for 0, 3d, 6d, 9d, 12d and 15d at low water temperature (13±1)℃. The relevant physiological and biochemical indexes were measured every three days. The results showed as follows: (1) With the extension of hunger time, the body weight, fullness, ratio of liver to body, ratio of viscera to body, protein and fat content of muscle of mandarin fish decreased gradually. The body weight decreased by a larger margin with with a reduction of 3.03%, 3.82%, 5.55%, 7.68% and 8.39% after 3d, 6d, 9d, 12d and 15d of starvation, respectively. (2) The activities of alanine aminotransferase and asoxal aminotransferase in the blood of mandarin fish decreased first and then increased with the extension of starvation time, reaching the minimum value on the third day. Blood glucose content increased significantly on the 6th day of starvation (P<0.05), and then remained in a certain range. Alkaline phosphatase activity, triglyceride, total cholesterol and high density lipoprotein cholesterol contents showed an overall decreasing trend. (3) The activities of pepsin, H+-K+-ATPase in stomach, trypsin and lipase in intestinal tract and pyloric blind cyst of mandarin fish showed an overall decreasing trend with the extension of starvation time, and all reached the minimum value on the 15th day of starvation, among which the decrease of H+-K+-ATPase activity in stomach was the most significant. The activity of amylase was stable in early starvation period and decreased in late starvation period. 4) The antioxidant capacity of the liver of mandarin fish first increased and then decreased with the extension of starvation time, and reached the lowest value on the 15th day. The results indicate that the short-term starvation of mandarin fish shows negative growth of body mass, slimming of body size and relatively smaller of liver under low water temperature. During the first 3d of starvation, muscle fat was preferentially used for energy, and muscle protein was preferentially used for energy in the later period. On the sixth day of starvation, the antioxidant capacity of the liver of the mandarin fish was improved, but the digestive and antioxidant function of the mandarin fish decreased significantly after prolonged starvation, and the feed inhibited the secretion of gastric acid, which may be related to the protection of gastric mucosa.
,
Available online
, doi: 10.7541/2023.2023.0031
Abstract:
In order to investigate the effect of continuous exercise training on the swimming performance and respiration metabolism of Takifugu obscurus during proliferation and release activities, the critical swimming speed (Ucrit), burst swimming speed (Ubrust), resting metabolic rate (RMR) and active metabolic rate (AMR) of T. obscurus were measured after exercise training at different intensities (0.75 and 1.5 BL/s) and durations (1, 2 and 4 weeks). The results showed that after 1 week of continuous training at low intensity (0.75 BL/s), Ubrust, RMR and AMR had no significant changes, while Ucrit was significantly increased. Following 2 weeks of continuous training, Ucrit, Ubrust, RMR and AMR remained reletively stable. After 4 weeks of continuous training, Ubrust and RMR showed no significant change, but Ucrit was significantly decreased (P<0.05) and AMR was significantly increased (P<0.05). After 2 weeks of high intensity (1.5 BL/s) training, there were no significant changes in Ucrit, Ubrust, RMR and AMR of T. obscurus. After 4 weeks of continuous training, Ucrit, Ubrust and RMR did not change significantly, while AMR decreased significantly (P<0.05). The results showed that short periods of low-intensity training (0.75 BL/s training for 1 to 2 weeks) improved the critical swimming capacity of T. obscurus, while continuous low-intensity training (0.75 BL/s training for 2—4 weeks) increased the active metabolic rate of T. obscurus. Therefore, proper exercise training may play a certain role in improving the swimming capacity of T. obscurus after releasing, which is helpful to improve the survival rate and releasing effect.
In order to investigate the effect of continuous exercise training on the swimming performance and respiration metabolism of Takifugu obscurus during proliferation and release activities, the critical swimming speed (Ucrit), burst swimming speed (Ubrust), resting metabolic rate (RMR) and active metabolic rate (AMR) of T. obscurus were measured after exercise training at different intensities (0.75 and 1.5 BL/s) and durations (1, 2 and 4 weeks). The results showed that after 1 week of continuous training at low intensity (0.75 BL/s), Ubrust, RMR and AMR had no significant changes, while Ucrit was significantly increased. Following 2 weeks of continuous training, Ucrit, Ubrust, RMR and AMR remained reletively stable. After 4 weeks of continuous training, Ubrust and RMR showed no significant change, but Ucrit was significantly decreased (P<0.05) and AMR was significantly increased (P<0.05). After 2 weeks of high intensity (1.5 BL/s) training, there were no significant changes in Ucrit, Ubrust, RMR and AMR of T. obscurus. After 4 weeks of continuous training, Ucrit, Ubrust and RMR did not change significantly, while AMR decreased significantly (P<0.05). The results showed that short periods of low-intensity training (0.75 BL/s training for 1 to 2 weeks) improved the critical swimming capacity of T. obscurus, while continuous low-intensity training (0.75 BL/s training for 2—4 weeks) increased the active metabolic rate of T. obscurus. Therefore, proper exercise training may play a certain role in improving the swimming capacity of T. obscurus after releasing, which is helpful to improve the survival rate and releasing effect.
,
Available online
, doi: 10.7541/2023.2023.0028
Abstract:
To investigate the trophic structure of fish communities and utilization of fish food resources in valley-type reservoirs, the characteristics of fish community structure in the Weishui Reservoir (Hubei Province) were studied in summer and autumn 2020 based on stable carbon (δ13C) and nitrogen (δ15N) techniques. Moreover, the contributions of four potential carbon sources (particulate organic matter, terrestrial plants, epilithic algae, and organic detritus) to fish with different feeding habits were evaluated by a Bayesian stable isotope mixing model. The results showed that there were seasonal differences in the trophic structure of fish communities in the Weishui Reservoir. The Layman’s community-wide metrics showed that the δ15N range (NR), δ13C range (CR), total area (TA), mean nearest neighbor distance (MNND), standard deviation of nearest neighbor distance (SDNND) and standard ellipse area (SEA) of fish communities in summer were greater than those in autumn, suggesting a higher diversity of food sources, lower degree of trophic redundancy, and more complex and stable food web structure in summer. Fish relied on allochthonous carbon in summer and autumn, but significant differences between those in two seasons (P<0.05) were found. Overall, terrestrial plants made the greatest contribution to the carbon sources of fish in the Weishui Reservoir, however, epilithic algae and organic detritus were the secondary important carbon sources in summer and autumn, respectively. Particulate organic matter was unimportant for fish at two seasons. In summer and autumn, detritivorous fish Xenocypris davidi exhibited the highest reliance on allochthonous carbon, whereas filter-feeding fish (bighead carp) and herbivorous fish (blunt snout bream) showed the lowest reliance on allochthonous carbon. Trophic positions of fish ranged between 2.5-3.5 (averaged 3.01) in summer, whereas between 2.9-3.8 (averaged 3.32) in autumn. For the nine common species at two seasons, piscivorous fish (Siniperca chuatsi and Erythroculter mongolicus), omnivorous fish (Cyprinus carpio and Carassius auratus) and detritivorous fish (Xenocypris davidi) showed great variations in TPs. Based on the analysis of stable carbon and nitrogen isotopes for fish with different feeding habits, we found that TPs of fish in autumn were significantly higher than those in summer (P<0.05). Our study revealed a significant difference between the utilization of carbon sources by fish between summer and autumn, with TPs of fish in autumn was generally higher than that in summer. This is primarily ascribed to the low water levels of the Weishui Reservoir in autumn because low water-levels do not allow the entry of terrestrial plants into aquatic food webs, thereby resulting in intensified competition of fish for food resources and predating. Analysis of the Bayesian stable isotope mixing models suggests that of herbivorous and omnivorous fries such as grass carp and blunt snout bream are recommended to release to the reservoir in early spring (February-March), while detritivorous fries are recommended for release in autumn and winter.
,
Available online
, doi: 10.7541/2023.2023.0077
Abstract:
In recent years, Bacillus used in aquaculture has attracted much attention as a microbial candidate to maintain the health and well-being of aquatic animals. Bacillus licheniformis FA6 is a probiotic isolated from the intestines of grass carp (Ctenopharyngodon idella), and has been shown improve growth performance, promote immune response and help the host digest through its enzyme activity. However, the fermentation process of B. licheniformis FA6 is unclear, which has limited its large-scale application in aquaculture. In this study, both traditional one-factor-at-a-time method and response surface methodology were used to optimize the fermentation medium and conditions based on the viable count of B. licheniformis FA6. We found that the optimal fermentation medium of B. licheniformis FA6 contained 70 g/L soluble starch, 40 g/L casein peptone, 2 g/L K2HPO4, 1 g/L KH2PO4, 2 g/L Na2HPO4, 2 g/L MgSO4 and 8 g/L NaCl. The optimal fermentation conditions were an initial pH of 7.0, inoculation quantity of 1%, fermentation temperature of 28.8℃, fermentation time of 31h, liquid volume of 50mL/250mL and rotational speed of 160 r/min. Under these optimized conditions, the viable count of Bacillus licheniformis FA6 reached 7.97×109 CFU/mL, which was 8.1 times higher than before optimization. The acquisition of the optimal fermentation process of B. licheniformis FA6 provides a reference for the high-density production and industrial application of fish-derived Bacillus.
In recent years, Bacillus used in aquaculture has attracted much attention as a microbial candidate to maintain the health and well-being of aquatic animals. Bacillus licheniformis FA6 is a probiotic isolated from the intestines of grass carp (Ctenopharyngodon idella), and has been shown improve growth performance, promote immune response and help the host digest through its enzyme activity. However, the fermentation process of B. licheniformis FA6 is unclear, which has limited its large-scale application in aquaculture. In this study, both traditional one-factor-at-a-time method and response surface methodology were used to optimize the fermentation medium and conditions based on the viable count of B. licheniformis FA6. We found that the optimal fermentation medium of B. licheniformis FA6 contained 70 g/L soluble starch, 40 g/L casein peptone, 2 g/L K2HPO4, 1 g/L KH2PO4, 2 g/L Na2HPO4, 2 g/L MgSO4 and 8 g/L NaCl. The optimal fermentation conditions were an initial pH of 7.0, inoculation quantity of 1%, fermentation temperature of 28.8℃, fermentation time of 31h, liquid volume of 50mL/250mL and rotational speed of 160 r/min. Under these optimized conditions, the viable count of Bacillus licheniformis FA6 reached 7.97×109 CFU/mL, which was 8.1 times higher than before optimization. The acquisition of the optimal fermentation process of B. licheniformis FA6 provides a reference for the high-density production and industrial application of fish-derived Bacillus.
,
Available online
, doi: 10.7541/2023.2023.0053
Abstract:
In order to investigate microplastic pollution in fish of five artificial backbone rivers of Huangpu River in Shanghai, the digestive tracts and gills of Coilia nasus, Hemiculter leucisculus, Carassius auratus, Pseudobrama simoni and Pelteobagrus nitidus were investigated. In addition, the distribution of microplastics in digestive tract walls and digestive tract contents of digestive tracts in 50samples were further assessed at the same time. The results showed that 537 microplastics were detected in 200 fish samples of 5species. The average detection rate was 83.00% and the average abundance was (2.69±2.74) items/individual. The distribution of microplastics in fish differed significantly in the five rivers. The detection rate of microplastics in digestive tract (70.50%) was significantly than that in gill (49.00%; P<0.01), and the abundance of microplastics in digestive tract (1.84±2.31 items/individual) was significantly higher than that in gill (0.85±1.20 items/individual) (P<0.05). Furthermore, 78 and 40 microplastics were detected in digestive tract walls and contents of 50samples, respectively. The detection rate was 70.0% and the abundance was 1.56±1.63 items/individual in digestive tract walls, which had significantly higher than that of digestive tract contents (42.0% and 0.80±1.14 items/individual) (P<0.05). Among the detected microplastics, fiber (53.07%) and fragment (33.15%), black (41.90%) and red (25.33%), and the size≤1mm (83.80%) accounted for a higher proportion. Gill microplastic had a higher proportion (59.76%) of fiber, while the digestive tract had a higher proportion (43.48%) of black, and the adhesion on digestive tract wall was mainly fragment (43.59%) and black (43.59%). Twelve chemical components were detected, with Cellophane (CP,40.96%), polyethylene terephthalate (PET, 20.48%) and ethylene-vinyl acetate copolymer (EVA,12.05%) being the main polymer types. The research showed that the detection rate and abundance of microplastics in Huangpu River artificial backbone rivers in Shanghai were slightly higher than those in its natural waters. The types of dominant microplastics were significantly different, and the waste of household articles and agricultural film may be the important source of microplastic pollution.
In order to investigate microplastic pollution in fish of five artificial backbone rivers of Huangpu River in Shanghai, the digestive tracts and gills of Coilia nasus, Hemiculter leucisculus, Carassius auratus, Pseudobrama simoni and Pelteobagrus nitidus were investigated. In addition, the distribution of microplastics in digestive tract walls and digestive tract contents of digestive tracts in 50samples were further assessed at the same time. The results showed that 537 microplastics were detected in 200 fish samples of 5species. The average detection rate was 83.00% and the average abundance was (2.69±2.74) items/individual. The distribution of microplastics in fish differed significantly in the five rivers. The detection rate of microplastics in digestive tract (70.50%) was significantly than that in gill (49.00%; P<0.01), and the abundance of microplastics in digestive tract (1.84±2.31 items/individual) was significantly higher than that in gill (0.85±1.20 items/individual) (P<0.05). Furthermore, 78 and 40 microplastics were detected in digestive tract walls and contents of 50samples, respectively. The detection rate was 70.0% and the abundance was 1.56±1.63 items/individual in digestive tract walls, which had significantly higher than that of digestive tract contents (42.0% and 0.80±1.14 items/individual) (P<0.05). Among the detected microplastics, fiber (53.07%) and fragment (33.15%), black (41.90%) and red (25.33%), and the size≤1mm (83.80%) accounted for a higher proportion. Gill microplastic had a higher proportion (59.76%) of fiber, while the digestive tract had a higher proportion (43.48%) of black, and the adhesion on digestive tract wall was mainly fragment (43.59%) and black (43.59%). Twelve chemical components were detected, with Cellophane (CP,40.96%), polyethylene terephthalate (PET, 20.48%) and ethylene-vinyl acetate copolymer (EVA,12.05%) being the main polymer types. The research showed that the detection rate and abundance of microplastics in Huangpu River artificial backbone rivers in Shanghai were slightly higher than those in its natural waters. The types of dominant microplastics were significantly different, and the waste of household articles and agricultural film may be the important source of microplastic pollution.
,
Available online
, doi: 10.7541/2023.2023.0033
Abstract:
Abstact: The regulatory role of Amh in early sex determination and gonadal differentiation has been studied in some GSD (genetic sex determination) animals, such as fish, however, the biological function of this gene in species with temperature-dependent sex determination (TSD) has not been reported. In this study, the red-eared slider turtle Trachemys scripta (T. scripta) was used as an animal model of TSD to analyze the expression characteristics and cellular localization of Amh in embryonic gonads. Then, the specific function of Amh in TSD was identified by means of gene loss- and gain-of-function studies (LV-Amh-shRNA and LV-Amh-OE vector systems) . The expression analysis showed that Amh was highly expressed in MPT (male-producing temperature) gonads of stage 15, prior to the onset of gonadal differentiation. AMH protein was mainly localized in the precursor sertoli cells of MPT gonads, however, the FPT (female- producing temperature) gonads exhibited extremely low expression levels of Amh mRNA and protein throughout the embryogenesis. RNA interference experiments showed complete male-to-female sex reversal in MPT gonads with Amh knockdown, characterized by obvious feminization of gonads, female-styled germ cell distribution, significant downregulation of testicular marker Sox9, and remarkable upregulation of ovarian markers Foxl2 and Cyp19a1. Conversely, ectopic expression of Amh led to largely masculinized FPT gonads, a decline in Foxl2 and Cyp19a1, and production of Sox9. The statistical results showed that the sex reversal rates induced by LV-Amh-shRNA and LV-Amh-OE were 92.86%(26/28) and 66.67%(26/39), respectively. These data strongly provided for the first evidence that Amh is both necessary and sufficient to initiate early testicular differentiation in T. scripta, and it is located upstream of the male molecular pathway of TSD, laying the foundation for the analysis of the TSD molecular mechanism.
Abstact: The regulatory role of Amh in early sex determination and gonadal differentiation has been studied in some GSD (genetic sex determination) animals, such as fish, however, the biological function of this gene in species with temperature-dependent sex determination (TSD) has not been reported. In this study, the red-eared slider turtle Trachemys scripta (T. scripta) was used as an animal model of TSD to analyze the expression characteristics and cellular localization of Amh in embryonic gonads. Then, the specific function of Amh in TSD was identified by means of gene loss- and gain-of-function studies (LV-Amh-shRNA and LV-Amh-OE vector systems) . The expression analysis showed that Amh was highly expressed in MPT (male-producing temperature) gonads of stage 15, prior to the onset of gonadal differentiation. AMH protein was mainly localized in the precursor sertoli cells of MPT gonads, however, the FPT (female- producing temperature) gonads exhibited extremely low expression levels of Amh mRNA and protein throughout the embryogenesis. RNA interference experiments showed complete male-to-female sex reversal in MPT gonads with Amh knockdown, characterized by obvious feminization of gonads, female-styled germ cell distribution, significant downregulation of testicular marker Sox9, and remarkable upregulation of ovarian markers Foxl2 and Cyp19a1. Conversely, ectopic expression of Amh led to largely masculinized FPT gonads, a decline in Foxl2 and Cyp19a1, and production of Sox9. The statistical results showed that the sex reversal rates induced by LV-Amh-shRNA and LV-Amh-OE were 92.86%(26/28) and 66.67%(26/39), respectively. These data strongly provided for the first evidence that Amh is both necessary and sufficient to initiate early testicular differentiation in T. scripta, and it is located upstream of the male molecular pathway of TSD, laying the foundation for the analysis of the TSD molecular mechanism.
,
Available online
, doi: 10.7541/2023.2023.0073
Abstract:
In reptiles, primordial germ cells proliferate massively in the female cortex and entry the “mitotic arrest” in the male medulla when they reach the genital ridge. Somatic cells facilitate germ cells development and differentiation. However, it is not clear how germ cells affect somatic cells and whether germ cells depletion could influence the sex differentiation. To investigate whether germ cells have impacts on somatic cells and gonadal sex differentiation we depleted the endogenous germ cells in ZZ and ZW genetic Pelodicus sinensis by injecting of 20 mg/kg busulfan into the embryos in this study. Immunofluorescence of VASA showed that the germ cells are depleted after treatment of busulfan in both ZZ and ZW gonads. H&E staining analysis showed that the morphology of cortex and medullary cords had no difference with or without busulfan treatment in ZZ and ZW turtles. The busulfan treated ZW gonads expressed the ovary-specific marker FOXL2 and CYP19A1 , while the busulfan treated ZZ gonads showed immunofluorescence staining of testicular marker protein DMRT1 and SOX9. The real-time PCR analysis showed that the busulfan-treated ZW gonads still expressed high levels of Cyp19a1 and Foxl2 and low levels of Dmrt1 and Sox9, while the busulfan-treated ZZ gonads expressed high levels of Dmrt1 and Sox9 and relative low levels of Cyp19a1 and Foxl2. These results suggest that the gonads sex do not change after the depletion of germ cells in both ZW and ZZ genetic turtles. In conclusion, our study first proved that the germ cells depletion do not alter the sex differentiation in GSD reptiles, which can provide reference significance for breeding of Pelodicus sinensis.
In reptiles, primordial germ cells proliferate massively in the female cortex and entry the “mitotic arrest” in the male medulla when they reach the genital ridge. Somatic cells facilitate germ cells development and differentiation. However, it is not clear how germ cells affect somatic cells and whether germ cells depletion could influence the sex differentiation. To investigate whether germ cells have impacts on somatic cells and gonadal sex differentiation we depleted the endogenous germ cells in ZZ and ZW genetic Pelodicus sinensis by injecting of 20 mg/kg busulfan into the embryos in this study. Immunofluorescence of VASA showed that the germ cells are depleted after treatment of busulfan in both ZZ and ZW gonads. H&E staining analysis showed that the morphology of cortex and medullary cords had no difference with or without busulfan treatment in ZZ and ZW turtles. The busulfan treated ZW gonads expressed the ovary-specific marker FOXL2 and CYP19A1 , while the busulfan treated ZZ gonads showed immunofluorescence staining of testicular marker protein DMRT1 and SOX9. The real-time PCR analysis showed that the busulfan-treated ZW gonads still expressed high levels of Cyp19a1 and Foxl2 and low levels of Dmrt1 and Sox9, while the busulfan-treated ZZ gonads expressed high levels of Dmrt1 and Sox9 and relative low levels of Cyp19a1 and Foxl2. These results suggest that the gonads sex do not change after the depletion of germ cells in both ZW and ZZ genetic turtles. In conclusion, our study first proved that the germ cells depletion do not alter the sex differentiation in GSD reptiles, which can provide reference significance for breeding of Pelodicus sinensis.
,
Available online
, doi: 10.7541/2023.2023.0064
Abstract:
The ex situ conservation of the first-class protected animal in China, Yangtze finless porpoise (YFP), have gained preliminary success. As the last step in ex situ conservation, reintroduction is an inevitable requirement for achieving the goal. Under this circumstance, two male YFPs from the ex-situ group in Tian-e-zhou oxbow were translocated to Laowan branch in April 2021 for the very first acclimation training attempt to study the adaptive process of their behavior and vocalization, and to figure out whether they can adapt to the harsh environment in terms of feeding behavior and diel activities. The attempt is expected to accumulate experience for the large-scale reintroduction adaptation training of the porpoise into Yangtze River in the future. After one year of training and continuous monitoring, the results showed that the density of fish in Laowan branch is significantly lower compared to that of Tianezhou Oxbow. The shoal of fish is unevenly distributed during the wet season, and the density being higher in upstream than that in the middle and downstream. The average time expense of YFP in the upstream is significantly higher than that in the middle and downstream. Spearman correlation analysis shows that there is a significant correlation with the density distribution of fish. During the first two months of entering the branch, the time required for YFP to cruise downstream gradually increased to a peak, then decreased and stabilized. In the training of ship noise adaptability, the average breathing interval of porpoises decreased significantly in the presence of ship interference, and gradually recovered to the level of non-interference with the increase of interference times. Our study indicates that the two porpoises have kind adaptability to the high flow velocity, low fish resource density and artificial vessel noise interference in the branch and are feasible to release into the Yangtze River. This is the first time that the adaptation training of YFP in a completely natural environment has been implemented, which will provide technical support for large-scale release and promote the recovery of YFPs' natural population.
,
Available online
, doi: 10.7541/2023.2022.0474
Abstract:
In order to investigate the trophic structure characteristics and spatiotemporal variations of aquatic communities in the Hun-Tai River, an important branch of the Liaohe River, the fishery resources surveys were conducted in autumn (October) 2020 and spring (May) 2021. Based on stable isotope analysis, the δ13C and δ15N values of dominant consumers and basal food sources in the river were determined. Then the spatiotemporal variations of trophic structures and the contributions of the basal carbon sources to the aquatic food web were analyzed by SIBER and MixSIAR package. In our study, a total of 23species of catches, belonging to 3 orders, 6 families, and 20 genera were collected. All the δ13C and δ15N values of the main catches ranged widely from –37.18‰ to –19.28‰, 7.98‰ to 16.51‰, respectively. There were no significant seasonal differences in δ13C and δ15N values (P>0.05). However, the δ13C values variations of spatiality were significant (P<0.01), and the carnivorous δ15N values were higher than omnivorous (P<0.05). The trophic level of catches, ranging from 1.71 to 4.39 in the Hun-Tai River, had extremely significant temporal and spatial differences (P<0.01). The comparison of the ecosystem trophic structure revealed that the food resources and ecological niche occupied by fish in autumn were higher and broader than that in spring, and all trophic structure indicators (NR/CR/TA/CD/NND/SDNND) of the Taizi River higher than those of the Hun River might be brought out by the higher degree of exploitation in the Hun River. In addition, the basal food sources analysis results supposed that aquatic plants and terrestrial plants were major carbon sources in autumn and spring, respectively. Meanwhile the terrestrial plants and POM were major carbon sources in the Hun River and Taizi River, respectively. This study of enriching the contents about food web in the Hun-Tai River provided references for the subsequent protection, restoration and further development, and accumulated basic data for the reconstruction of the river ecosystem in Northeast China.
In order to investigate the trophic structure characteristics and spatiotemporal variations of aquatic communities in the Hun-Tai River, an important branch of the Liaohe River, the fishery resources surveys were conducted in autumn (October) 2020 and spring (May) 2021. Based on stable isotope analysis, the δ13C and δ15N values of dominant consumers and basal food sources in the river were determined. Then the spatiotemporal variations of trophic structures and the contributions of the basal carbon sources to the aquatic food web were analyzed by SIBER and MixSIAR package. In our study, a total of 23species of catches, belonging to 3 orders, 6 families, and 20 genera were collected. All the δ13C and δ15N values of the main catches ranged widely from –37.18‰ to –19.28‰, 7.98‰ to 16.51‰, respectively. There were no significant seasonal differences in δ13C and δ15N values (P>0.05). However, the δ13C values variations of spatiality were significant (P<0.01), and the carnivorous δ15N values were higher than omnivorous (P<0.05). The trophic level of catches, ranging from 1.71 to 4.39 in the Hun-Tai River, had extremely significant temporal and spatial differences (P<0.01). The comparison of the ecosystem trophic structure revealed that the food resources and ecological niche occupied by fish in autumn were higher and broader than that in spring, and all trophic structure indicators (NR/CR/TA/CD/NND/SDNND) of the Taizi River higher than those of the Hun River might be brought out by the higher degree of exploitation in the Hun River. In addition, the basal food sources analysis results supposed that aquatic plants and terrestrial plants were major carbon sources in autumn and spring, respectively. Meanwhile the terrestrial plants and POM were major carbon sources in the Hun River and Taizi River, respectively. This study of enriching the contents about food web in the Hun-Tai River provided references for the subsequent protection, restoration and further development, and accumulated basic data for the reconstruction of the river ecosystem in Northeast China.
,
Available online
, doi: 10.7541/2023.2023.0030
Abstract:
The industrial development of yellow catfish (Tachysurus fulvidraco) is limited by the shortage of female broodstocks. The aquaculture yield of female yellow catfish is significantly reduced due to the successful promotion of all-male and hybrid new varieties. Meanwhile, wild germplasm resources are not possible to be used as broodstock because of the vigorous implementation of resource conservation policy. It is urgently needed to establish a large-scale producing system of the all-female population, and the key is to efficiently induce fertile XX pseudo-males. In this study, different percentages of masculinization 4.0%, 25.0%, and 62.5% was induced by different doses of levonorgestrel (LNG) immersion treatments, 1, 0.1, and 0.01 μg/L, respectively, starting from 12 days post-hatching (DPH) to 60 DPH. Complete-testis-type XX pseudo-males were induced in the 1 and 0.1 μg/L groups, while complete-testis-type (20.8%) and partial-testis-type pseudo-males (41.7%) were both found in the 0.01 μg/L group. A quantity of sperm and intercommunicating seminiferous tubules were observed in XX males at 122 DPH individuals, indicating that induced XX pseudo-male fish have the normal reproductive ability. Reduced oocyte numbers at 62 DPH and gonadosomatic index at 122 DPH of un-masculinized XX individuals after LNG immersion indicate negative effects of LNG on ovarian development. Growth and mortality were not significantly affected by LNG treatments. Our results suggested that LNG-induced masculinization in yellow catfish had the advantages of low treatment dosage, high efficiency on masculinization, and promoting the testis development of the XX pseudo-males. The present work provides new ideas for the optimization of inducing functional XX pseudo-males, and establishes an important foundation for sustainable aquaculture development and high-efficient breeding of yellow catfish. The establishment of the all-female production system will strongly increase the efficiency of genetic breeding in yellow catfish. The roles of progesterone in fish sex differentiation deserve further investigation.
The industrial development of yellow catfish (Tachysurus fulvidraco) is limited by the shortage of female broodstocks. The aquaculture yield of female yellow catfish is significantly reduced due to the successful promotion of all-male and hybrid new varieties. Meanwhile, wild germplasm resources are not possible to be used as broodstock because of the vigorous implementation of resource conservation policy. It is urgently needed to establish a large-scale producing system of the all-female population, and the key is to efficiently induce fertile XX pseudo-males. In this study, different percentages of masculinization 4.0%, 25.0%, and 62.5% was induced by different doses of levonorgestrel (LNG) immersion treatments, 1, 0.1, and 0.01 μg/L, respectively, starting from 12 days post-hatching (DPH) to 60 DPH. Complete-testis-type XX pseudo-males were induced in the 1 and 0.1 μg/L groups, while complete-testis-type (20.8%) and partial-testis-type pseudo-males (41.7%) were both found in the 0.01 μg/L group. A quantity of sperm and intercommunicating seminiferous tubules were observed in XX males at 122 DPH individuals, indicating that induced XX pseudo-male fish have the normal reproductive ability. Reduced oocyte numbers at 62 DPH and gonadosomatic index at 122 DPH of un-masculinized XX individuals after LNG immersion indicate negative effects of LNG on ovarian development. Growth and mortality were not significantly affected by LNG treatments. Our results suggested that LNG-induced masculinization in yellow catfish had the advantages of low treatment dosage, high efficiency on masculinization, and promoting the testis development of the XX pseudo-males. The present work provides new ideas for the optimization of inducing functional XX pseudo-males, and establishes an important foundation for sustainable aquaculture development and high-efficient breeding of yellow catfish. The establishment of the all-female production system will strongly increase the efficiency of genetic breeding in yellow catfish. The roles of progesterone in fish sex differentiation deserve further investigation.
,
Available online
, doi: 10.7541/2023.2023.0017
Abstract:
Supernumerary microchromosomes are non-essential chromosomes in addition to regular chromosomes, and it always believed that they don’t have biological functions. With the rapid development of sequencing technology, more and more evidence show that supernumerary microchromosomes have active genes and play important role in organism. Amphitriploid gibel carp (Carassius gibelio) and amphidiploid crucian carp (Carassius auratus) are belonged to the polyploid Carassius complex, and previous studies have shown that amphitriploid C. gibelio contain regular chromosomes and supernumerary microchromosomes while amphidiploid C. auratus are consist of regular chromosomes. To reveal genomic characteristics of the supernumerary microchromosomes in amphitriploid C. gibelio, we identified the potential sequences of supernumerary microchromosomes by supernumerary microchromosome-enriched satellite sequences and fluorescence in situ hybridization, and performed genomic characterization of these sequences. In this study, a total of 15scaffolds were identified to be derived from supernumerary microchromosomes in the genome database of a female gibel carp, and 22.28% of these sequences had homologous to the regular chromosomes of amphidiploid C. auratus, which was the ancestral of gibel carp. The repetitive sequence proportion of supernumerary microchromosomes in amphitriploid C. gibelio was obviously higher than that of regular chromosomes in amphidiploid C. auratus and amphitriploid C. gibelio, and the contents of repetitive sequences were also different among them. Subsequently, we found that 6 of the 8 expanded meiosis-related gene families in C. gibelio had duplicated copies in the sequences of supernumerary microchromosomes, and these duplicated copies displayed transcriptional activity during oogenesis. In addition, we developed 3 SCAR markers specific to supernumerary microchromosomes based on these amplified copies, and these markers also could be used to distinguish amphidiploid C. auratus and amphitriploid C. gibelio. These results indicated that the supernumerary microchromosomes of amphitriploid C. gibelio originated from regular chromosomes, and accumulated numerous repeats and active genes during the evolution process. Besides, most gene expansions of meiosis-related genes were accomplished by supernumerary microchromosomes in C. gibelio. These findings not only revealed the genomic characteristics of supernumerary microchromosomes in amphitriploid C. gibelio, but also provided novel insight into the role of supernumerary chromosomes in the evolution of unisexual reproduction.
Supernumerary microchromosomes are non-essential chromosomes in addition to regular chromosomes, and it always believed that they don’t have biological functions. With the rapid development of sequencing technology, more and more evidence show that supernumerary microchromosomes have active genes and play important role in organism. Amphitriploid gibel carp (Carassius gibelio) and amphidiploid crucian carp (Carassius auratus) are belonged to the polyploid Carassius complex, and previous studies have shown that amphitriploid C. gibelio contain regular chromosomes and supernumerary microchromosomes while amphidiploid C. auratus are consist of regular chromosomes. To reveal genomic characteristics of the supernumerary microchromosomes in amphitriploid C. gibelio, we identified the potential sequences of supernumerary microchromosomes by supernumerary microchromosome-enriched satellite sequences and fluorescence in situ hybridization, and performed genomic characterization of these sequences. In this study, a total of 15scaffolds were identified to be derived from supernumerary microchromosomes in the genome database of a female gibel carp, and 22.28% of these sequences had homologous to the regular chromosomes of amphidiploid C. auratus, which was the ancestral of gibel carp. The repetitive sequence proportion of supernumerary microchromosomes in amphitriploid C. gibelio was obviously higher than that of regular chromosomes in amphidiploid C. auratus and amphitriploid C. gibelio, and the contents of repetitive sequences were also different among them. Subsequently, we found that 6 of the 8 expanded meiosis-related gene families in C. gibelio had duplicated copies in the sequences of supernumerary microchromosomes, and these duplicated copies displayed transcriptional activity during oogenesis. In addition, we developed 3 SCAR markers specific to supernumerary microchromosomes based on these amplified copies, and these markers also could be used to distinguish amphidiploid C. auratus and amphitriploid C. gibelio. These results indicated that the supernumerary microchromosomes of amphitriploid C. gibelio originated from regular chromosomes, and accumulated numerous repeats and active genes during the evolution process. Besides, most gene expansions of meiosis-related genes were accomplished by supernumerary microchromosomes in C. gibelio. These findings not only revealed the genomic characteristics of supernumerary microchromosomes in amphitriploid C. gibelio, but also provided novel insight into the role of supernumerary chromosomes in the evolution of unisexual reproduction.
,
Available online
, doi: 10.7541/2023.2023.0038
Abstract:
To investigate the changes of miRNA expression profile of Ctenopharyngodon idella kidney cell line (CIK) before and after overexpression of the Ctenopharyngodon idella antimicrobial peptide Hepcidin (CiHep), and its molecular mechanism, the constructed recombinant expression plasmid pmCherry-N1-Cihep was transfected into CIK cells, and its optimal overexpression time was screened by detecting the transcription level of the gene and observing the fluorescence intensity of fusion proteinm Cherry-CiHep. CIK cell samples were collected at the optimal overexpression time point, and further analyzed for differentially miRNA expression profiles using high-throughput sequencing and qPCR techniques. The results showed that the optimal overexpression time of CiHep gene in CIK cells was 72h after transfection. 1850 and 2013 known miRNAs were identified as well as 1266 and 1347 new miRNAs were found from the two constructed sRNA libraries, respectively. Compared with the control group, 460 DEmiRNAs were screened in the overexpression group, among which 392 were significantly up-regulated and 68 were significantly down-regulated. GO annotation and KEGG pathway analysis of 5150 DEmiRNA target genes revealed that 436 target genes were GO annotated and mainly involved in biological processes such as cellular processes, biological regulation and single cell biological processes. 157 target genes were enriched in 54 KEGG pathways. miRNA-mRNA-immune interaction network analysis revealed that 29 DEmiRNAs and 23 target genes potentially mediated CiHep involvement in 13 immune-related signaling pathways including C-type lectin receptor, PI3K-Akt, and NOD-like receptor. The qPCR validation results of 12 DEmiRNAs were consistent with high-throughput sequencing results. The characteristics of miRNA expression profiles of CIK cells before and after CiHep overexpression were resolved in the study, and clarified pma-miR-199b-5p, dre-miR-15a-5p, novel_miR_317 and novel_miR_536 played a potentially important role in the immune regulatory network, which laid the foundation for an in-depth investigation of the molecular mechanisms of miRNA immune regulation induced by antimicrobial peptides in fish.
To investigate the changes of miRNA expression profile of Ctenopharyngodon idella kidney cell line (CIK) before and after overexpression of the Ctenopharyngodon idella antimicrobial peptide Hepcidin (CiHep), and its molecular mechanism, the constructed recombinant expression plasmid pmCherry-N1-Cihep was transfected into CIK cells, and its optimal overexpression time was screened by detecting the transcription level of the gene and observing the fluorescence intensity of fusion proteinm Cherry-CiHep. CIK cell samples were collected at the optimal overexpression time point, and further analyzed for differentially miRNA expression profiles using high-throughput sequencing and qPCR techniques. The results showed that the optimal overexpression time of CiHep gene in CIK cells was 72h after transfection. 1850 and 2013 known miRNAs were identified as well as 1266 and 1347 new miRNAs were found from the two constructed sRNA libraries, respectively. Compared with the control group, 460 DEmiRNAs were screened in the overexpression group, among which 392 were significantly up-regulated and 68 were significantly down-regulated. GO annotation and KEGG pathway analysis of 5150 DEmiRNA target genes revealed that 436 target genes were GO annotated and mainly involved in biological processes such as cellular processes, biological regulation and single cell biological processes. 157 target genes were enriched in 54 KEGG pathways. miRNA-mRNA-immune interaction network analysis revealed that 29 DEmiRNAs and 23 target genes potentially mediated CiHep involvement in 13 immune-related signaling pathways including C-type lectin receptor, PI3K-Akt, and NOD-like receptor. The qPCR validation results of 12 DEmiRNAs were consistent with high-throughput sequencing results. The characteristics of miRNA expression profiles of CIK cells before and after CiHep overexpression were resolved in the study, and clarified pma-miR-199b-5p, dre-miR-15a-5p, novel_miR_317 and novel_miR_536 played a potentially important role in the immune regulatory network, which laid the foundation for an in-depth investigation of the molecular mechanisms of miRNA immune regulation induced by antimicrobial peptides in fish.
EARLY STAGE STARVATION ON SURVIVAL AND GROWTH OF THE LARVAL SILVER CARP, HYPOPHTHALMICHTHYS MOLITRIX
,
Available online
, doi: 10.7541/2023.2023.0044
Abstract:
Food deprivation after a prolonged downriver drift could severely affect the growth and survival of silver carp Hypophthalmichthys molitrix larvae. In order to study the effect of the first feeding time on feeding ability, survival and growth of silver carp larvae, this study was carried out with a delay of 0 (feeding group), 2d, 4d and 6d in the feeding group and the starvation group at water temperature of (24±1)℃ under experimental conditions, respectively. Silver carp larvae were reared in experimental tanks (25 L) for 30d in five treatments. The feeding time of the five treatments in triplicates was 3 days after hatching (dah), 5 dah, 7 dah, 9 dah and FG (fasted group) respectively. The results were as follows: the initial feeding rate of silver carp larvae was 36.67% at 3 dah and reached the point of no return (PNR) at 11 dah. The timing of first feeding had a great influence on the survival rate of silver carp larvae. All the larvae in the starvation group died at 15 dah, while the survival rate of the larvae in the fed control group was 69.00% at 15 dah. With the extension of delayed feeding time, the survival rate of larvae decreased significantly. Larval growth was significantly affected by the time of first exogenous feeding. The total length specific growth rate (SGRL) and body weight specific growth rate(SGRW) of silver carp larvae in different treatment groups exhibited a general downward trend during starvation periods. SGRL of larvae at 14 and 30 dah in feeding group was higher than that in other delayed feeding treatments. Starvation affects the morphological characters of silver carp larvae. Principal component analysis of morphological ratio data showed that the morphological differences between starvation group and feeding group were mainly caused by the differences in head morphology and myotome height. Fed larvae began to show notochord flexion from 8 dah, and all of them turned to the notochord flexion at 14 dah, whereas unfed larvae remained at the preflexion stage until 14 dah. In order to avoid potential mortality by starvation and obtain adequate growth and development, the silver carp larvae must establish successful initial feeding within 2d before and after yolk sac depletion. This study can provide basic data and reference for the exploration of early recruitment process and population recruitment mechanism of silver carp.
Food deprivation after a prolonged downriver drift could severely affect the growth and survival of silver carp Hypophthalmichthys molitrix larvae. In order to study the effect of the first feeding time on feeding ability, survival and growth of silver carp larvae, this study was carried out with a delay of 0 (feeding group), 2d, 4d and 6d in the feeding group and the starvation group at water temperature of (24±1)℃ under experimental conditions, respectively. Silver carp larvae were reared in experimental tanks (25 L) for 30d in five treatments. The feeding time of the five treatments in triplicates was 3 days after hatching (dah), 5 dah, 7 dah, 9 dah and FG (fasted group) respectively. The results were as follows: the initial feeding rate of silver carp larvae was 36.67% at 3 dah and reached the point of no return (PNR) at 11 dah. The timing of first feeding had a great influence on the survival rate of silver carp larvae. All the larvae in the starvation group died at 15 dah, while the survival rate of the larvae in the fed control group was 69.00% at 15 dah. With the extension of delayed feeding time, the survival rate of larvae decreased significantly. Larval growth was significantly affected by the time of first exogenous feeding. The total length specific growth rate (SGRL) and body weight specific growth rate(SGRW) of silver carp larvae in different treatment groups exhibited a general downward trend during starvation periods. SGRL of larvae at 14 and 30 dah in feeding group was higher than that in other delayed feeding treatments. Starvation affects the morphological characters of silver carp larvae. Principal component analysis of morphological ratio data showed that the morphological differences between starvation group and feeding group were mainly caused by the differences in head morphology and myotome height. Fed larvae began to show notochord flexion from 8 dah, and all of them turned to the notochord flexion at 14 dah, whereas unfed larvae remained at the preflexion stage until 14 dah. In order to avoid potential mortality by starvation and obtain adequate growth and development, the silver carp larvae must establish successful initial feeding within 2d before and after yolk sac depletion. This study can provide basic data and reference for the exploration of early recruitment process and population recruitment mechanism of silver carp.
,
Available online
, doi: 10.7541/2023.2023.0034
Abstract:
In this study, the typical submerged macrophyte Vallisneria natans was selscted ,and the fresh weight, plant height, chlorophyll, malondialdehyde (MDA), superoxide dismutase (SOD) and peroxidase (POD) activities of Vallisneria natans were measured at 0, 1, 5, 10, 20 and 50 mg/kg of sediment cadmium contamination to analyze the cadmium tolerance effect of Vallisneria natans, and the enrichment capacities were indicated by the values of Biota-sediment accumulation factor (BSAF) and translocation factor (TF), while the 16SrRNA gene amplicon sequencing technique was used to study the community structure of Vallisneria natans rhizosphere bacteria response to the sediment cadmium contamination. The results showed that: 1) When Cd≥20 mg/kg treatment, the fresh weight, plant height, chlorophyll content and the stress resistance decreased of Vallisneria natans. The activities of SOD and POD increased firstly and then reduced, MDA content increased with increasing concentration; 2) in all the treatments, BSAF exceeded 1, indicating that Vallisneria natans could effectively enrich cadmium in the contaminated sediment, and TF was less than 1, indicating that Vallisneria natans relied on root filtration mechanism to enrich cadmium, thus it was recommended that Vallisneria natans need to be harvested regularly; 3) the sequencing results showed that the rhizosphere bacteria of Vallisneria natans were mainly composed of 37 phylum, such as Actinobacteria, Firmicutes and Proteobacteria, including plant growth-promoting bacteria such as Sphingomonas, Flavisobacter, Massilia, Bacillus, and Arthrobacter, which may play important roles in promoting the growth, tolerance, and enrichment of cadmium in Vallisneria natans. In this study, we preliminarily analyzed the changes of morphological, physiological and biochemical indicators of Vallisneria natans under varied cadmium stress environments and the composition of Vallisneria natans rhizosphere bacterial community and its response characteristics to cadmium stress, which provide guidance for the subsequent improvement of Vallisneria natans restoration efficiency.
In this study, the typical submerged macrophyte Vallisneria natans was selscted ,and the fresh weight, plant height, chlorophyll, malondialdehyde (MDA), superoxide dismutase (SOD) and peroxidase (POD) activities of Vallisneria natans were measured at 0, 1, 5, 10, 20 and 50 mg/kg of sediment cadmium contamination to analyze the cadmium tolerance effect of Vallisneria natans, and the enrichment capacities were indicated by the values of Biota-sediment accumulation factor (BSAF) and translocation factor (TF), while the 16SrRNA gene amplicon sequencing technique was used to study the community structure of Vallisneria natans rhizosphere bacteria response to the sediment cadmium contamination. The results showed that: 1) When Cd≥20 mg/kg treatment, the fresh weight, plant height, chlorophyll content and the stress resistance decreased of Vallisneria natans. The activities of SOD and POD increased firstly and then reduced, MDA content increased with increasing concentration; 2) in all the treatments, BSAF exceeded 1, indicating that Vallisneria natans could effectively enrich cadmium in the contaminated sediment, and TF was less than 1, indicating that Vallisneria natans relied on root filtration mechanism to enrich cadmium, thus it was recommended that Vallisneria natans need to be harvested regularly; 3) the sequencing results showed that the rhizosphere bacteria of Vallisneria natans were mainly composed of 37 phylum, such as Actinobacteria, Firmicutes and Proteobacteria, including plant growth-promoting bacteria such as Sphingomonas, Flavisobacter, Massilia, Bacillus, and Arthrobacter, which may play important roles in promoting the growth, tolerance, and enrichment of cadmium in Vallisneria natans. In this study, we preliminarily analyzed the changes of morphological, physiological and biochemical indicators of Vallisneria natans under varied cadmium stress environments and the composition of Vallisneria natans rhizosphere bacterial community and its response characteristics to cadmium stress, which provide guidance for the subsequent improvement of Vallisneria natans restoration efficiency.
,
Available online
, doi: 10.7541/2023.2023.0029
Abstract:
Along the rapid development of molecular biology technology, the cyanobacterial taxonomy is also experiencing great development and improvement, and many novel cyanobacterial taxa from different ecosystems were described. Coleofecosciculaceae is a new family established by Komárek et al. in 2014, which was separated from the Microcolleus-like group. However, the taxonomic studies and basic knowledge of this family are not involved in China. In this study, four filamentous cyanobacteria were successfully isolated from the microbial mats samples collected in Zhejiang Province, China. These strains were morphologically similar to the species of the family Coleofasciculaceae. The molecular characteristics and phylogenetic analysis based on 16S rRNA gene and 16S—23S ITS secondary structure showed that these strains formed well-supported phylogenetic evolutionary clades with Pycnacronema and Wilmottia, respectively. This paper uses a method combination of all evidence composed of molecular characters, morphological, and ecophysiological data for taxa delimitation of Pycnacronema and Wilmottia. The family Coleofasciculaceae was firstly recorded here in China, and Pycnacronema and Wilmottia, were also the new recorded genera in China. This paper describes not only the history of the family Coleofasciculaceae but also introduces and discusses the modern cyanobacterial taxonomic system including its on-going process, current results and development trend. These positive results can greatly advance the progress of cyanobacterial taxonomy and increase the abundance of cyanobacterial species in China.
Along the rapid development of molecular biology technology, the cyanobacterial taxonomy is also experiencing great development and improvement, and many novel cyanobacterial taxa from different ecosystems were described. Coleofecosciculaceae is a new family established by Komárek et al. in 2014, which was separated from the Microcolleus-like group. However, the taxonomic studies and basic knowledge of this family are not involved in China. In this study, four filamentous cyanobacteria were successfully isolated from the microbial mats samples collected in Zhejiang Province, China. These strains were morphologically similar to the species of the family Coleofasciculaceae. The molecular characteristics and phylogenetic analysis based on 16S rRNA gene and 16S—23S ITS secondary structure showed that these strains formed well-supported phylogenetic evolutionary clades with Pycnacronema and Wilmottia, respectively. This paper uses a method combination of all evidence composed of molecular characters, morphological, and ecophysiological data for taxa delimitation of Pycnacronema and Wilmottia. The family Coleofasciculaceae was firstly recorded here in China, and Pycnacronema and Wilmottia, were also the new recorded genera in China. This paper describes not only the history of the family Coleofasciculaceae but also introduces and discusses the modern cyanobacterial taxonomic system including its on-going process, current results and development trend. These positive results can greatly advance the progress of cyanobacterial taxonomy and increase the abundance of cyanobacterial species in China.
,
Available online
, doi: 10.7541/2023.2022.0318
Abstract:
In order to investigate the phytoplankton functional groups distribution and its driving key factors, sixteen sampling sites were selected in the Yellow River Basin within Henan Province, involving two main streams, eleven tributaries and three reservoirs, from June to July, 2021. According to the analysis of phytoplankton composition, distribution of phytoplankton functional groups and the relationship between phytoplankton and environmental variables, results showed that (1) a total of 154species belonging to 65 genera and 7 phyla were identified, mainly including Bacillariophyta, Cyanophyta, Chlorophyta, Dinoflagellata, Euglenophyta, etc. In terms of species abundance, Chlorophyta (68species)>diatom (60species)>Cyanophyta (11species); Cyclotella sp., Auracoseira Granata var. angutissima, Aphanizomenon sp. and pseudoanabaena sp. are the main dominant species in the basin (dominance≥0.02), among which diatom is absolutely dominant and Chlorophyta is sub-absolutely dominant. (2) Phytoplankton in the Yellow River Basin within Henan Province are classified into 23 functional groups, namely assemblage B, C, D, E, F, G, H1, J, LM, Lo, M, MP, N, P, S1, T, W1, W2, X1, X2, X3, Xph and Y; the spatial distribution of functional groups in the investigated basin is quite different. The functional groups in main stream are the least and tributaries are the most, the functional groups C, D, MP, P and J that adapt to eutrophic and mixed water bodies are dominant. (3) RDA analysis showed that the five dominant functional groups were positively correlated with WT, pH,\begin{document}${\rm{NH}}^+_4 $\end{document} ![]()
![]()
In order to investigate the phytoplankton functional groups distribution and its driving key factors, sixteen sampling sites were selected in the Yellow River Basin within Henan Province, involving two main streams, eleven tributaries and three reservoirs, from June to July, 2021. According to the analysis of phytoplankton composition, distribution of phytoplankton functional groups and the relationship between phytoplankton and environmental variables, results showed that (1) a total of 154species belonging to 65 genera and 7 phyla were identified, mainly including Bacillariophyta, Cyanophyta, Chlorophyta, Dinoflagellata, Euglenophyta, etc. In terms of species abundance, Chlorophyta (68species)>diatom (60species)>Cyanophyta (11species); Cyclotella sp., Auracoseira Granata var. angutissima, Aphanizomenon sp. and pseudoanabaena sp. are the main dominant species in the basin (dominance≥0.02), among which diatom is absolutely dominant and Chlorophyta is sub-absolutely dominant. (2) Phytoplankton in the Yellow River Basin within Henan Province are classified into 23 functional groups, namely assemblage B, C, D, E, F, G, H1, J, LM, Lo, M, MP, N, P, S1, T, W1, W2, X1, X2, X3, Xph and Y; the spatial distribution of functional groups in the investigated basin is quite different. The functional groups in main stream are the least and tributaries are the most, the functional groups C, D, MP, P and J that adapt to eutrophic and mixed water bodies are dominant. (3) RDA analysis showed that the five dominant functional groups were positively correlated with WT, pH,
,
Available online
, doi: 10.7541/2023.2022.0503
Abstract:
Jiangxi Province is one of the most important distribution of Yangtze finless porpoise (YFP). Since the scientific investigation of Yangtze finless porpoise in the whole Yangtze River basin in 2017, there is no report about the comprehensive and systematic investigation of YFP in Jiangxi Province, and the changes and distribution characteristics of YFP are not clear. In this study, we set up 12 investigation routes from November to December 2021, and the synchronous visual survey method was used to investigate the quantity and distribution of YFP, including the Jiangxi section of the Yangtze River, Poyang Lake and the lower reaches of Ganjiang River. The changes of the population quantity and distribution of YFP in Jiangxi Province and the migration relationship between rivers and lakes of YFP were discussed based on historical data. The results showed that 217 groups and 454 of YFP were observed in November, and 236 groups and 569 of YFP were observed in December. Influenced by environmental conditions such as water level and weather, paired-samples t-test showed that there were significant differences in the number of YFP observations between the two surveys (t=–2.23, P<0.05). The distribution pattern of YFP in November and December were basically the same: YFP were mainly distributed in Hukou Shizhongshan-Pengze Sanhao Island in the Jiangxi section of the Yangtze River; YFP can be found in the waters with suitable water depth, and YFP were high-density distribution in the areas among which Wanghuting-Zhuxihe estuary, Duchang shipyard-Huangjin mouse-Sanshan–Piaosan in Poyang Lake. In the lower reaches of Ganjiang River, YFP were found around the fishing village of Yangzizhou. In December, the encounter rates of the two surveys were 1.00 and 1.08/km respectively, which were both higher than those of previous years, therefore, the population of YFP in Poyang Lake and Yangtze River may have increased. Only 3 YFP and 2 YFP were found in the Hamashi and Shizongshan waters of Poyang Lake during the two investigations, which suggests that there has been almost no migration of YFP between the Yangtze River and Poyang Lake during the survey. In the future, it is necessary to further control human activities in the migration waters of rivers and lakes and promote the migration. Zhuxi Estuary-Wucheng is the main distribution area of finless porpoises. In dry season, navigation control of vessels in this area should be strengthened to reduce the impact of shipping and improve the protection effect of Poyang Lake Yangtze finless porpoises.
Jiangxi Province is one of the most important distribution of Yangtze finless porpoise (YFP). Since the scientific investigation of Yangtze finless porpoise in the whole Yangtze River basin in 2017, there is no report about the comprehensive and systematic investigation of YFP in Jiangxi Province, and the changes and distribution characteristics of YFP are not clear. In this study, we set up 12 investigation routes from November to December 2021, and the synchronous visual survey method was used to investigate the quantity and distribution of YFP, including the Jiangxi section of the Yangtze River, Poyang Lake and the lower reaches of Ganjiang River. The changes of the population quantity and distribution of YFP in Jiangxi Province and the migration relationship between rivers and lakes of YFP were discussed based on historical data. The results showed that 217 groups and 454 of YFP were observed in November, and 236 groups and 569 of YFP were observed in December. Influenced by environmental conditions such as water level and weather, paired-samples t-test showed that there were significant differences in the number of YFP observations between the two surveys (t=–2.23, P<0.05). The distribution pattern of YFP in November and December were basically the same: YFP were mainly distributed in Hukou Shizhongshan-Pengze Sanhao Island in the Jiangxi section of the Yangtze River; YFP can be found in the waters with suitable water depth, and YFP were high-density distribution in the areas among which Wanghuting-Zhuxihe estuary, Duchang shipyard-Huangjin mouse-Sanshan–Piaosan in Poyang Lake. In the lower reaches of Ganjiang River, YFP were found around the fishing village of Yangzizhou. In December, the encounter rates of the two surveys were 1.00 and 1.08/km respectively, which were both higher than those of previous years, therefore, the population of YFP in Poyang Lake and Yangtze River may have increased. Only 3 YFP and 2 YFP were found in the Hamashi and Shizongshan waters of Poyang Lake during the two investigations, which suggests that there has been almost no migration of YFP between the Yangtze River and Poyang Lake during the survey. In the future, it is necessary to further control human activities in the migration waters of rivers and lakes and promote the migration. Zhuxi Estuary-Wucheng is the main distribution area of finless porpoises. In dry season, navigation control of vessels in this area should be strengthened to reduce the impact of shipping and improve the protection effect of Poyang Lake Yangtze finless porpoises.
,
Available online
, doi: 10.7541/2023.2022.0499
Abstract:
In order to adapt to the transition from aquatic to terrestrial, the skeletal system of amphibians has undergone tremendous changes before and after metamorphosis. The characteristics of the skeleton development sequence in amphibians reflect their evolutionary adaptation to lifestyle and are also ideal materials for studying vertebrate skeleton formation, growth, and remodeling. In order to reveal the characteristics of the amphibian skeletal system and the sequence of skeletal development, the process of skeletal system development of amphibians at different ages was observed and compared by the double staining of cartilage and bone procedure. The results showed that the skeletal system of Ranodon sibiricus was divided into the skull, vertebra, and appendicular skeleton, with a total of (217±1) bones, including 53skull bones, (48±1) vertebra bones, and 116 appendage bones. Furthermore, the skeletal system of Ranodon sibiricus has some significant morphological features that are different from other species of Hynobiidae. The contour of the skull appears broad and flat, and the skull fragments are thin and weak. In addition to the fontanelle between the frontals in the dorsal center of the skull, there is also a premaxillary fontanelle in the dorsal front of the skull, and the ratio of the length of the premaxillary fontanel to the length of the nasal bone is up to or more than 1/2. The two rows of vomerine dentition are positioned between the nostrils and separated. The arrangement pattern of the vomerine pars dentition changed from '/ \' to accompanied by the metamorphosis from larva to adult of Ranodon sibiricus. The anterior of the pterygoid is very close to the posterior of the maxilla, even linked by the bone bridge at the larval stage until the bone bridge breaks after metamorphosis. The shape of the maxillary arch is arched, and the lower jaw is thin and weak. Squamosal is 'T' shaped and narrower. The first branchial arch is completely cartilage. The cornua of the basibranchial cartilage show two cylindrical branches gradually tapering anterolaterally to a pointed tip. The process of prearticular is not developed, with small articular. The caudal vertebrae are flat. The first three caudal vertebrae still have ribs, and the haemal arch appears from the fourth caudal vertebra. With 4 fingers and 5 toes, it usually has 8 carpals and 10 tarsals, respectively. At the age of 6 months, the morphology and structure of the skull of Ranodon sibiricus began to change significantly compared with the previous development stage. For example, the maxilla, lacrimale, and prefrontal were born. The outline of the premaxillary fontanelle is gradually clear. The palatine degenerates. The pterygoid retracts backward. The squamosal extends outward, and the angle formed by the outer edge of the left and right squamosal increases further. At the same time, the prepubis was born in the pelvic girdle. These massive newborn or remodeling bones at the skull and the pelvic girdle suggest that Ranodon sibiricus has entered the metamorphosis stage to adapt to the transition from aquatic to terrestrial. The second significant change in the skeletal number and morphology of Ranodon sibiricus occurs at the age of 2 years. Although most bones only showed the enhancement of ossification degree from 6 months to 2 years old, there were significant changes in the apparatus hyoideus. The third and fourth branchial arches degenerate or disappear, meaning the outer gills disappear. The disappearance of the outer gills also suggests that the development of metamorphosis is nearing its end. Based on the comparative analysis of the skeletal system of Ranodon sibiricus at different ages, it is speculated that the metamorphosis of Ranodon sibiricus occurred from 6 months and lasted until the age of 2 years. During the development of metamorphosis, the newborn, degeneration, and reorganization of bones are mainly to adapt to the changes in feeding, breathing, and movement before and after metamorphosis. The results of this study can provide a theoretical basis for studying the skeletal functional development of Ranodon sibiricus and its phylogenetic classification in Hynobiidae species.
In order to adapt to the transition from aquatic to terrestrial, the skeletal system of amphibians has undergone tremendous changes before and after metamorphosis. The characteristics of the skeleton development sequence in amphibians reflect their evolutionary adaptation to lifestyle and are also ideal materials for studying vertebrate skeleton formation, growth, and remodeling. In order to reveal the characteristics of the amphibian skeletal system and the sequence of skeletal development, the process of skeletal system development of amphibians at different ages was observed and compared by the double staining of cartilage and bone procedure. The results showed that the skeletal system of Ranodon sibiricus was divided into the skull, vertebra, and appendicular skeleton, with a total of (217±1) bones, including 53skull bones, (48±1) vertebra bones, and 116 appendage bones. Furthermore, the skeletal system of Ranodon sibiricus has some significant morphological features that are different from other species of Hynobiidae. The contour of the skull appears broad and flat, and the skull fragments are thin and weak. In addition to the fontanelle between the frontals in the dorsal center of the skull, there is also a premaxillary fontanelle in the dorsal front of the skull, and the ratio of the length of the premaxillary fontanel to the length of the nasal bone is up to or more than 1/2. The two rows of vomerine dentition are positioned between the nostrils and separated. The arrangement pattern of the vomerine pars dentition changed from '/ \' to accompanied by the metamorphosis from larva to adult of Ranodon sibiricus. The anterior of the pterygoid is very close to the posterior of the maxilla, even linked by the bone bridge at the larval stage until the bone bridge breaks after metamorphosis. The shape of the maxillary arch is arched, and the lower jaw is thin and weak. Squamosal is 'T' shaped and narrower. The first branchial arch is completely cartilage. The cornua of the basibranchial cartilage show two cylindrical branches gradually tapering anterolaterally to a pointed tip. The process of prearticular is not developed, with small articular. The caudal vertebrae are flat. The first three caudal vertebrae still have ribs, and the haemal arch appears from the fourth caudal vertebra. With 4 fingers and 5 toes, it usually has 8 carpals and 10 tarsals, respectively. At the age of 6 months, the morphology and structure of the skull of Ranodon sibiricus began to change significantly compared with the previous development stage. For example, the maxilla, lacrimale, and prefrontal were born. The outline of the premaxillary fontanelle is gradually clear. The palatine degenerates. The pterygoid retracts backward. The squamosal extends outward, and the angle formed by the outer edge of the left and right squamosal increases further. At the same time, the prepubis was born in the pelvic girdle. These massive newborn or remodeling bones at the skull and the pelvic girdle suggest that Ranodon sibiricus has entered the metamorphosis stage to adapt to the transition from aquatic to terrestrial. The second significant change in the skeletal number and morphology of Ranodon sibiricus occurs at the age of 2 years. Although most bones only showed the enhancement of ossification degree from 6 months to 2 years old, there were significant changes in the apparatus hyoideus. The third and fourth branchial arches degenerate or disappear, meaning the outer gills disappear. The disappearance of the outer gills also suggests that the development of metamorphosis is nearing its end. Based on the comparative analysis of the skeletal system of Ranodon sibiricus at different ages, it is speculated that the metamorphosis of Ranodon sibiricus occurred from 6 months and lasted until the age of 2 years. During the development of metamorphosis, the newborn, degeneration, and reorganization of bones are mainly to adapt to the changes in feeding, breathing, and movement before and after metamorphosis. The results of this study can provide a theoretical basis for studying the skeletal functional development of Ranodon sibiricus and its phylogenetic classification in Hynobiidae species.
,
Available online
, doi: 10.7541/2023.2022.0479
Abstract:
As a unique carnivorous groundfish in the middle and upper reaches of the Yellow River basin, Silurus lanzhouensis has a delicious meat quality, a large market demand and a promising breeding prospect, but because of its characteristics of feeding on live bait such as small fish and shrimps in natural waters, it is difficult to transform the breeding domestication, and the survival rate of fry breeding is low, which becomes an important bottleneck limiting the sustainable development of the S. lanzhouensis breeding industry. In view of this, this study was conducted to predict the composition, abundance, diversity and function of the intestinal flora in different environments by high-throughput sequencing of the bacterial 16S rDNA V3—V4 region of the S. lanzhouensis population in different habitats. The results showed that the main phyla of the intestinal tract in S. lanzhouensis were Proteobacteria, Fusobacteria, Firmicutes, Bacteroidetes and Actinobacteria, and the main genera were Cetobacterium, Plesiomonas, Aeromonas, Methylobacterium, Escherichia-Shigella, Acinetobacter and Shewanella. Among them, Fusobacteria and Proteobacteria accounted for more than 60% of the four groups of species and were the core phyla; the core genera were Cetobacterium and Plesiomonas. The results of gut flora α and β diversity analysis showed that the richness and evenness of the gut flora were CT>DK>WX>TL; the diversity of gut flora species was more different between the two groups of culture type; the diversity of gut flora was higher in S. lanzhouensis at 26.5℃ than at 20℃; the diversity of gut flora was lower in S. lanzhouensis in single species net tank culture than in other culture modes. Further analysis of the composition and abundance of the intestinal flora of S. lanzhouensis showed that the relative abundance of Bacteroidetes in the CT group was significantly different from that of the TL group (P≤0.01) and from that of the WX group (P≤0.05), while the relative abundance of Actinobacteria in the cultured CT group was significantly The relative abundance of Actinobacteria in the cultured CT group was significantly higher than that in the wild-type groups (P≤0.05), and the abundance of Methylobacterium was significantly higher than that in the WX and TL groups (P≤0.05). Further analysis in combination with environmental factors indicated that temperature, pH and ammonia concentration may be important factors influencing the composition and abundance of the intestinal flora in S. lanzhouensis. The predicted intestinal flora function indicated that different environments would affect the metabolic capacity of the intestinal flora of S. lanzhouensis. Among them, the DK group was a separate branch and its gut flora had higher abundance of lipid metabolism and carbohydrate metabolism pathways, which may be related to the higher F/B ratio of wild-type S. lanzhouensis gut flora to help the host to digest food more efficiently for more energy in the wild environment. In summary, different growth environments have significant effects on the composition, abundance, and predicted flora function of the S. lanzhouensis gut flora, which can help to promote sustainable S. lanzhouensis farming by changing external conditions and thus effectively controlling the S. lanzhouensis gut flora.
As a unique carnivorous groundfish in the middle and upper reaches of the Yellow River basin, Silurus lanzhouensis has a delicious meat quality, a large market demand and a promising breeding prospect, but because of its characteristics of feeding on live bait such as small fish and shrimps in natural waters, it is difficult to transform the breeding domestication, and the survival rate of fry breeding is low, which becomes an important bottleneck limiting the sustainable development of the S. lanzhouensis breeding industry. In view of this, this study was conducted to predict the composition, abundance, diversity and function of the intestinal flora in different environments by high-throughput sequencing of the bacterial 16S rDNA V3—V4 region of the S. lanzhouensis population in different habitats. The results showed that the main phyla of the intestinal tract in S. lanzhouensis were Proteobacteria, Fusobacteria, Firmicutes, Bacteroidetes and Actinobacteria, and the main genera were Cetobacterium, Plesiomonas, Aeromonas, Methylobacterium, Escherichia-Shigella, Acinetobacter and Shewanella. Among them, Fusobacteria and Proteobacteria accounted for more than 60% of the four groups of species and were the core phyla; the core genera were Cetobacterium and Plesiomonas. The results of gut flora α and β diversity analysis showed that the richness and evenness of the gut flora were CT>DK>WX>TL; the diversity of gut flora species was more different between the two groups of culture type; the diversity of gut flora was higher in S. lanzhouensis at 26.5℃ than at 20℃; the diversity of gut flora was lower in S. lanzhouensis in single species net tank culture than in other culture modes. Further analysis of the composition and abundance of the intestinal flora of S. lanzhouensis showed that the relative abundance of Bacteroidetes in the CT group was significantly different from that of the TL group (P≤0.01) and from that of the WX group (P≤0.05), while the relative abundance of Actinobacteria in the cultured CT group was significantly The relative abundance of Actinobacteria in the cultured CT group was significantly higher than that in the wild-type groups (P≤0.05), and the abundance of Methylobacterium was significantly higher than that in the WX and TL groups (P≤0.05). Further analysis in combination with environmental factors indicated that temperature, pH and ammonia concentration may be important factors influencing the composition and abundance of the intestinal flora in S. lanzhouensis. The predicted intestinal flora function indicated that different environments would affect the metabolic capacity of the intestinal flora of S. lanzhouensis. Among them, the DK group was a separate branch and its gut flora had higher abundance of lipid metabolism and carbohydrate metabolism pathways, which may be related to the higher F/B ratio of wild-type S. lanzhouensis gut flora to help the host to digest food more efficiently for more energy in the wild environment. In summary, different growth environments have significant effects on the composition, abundance, and predicted flora function of the S. lanzhouensis gut flora, which can help to promote sustainable S. lanzhouensis farming by changing external conditions and thus effectively controlling the S. lanzhouensis gut flora.
,
Available online
, doi: 10.7541/2023.2022.0027
Abstract:
In order to increase the reproductive efficiency of hybrid yellow catfish [Pelteobagrus fulvidraco (♀)×Pelteobagrus vachelli (♂)], the addition of two functional amino acids L-arginine (L-Arg) and L-Leucine (L-Leu) in sperm preservation solution was studied to find out the optimal concentration in this study. The fertilization rate, hatching rate and malformation rate were used as factors to evaluate reproductive efficiency. Results showed that the fertilization rate increased first and then decreased with the fold increase in L-arginine concentration, and all of them were significantly higher than the control group (P<0.05). The highest fertilization rate was found in the 0.50 mmol/L concentration group, but there was no significant influence on the hatching rate and malformation rate (P>0.05). As the increasing of L-leucine concentration, the fertilization rate and hatching rate increased first and then decreased, while the malformation rate decreased and then increased, with the highest fertilization rate, the highest hatching rate and the lowest malformation rate in the 0.80 mmol/L concentration group, and all three evaluation factors were significantly improved in values when compared with the control group (P<0.05). We also tried to add the two amino acids simultaneously, at the concentrations of 0.4 and 1.0 mmol/L for L-arginine and L-leucine, respectively. We found that the fertilization rate, hatching rate and malformation rate were significantly improved (P<0.05). Besides, in this study we examined sperm motility using a computer-assisted sperm analysis system (CASA), the results indicated that the addition of 0.4 mmol/L arginine and 1.0 mmol/L leucine, alone or simultaneously, significantly promoted sperm motility (P<0.05). Finally, an improved hatching bucket of Pelteobagrus fulvidraco was developed in this study. It was proved to be more suitable for artificial breeding with the fertilization rate and hatching rate significantly higher than those of the traditional hatching bucket, by 12.13% and 20.76%, respectively (P<0.05). And with the malformation rate significantly lower than the traditional hatching bucket (with a reduction of 6.42%) (P<0.05). This study established a more efficient and convenient method for the artificial breeding of hybrid yellow catfish, which will help to promote the new species and accelerate the industrial development process.
In order to increase the reproductive efficiency of hybrid yellow catfish [Pelteobagrus fulvidraco (♀)×Pelteobagrus vachelli (♂)], the addition of two functional amino acids L-arginine (L-Arg) and L-Leucine (L-Leu) in sperm preservation solution was studied to find out the optimal concentration in this study. The fertilization rate, hatching rate and malformation rate were used as factors to evaluate reproductive efficiency. Results showed that the fertilization rate increased first and then decreased with the fold increase in L-arginine concentration, and all of them were significantly higher than the control group (P<0.05). The highest fertilization rate was found in the 0.50 mmol/L concentration group, but there was no significant influence on the hatching rate and malformation rate (P>0.05). As the increasing of L-leucine concentration, the fertilization rate and hatching rate increased first and then decreased, while the malformation rate decreased and then increased, with the highest fertilization rate, the highest hatching rate and the lowest malformation rate in the 0.80 mmol/L concentration group, and all three evaluation factors were significantly improved in values when compared with the control group (P<0.05). We also tried to add the two amino acids simultaneously, at the concentrations of 0.4 and 1.0 mmol/L for L-arginine and L-leucine, respectively. We found that the fertilization rate, hatching rate and malformation rate were significantly improved (P<0.05). Besides, in this study we examined sperm motility using a computer-assisted sperm analysis system (CASA), the results indicated that the addition of 0.4 mmol/L arginine and 1.0 mmol/L leucine, alone or simultaneously, significantly promoted sperm motility (P<0.05). Finally, an improved hatching bucket of Pelteobagrus fulvidraco was developed in this study. It was proved to be more suitable for artificial breeding with the fertilization rate and hatching rate significantly higher than those of the traditional hatching bucket, by 12.13% and 20.76%, respectively (P<0.05). And with the malformation rate significantly lower than the traditional hatching bucket (with a reduction of 6.42%) (P<0.05). This study established a more efficient and convenient method for the artificial breeding of hybrid yellow catfish, which will help to promote the new species and accelerate the industrial development process.
,
Available online
, doi: 10.7541/2023.2022.0475
Abstract:
Sheathia is a representative genus of freshwater red algae with a large number of species and a wide distribution. It grows most commonly in clean freshwater such as streams, rivers and springs with low levels of light, low temperatures and high levels of dissolved oxygen. It has been recorded from Asia, Europe, Africa, North America and Oceania. Its harsh habitat makes it easy for the Sheathia to fail to grow normally when the external environment is altered. With the increasing pollution of the global water environment, the scarce freshwater resources have been severely damaged and the number of freshwater Sheathia is also decreasing. At the moment, many species have been added to the list of endangered plants. In this paper, 116species of samples of Sheathia around the world were used as the research object. A variety of statistical analyses, including one-way ANOVA, correlation analysis, stepwise regression analysis, principal component analysis and linear discriminant analysis were used to analyze the variability and interrelationships between the geographical distribution of different species and latitude, longitude, altitude, water temperature, current velocity and pH. According to the results of one-way ANOVA and linear discriminant analysis, the geographical distribution and growth environment of Sheathia arcuata, S. boryana, S. confusa, S. dispersa, S. longipedicellata and Remainder were significantly different. Combining the results of correlation analysis, stepwise regression analysis and principal component analysis, altitude, water temperature, current velocity and pH were important environmental factors affecting the geographical distribution of Sheathia. This study has analyzed the important environmental factors affecting the geographical distribution of Sheathia at the species level, in order to provide more scientific basis for understanding the mechanism of freshwater red algae adaptation to the environment, to enrich the data on the geographical distribution of freshwater red algae, to establish a relatively perfect freshwater nature sanctuary and to protect the freshwater red algae groups with special habitats.
Sheathia is a representative genus of freshwater red algae with a large number of species and a wide distribution. It grows most commonly in clean freshwater such as streams, rivers and springs with low levels of light, low temperatures and high levels of dissolved oxygen. It has been recorded from Asia, Europe, Africa, North America and Oceania. Its harsh habitat makes it easy for the Sheathia to fail to grow normally when the external environment is altered. With the increasing pollution of the global water environment, the scarce freshwater resources have been severely damaged and the number of freshwater Sheathia is also decreasing. At the moment, many species have been added to the list of endangered plants. In this paper, 116species of samples of Sheathia around the world were used as the research object. A variety of statistical analyses, including one-way ANOVA, correlation analysis, stepwise regression analysis, principal component analysis and linear discriminant analysis were used to analyze the variability and interrelationships between the geographical distribution of different species and latitude, longitude, altitude, water temperature, current velocity and pH. According to the results of one-way ANOVA and linear discriminant analysis, the geographical distribution and growth environment of Sheathia arcuata, S. boryana, S. confusa, S. dispersa, S. longipedicellata and Remainder were significantly different. Combining the results of correlation analysis, stepwise regression analysis and principal component analysis, altitude, water temperature, current velocity and pH were important environmental factors affecting the geographical distribution of Sheathia. This study has analyzed the important environmental factors affecting the geographical distribution of Sheathia at the species level, in order to provide more scientific basis for understanding the mechanism of freshwater red algae adaptation to the environment, to enrich the data on the geographical distribution of freshwater red algae, to establish a relatively perfect freshwater nature sanctuary and to protect the freshwater red algae groups with special habitats.
,
Available online
, doi: 10.7541/2023.2022.0403
Abstract:
The large cage has a large aquaculture volume, so how to intercept and aggregate the breeding objects and realize batch fishing is one of the important problems to be solved in this model. Rainbow trout (Oncorhynchus mykiss), as a kind of cold water fish with rich nutrition and high value, will become one of the important aquaculture species of large sea cage in China in the future. The underwater bubble curtain has the advantages of low cost, no pollution and no damage in catching and displacing fish. It has been applied in the control of fish in marine ranches, catching and displacing fish in river channels and intakes. In 2021, the "Shenlan 1" fully submersible large-scale steel structure cage developed by China has achieved large-scale rainbow trout farming in the cold water mass of the Yellow Sea. In order to make full use of the cold water mass in the Yellow Sea to cultivate cold water fish, to realize the interception and aggregation of rainbow trout in the dark environment after the cage diving, and to improve the fishing efficiency, this study explored the obstructing effect of bubble curtain on rainbow trout under different conditions. The experiment was carried out in a light-tight room, and light and dark environments were distinguished by controlling the opening and closing of light sources. Under the light environment, four kinds of hole spacing (1.0, 2.0, 3.0 and 4.0 cm), four kinds of hole diameter (0.5, 1.0, 1.5 and 2.0 mm) and three kinds of gas flows (60, 120 and 180 L/min) were used to generate bubble curtain. The obstructing experiment of rainbow trout was carried out by single variable method, and the optimal obstructing effect was obtained. On this basis, the obstructing effect of bubble curtain on rainbow trout under the optimal condition of dark environment was tested. The results showed that under the light environment, the optimal obstructing effect was the bubble curtain with hole diameter of 1.0 mm, hole spacing of 2.0 cm and gas flow of 120 L/min, and the obstructing rate was (96.32±3.99)%. In the dark environment, the swimming speed of rainbow trout decreased significantly. The number of fish tail swimming above the bubble curtain pipe was 63.37% of that in the light environment, and the obstructing rate was (87.48±2.55)%. It was observed that rainbow trout passed through the bubble curtain in two ways: passive and active. In light environment and dark environment, there are differences in the behavior and obstructing rate of rainbow trout, indicating that rainbow trout can perceive the bubble curtain in advance through vision, so as to make behavioral response. In dark environment, rainbow trout cannot perceive the existence of bubble curtain visually, and rainbow trout can only perceive bubble curtain through other senses at close range. The visual effect of bubble curtain on rainbow trout plays a certain role in the obstructing process, but it is not the dominant role. The formation effect of bubble curtain is different with different parameters. The bubble curtain with dense bubbles is more like a "bubble wall", which prevents rainbow trout from passing through easily. However, the bubble curtain with sparse bubbles cannot completely block the perception of the environment on the other side of the bubble curtain. This study explores the bubble curtains on the block and block mechanism of rainbow trout, the results can be used for inside the cages bubble curtains block fish, can achieve the congregation of fish and other fishing gear partial fishing fishing method to provide possible, for our country large deep sea trout fish aquaculture control technology and fishing equipment research and development to provide theoretical reference and technical support.
The large cage has a large aquaculture volume, so how to intercept and aggregate the breeding objects and realize batch fishing is one of the important problems to be solved in this model. Rainbow trout (Oncorhynchus mykiss), as a kind of cold water fish with rich nutrition and high value, will become one of the important aquaculture species of large sea cage in China in the future. The underwater bubble curtain has the advantages of low cost, no pollution and no damage in catching and displacing fish. It has been applied in the control of fish in marine ranches, catching and displacing fish in river channels and intakes. In 2021, the "Shenlan 1" fully submersible large-scale steel structure cage developed by China has achieved large-scale rainbow trout farming in the cold water mass of the Yellow Sea. In order to make full use of the cold water mass in the Yellow Sea to cultivate cold water fish, to realize the interception and aggregation of rainbow trout in the dark environment after the cage diving, and to improve the fishing efficiency, this study explored the obstructing effect of bubble curtain on rainbow trout under different conditions. The experiment was carried out in a light-tight room, and light and dark environments were distinguished by controlling the opening and closing of light sources. Under the light environment, four kinds of hole spacing (1.0, 2.0, 3.0 and 4.0 cm), four kinds of hole diameter (0.5, 1.0, 1.5 and 2.0 mm) and three kinds of gas flows (60, 120 and 180 L/min) were used to generate bubble curtain. The obstructing experiment of rainbow trout was carried out by single variable method, and the optimal obstructing effect was obtained. On this basis, the obstructing effect of bubble curtain on rainbow trout under the optimal condition of dark environment was tested. The results showed that under the light environment, the optimal obstructing effect was the bubble curtain with hole diameter of 1.0 mm, hole spacing of 2.0 cm and gas flow of 120 L/min, and the obstructing rate was (96.32±3.99)%. In the dark environment, the swimming speed of rainbow trout decreased significantly. The number of fish tail swimming above the bubble curtain pipe was 63.37% of that in the light environment, and the obstructing rate was (87.48±2.55)%. It was observed that rainbow trout passed through the bubble curtain in two ways: passive and active. In light environment and dark environment, there are differences in the behavior and obstructing rate of rainbow trout, indicating that rainbow trout can perceive the bubble curtain in advance through vision, so as to make behavioral response. In dark environment, rainbow trout cannot perceive the existence of bubble curtain visually, and rainbow trout can only perceive bubble curtain through other senses at close range. The visual effect of bubble curtain on rainbow trout plays a certain role in the obstructing process, but it is not the dominant role. The formation effect of bubble curtain is different with different parameters. The bubble curtain with dense bubbles is more like a "bubble wall", which prevents rainbow trout from passing through easily. However, the bubble curtain with sparse bubbles cannot completely block the perception of the environment on the other side of the bubble curtain. This study explores the bubble curtains on the block and block mechanism of rainbow trout, the results can be used for inside the cages bubble curtains block fish, can achieve the congregation of fish and other fishing gear partial fishing fishing method to provide possible, for our country large deep sea trout fish aquaculture control technology and fishing equipment research and development to provide theoretical reference and technical support.
,
Available online
, doi: 10.7541/2023.2022.0387
Abstract:
Acanthopagrus schlegelii is an important fish species for enhancement and release in Chinese coastal waters. To study its swimming behavior and exercise physiology can provide technical support for the offshore cage culture and the feralization train of the enhancement and release. In this study, the swimming behavior (induced velocity, critical swimming speed, burst swimming speed and tail beat frequency), respiratory metabolism (oxygen consumption rate (Mo2), cost of transport (COT), median survival time and suffocation point), physiology and biochemistry (lactate, glycogen, glucose, phosphocreatine and hydrocortisone) of juvenile Acanthopagrus schlegelii [body length of (12.38±0.69) cm, weight of (45.99±9.05) g] at 19℃ and different flow velocity were measured in a loop test flume produced by Loligo Systems in Denmark. The results showed that the relative induced velocity of juvenile Acanthopagrus schlegelii was about 1.42 BL/s (body length/s), the critical swimming speed was about 76 cm/s, and the burst swimming speed was about 114 cm/s. The tail beat frequency had a significant linear positive correlation with the flow velocity. The standard metabolic rate was about 332.25 mg/(kg·h), and the activity metabolic rate had a quadratic polynomial relationship with the flow rate. The lowest oxygen consumption rate appeared at the flow rate of 3.6 BL/s, which was about 185.65 mg/(kg·h). The cost of transport had a power function relationship with the flow rate, and the minimum cost of transport appeared at a flow rate of 4 BL/s, which was about 66% Ucrit flow rate. The shortest median survival time of juvenile Acanthopagrus schlegelii was in the still water with about 3hours, and the longest median survival time was under the low (1 BL/s) and medium (3 BL/s) flow rates with more than 10hours. Suffocation point was about 0.34 mg/L in the still water, 1.70 mg/L at the low and medium flow rates, and about 3.18 mg/L at high flow rate. The contents of glycogen and phosphocreatine in white muscle and liver were higher at the low and medium flow rates (20% Ucrit, 50% Ucrit). The level of blood lactate was higher in the still water and at high flow rate, which correlated with oxygen consumption rate, suffocation point change trend was consistent. In conclusion, it is recommended that the flow rate for cage culture of juvenile Acanthopagrus schlegelii should not exceed 0.8 m/s, the appropriate training flow rate should be within the range of 1.5—3.5 BL/s, and the acclimation time should be more than 2 weeks.
Acanthopagrus schlegelii is an important fish species for enhancement and release in Chinese coastal waters. To study its swimming behavior and exercise physiology can provide technical support for the offshore cage culture and the feralization train of the enhancement and release. In this study, the swimming behavior (induced velocity, critical swimming speed, burst swimming speed and tail beat frequency), respiratory metabolism (oxygen consumption rate (Mo2), cost of transport (COT), median survival time and suffocation point), physiology and biochemistry (lactate, glycogen, glucose, phosphocreatine and hydrocortisone) of juvenile Acanthopagrus schlegelii [body length of (12.38±0.69) cm, weight of (45.99±9.05) g] at 19℃ and different flow velocity were measured in a loop test flume produced by Loligo Systems in Denmark. The results showed that the relative induced velocity of juvenile Acanthopagrus schlegelii was about 1.42 BL/s (body length/s), the critical swimming speed was about 76 cm/s, and the burst swimming speed was about 114 cm/s. The tail beat frequency had a significant linear positive correlation with the flow velocity. The standard metabolic rate was about 332.25 mg/(kg·h), and the activity metabolic rate had a quadratic polynomial relationship with the flow rate. The lowest oxygen consumption rate appeared at the flow rate of 3.6 BL/s, which was about 185.65 mg/(kg·h). The cost of transport had a power function relationship with the flow rate, and the minimum cost of transport appeared at a flow rate of 4 BL/s, which was about 66% Ucrit flow rate. The shortest median survival time of juvenile Acanthopagrus schlegelii was in the still water with about 3hours, and the longest median survival time was under the low (1 BL/s) and medium (3 BL/s) flow rates with more than 10hours. Suffocation point was about 0.34 mg/L in the still water, 1.70 mg/L at the low and medium flow rates, and about 3.18 mg/L at high flow rate. The contents of glycogen and phosphocreatine in white muscle and liver were higher at the low and medium flow rates (20% Ucrit, 50% Ucrit). The level of blood lactate was higher in the still water and at high flow rate, which correlated with oxygen consumption rate, suffocation point change trend was consistent. In conclusion, it is recommended that the flow rate for cage culture of juvenile Acanthopagrus schlegelii should not exceed 0.8 m/s, the appropriate training flow rate should be within the range of 1.5—3.5 BL/s, and the acclimation time should be more than 2 weeks.
,
Available online
, doi: 10.7541/2023.2022.0390
Abstract:
In recent decades, submerged macrophytes recession has become a prevalent environmental problem in shallow lakes in the middle and lower reaches of the Yangtze River affected by human disturbance and other factors. Bao’an Lake is located in the middle reaches of the Yangtze River. To understand the characteristics of submerged macrophytes community and the impacts of eutrophication and fishery production on the succession of macrophytes community, we analyzed the changes of the submerged macrophytes community, water quality and fishery resources in Bao’an Lake in the recent 40 years. The data were collected from our long-term monitoring, literature and the local lake management department. The results showed that: (1) During 1970s—1980s, there were about 10 common species of submerged macrophytes, mainly including Myriophyllum spicatum, Potamogeton maackianus and Potamogeton crispus, the annual average biomass was 1005—5954 g/m2. In 1990s, there were about 7 common species of submerged macrophytes, mainly Potamogeton maackianus and Potamogeton crispus, and the biomass decreased to 209—877 g/m2. During 2000s—2010s, the structure of submerged macrophytes was simplified, and Potamogeton crispus became the monodominant species, and the biomass changed greatly, fluctuated between 1 and 1478 g/m2. Since 2021, submerged macrophytes have basically disappeared. (2) From the 1980s to now, the nutrients content of Bao’an Lake exhibited an upward trend. Total phosphorus content (TP) during 1980s—1990s was about 0.03 mg/L, which was much lower than the regime shift threshold in shallow lakes. Eutrophication has little effect on submerged macrophytes at this time. In the 21st century, the nutrients content in lake water increased rapidly. In 2003, TP was 0.07 mg/L, which was close to the regime shift threshold. Since then, it was maintained at a relatively high level, which was one of the important reasons resulting in the decline of submerged macrophytes. (3) During 1980s—1990s, Ctenopharyngodon idellus and Eriocheir japonica sinensis were mainly stocked, and the fish yield fluctuated between 0.62×104 kg and 1.01×104 kg. The Ctenopharyngodon idellus was cultured at high density during 1986—1989 (about 2.6×104 kg), which was the main reason for the decline of submerged macrophytes during this period. In the 21st century, the fishery output has increased greatly, up to 500×104 kg. Hypophthalmichthys molitrix and Aristichthys nobilis have been the dominant species farming in the lakes, and there were so many Eriocheir japonica sinensis, which has adverse effects on the survival and development of submerged macrophytes. After the fishery withdrawal in 2018, the fishery resources have been greatly reduced, and only Hypophthalmichthys molitrix and Aristichthys nobilis were stocked, which has little direct impact on submerged macrophytes. The results indicated that in past 40 years, the biodiversity of submerged macrophytes in Bao’an Lake has decreased considerably, and the community structure has tended to be simplified. The succession of submerged macrophytes was mainly regulated by fishing (grazing pressure from Ctenopharyngodon idellus) during 1980s—1990s, while suffered with dual pressure from eutrophication and excessive aquaculture at the beginning of the 21st century. In recent years, eutrophication become the key factor influencing submerged macrophytes community. This research clarified the effects of eutrophication and excessive aquaculture on the succession of submerged macrophytes communities in isolated lakes, and provided theoretical basis for the ecological management for comparable shallow lakes located in the middle and lower reaches of the Yangtze River.
In recent decades, submerged macrophytes recession has become a prevalent environmental problem in shallow lakes in the middle and lower reaches of the Yangtze River affected by human disturbance and other factors. Bao’an Lake is located in the middle reaches of the Yangtze River. To understand the characteristics of submerged macrophytes community and the impacts of eutrophication and fishery production on the succession of macrophytes community, we analyzed the changes of the submerged macrophytes community, water quality and fishery resources in Bao’an Lake in the recent 40 years. The data were collected from our long-term monitoring, literature and the local lake management department. The results showed that: (1) During 1970s—1980s, there were about 10 common species of submerged macrophytes, mainly including Myriophyllum spicatum, Potamogeton maackianus and Potamogeton crispus, the annual average biomass was 1005—5954 g/m2. In 1990s, there were about 7 common species of submerged macrophytes, mainly Potamogeton maackianus and Potamogeton crispus, and the biomass decreased to 209—877 g/m2. During 2000s—2010s, the structure of submerged macrophytes was simplified, and Potamogeton crispus became the monodominant species, and the biomass changed greatly, fluctuated between 1 and 1478 g/m2. Since 2021, submerged macrophytes have basically disappeared. (2) From the 1980s to now, the nutrients content of Bao’an Lake exhibited an upward trend. Total phosphorus content (TP) during 1980s—1990s was about 0.03 mg/L, which was much lower than the regime shift threshold in shallow lakes. Eutrophication has little effect on submerged macrophytes at this time. In the 21st century, the nutrients content in lake water increased rapidly. In 2003, TP was 0.07 mg/L, which was close to the regime shift threshold. Since then, it was maintained at a relatively high level, which was one of the important reasons resulting in the decline of submerged macrophytes. (3) During 1980s—1990s, Ctenopharyngodon idellus and Eriocheir japonica sinensis were mainly stocked, and the fish yield fluctuated between 0.62×104 kg and 1.01×104 kg. The Ctenopharyngodon idellus was cultured at high density during 1986—1989 (about 2.6×104 kg), which was the main reason for the decline of submerged macrophytes during this period. In the 21st century, the fishery output has increased greatly, up to 500×104 kg. Hypophthalmichthys molitrix and Aristichthys nobilis have been the dominant species farming in the lakes, and there were so many Eriocheir japonica sinensis, which has adverse effects on the survival and development of submerged macrophytes. After the fishery withdrawal in 2018, the fishery resources have been greatly reduced, and only Hypophthalmichthys molitrix and Aristichthys nobilis were stocked, which has little direct impact on submerged macrophytes. The results indicated that in past 40 years, the biodiversity of submerged macrophytes in Bao’an Lake has decreased considerably, and the community structure has tended to be simplified. The succession of submerged macrophytes was mainly regulated by fishing (grazing pressure from Ctenopharyngodon idellus) during 1980s—1990s, while suffered with dual pressure from eutrophication and excessive aquaculture at the beginning of the 21st century. In recent years, eutrophication become the key factor influencing submerged macrophytes community. This research clarified the effects of eutrophication and excessive aquaculture on the succession of submerged macrophytes communities in isolated lakes, and provided theoretical basis for the ecological management for comparable shallow lakes located in the middle and lower reaches of the Yangtze River.
,
Available online
, doi: 10.7541/2023.2022.0490
Abstract:
High-throughput genotyping and phenotyping are the key techniques for efficient and precise breeding. Compared with the development of genotyping technology, the development of high-throughput phenotyping is relatively slower. In breeding of aquatic animals, especially for shrimp, the phenotypic data of the external growth traits are mainly obtained by manual measurement, which needs high labor intensity with low efficiency. In recent years, the rapid development of deep learning has provided technical support for high-throughput phenotyping. In order to improve the efficiency of obtaining phenotypic data of external growth traits of shrimp, we applied a Faster R-CNN (Faster Region-convolutional neural networks) model based on Region Proposal Networks (RPN) to automatically identify the body length of shrimp in this study. Based on the training to 8400shrimp photos, the model could rapidly identify and output location information of shrimp, and the total lengths of shrimp were accurately measured. For the shrimp photos taken in vertical view, the length of the recognition frame was highly correlated with the manually measured full length of the shrimp. For the photos taken in side view, some individuals of shrimp were in bent shape which will affect the correlations. We found that the ratio of the diagonal length of the recognition frame to the length (K value) could represent the degree of bending of the shrimp. Further analysis illustrated that the shrimp is straight in the picture and the length of the recognition frame is highly correlated with the full length of the shrimp when the K is less than 1.04. However, most of the shrimp in the photo is bent, and the diagonal length of the recognition frame is highly correlated with the full length of the shrimp, when the K is greater than 1.04. Consequently, we established a high-throughput technique to determine the full-length of shrimp. The establishment of this technique can save time in comparison to manual measurements on the shrimp phenotype and improve the efficiency of genomic selection breeding of shrimp. In addition, the establishment of this model also provides a new idea for the determination on the other external phenotypic data of shrimp, such as cephalothorax length and body segment lengths in shrimp, and lays an important foundation for the establishment of phenomics data in shrimp.
High-throughput genotyping and phenotyping are the key techniques for efficient and precise breeding. Compared with the development of genotyping technology, the development of high-throughput phenotyping is relatively slower. In breeding of aquatic animals, especially for shrimp, the phenotypic data of the external growth traits are mainly obtained by manual measurement, which needs high labor intensity with low efficiency. In recent years, the rapid development of deep learning has provided technical support for high-throughput phenotyping. In order to improve the efficiency of obtaining phenotypic data of external growth traits of shrimp, we applied a Faster R-CNN (Faster Region-convolutional neural networks) model based on Region Proposal Networks (RPN) to automatically identify the body length of shrimp in this study. Based on the training to 8400shrimp photos, the model could rapidly identify and output location information of shrimp, and the total lengths of shrimp were accurately measured. For the shrimp photos taken in vertical view, the length of the recognition frame was highly correlated with the manually measured full length of the shrimp. For the photos taken in side view, some individuals of shrimp were in bent shape which will affect the correlations. We found that the ratio of the diagonal length of the recognition frame to the length (K value) could represent the degree of bending of the shrimp. Further analysis illustrated that the shrimp is straight in the picture and the length of the recognition frame is highly correlated with the full length of the shrimp when the K is less than 1.04. However, most of the shrimp in the photo is bent, and the diagonal length of the recognition frame is highly correlated with the full length of the shrimp, when the K is greater than 1.04. Consequently, we established a high-throughput technique to determine the full-length of shrimp. The establishment of this technique can save time in comparison to manual measurements on the shrimp phenotype and improve the efficiency of genomic selection breeding of shrimp. In addition, the establishment of this model also provides a new idea for the determination on the other external phenotypic data of shrimp, such as cephalothorax length and body segment lengths in shrimp, and lays an important foundation for the establishment of phenomics data in shrimp.
,
Available online
, doi: 10.7541/2023.2022.0458
Abstract:
To elucidate the effects of rapeseed meal replacing fish meal on growth performance, feed utilization, digestive activity and antioxidant capacity of juvenile Procambarus clarkii, five isonitrogenous and isocaloric diets were formulated to feed juvenile Procambarus clarkii with the average initial body weight of (2.49±0.01) g 42d. The inclusion levels of rapeseed meal were 0, 21.25%, 42.50%, 63.75% and 85% by using rapeseed meal instead of fish meal in different proportions [0 (R0), 25% (R25), 50% (R0), 75% (R0) and 100% (R0)], respectively. The results showed that: (1) no significant differences in FBW, SGR, FE, and PER were observed among the R0, R25 and R50 groups (P>0.05), however, FBW, SGR, FE, and PER in R75 and R100 groups were significantly lower than those in R0 group (P<0.05). Compared with the R0 group, the crude protein and crude lipid contents of juvenile Procambarus clarkii in the R50, R75 and R100 groups were significantly reduced (P<0.05). The activities of hepatopancreatic trypsin, hepatopancreatic lipase and intestinal trypsin of juvenile Procambarus clarkii in the R75 and R100 groups were significantly lower than those in the R0 group (P<0.05), while there was no significant difference in amylase activity among all the groups (P>0.05). NPY and TRY genes expressions levels in hepatopancreas and intestine of R75 and R100 groups significantly decreased than those of R0 group (P<0.05), while MSNP gene expression level significantly increased (P<0.05). (2) Hepatopancreatic alkaline phosphatase (AKP), alanine aminotransferase (GPT), and aspartate aminotransferase (GOT) activities in the R100 group significantly increased compared with the R0 group (P<0.05). With the increase of rapeseed meal level, the activities of catalase (CAT), superoxide dismutase (SOD), glutathione peroxidase (GPX) and glutathione S-transferase (GST) in hepatopancreas showed a decreasing tendency, which in the R75 and R100 groups were significantly lower than those in the R0 group (P<0.05). The expression levels of AKP gene in hepatopancreas and intestine of the R50, R75 and R100 groups significantly increased compared with the R0 group (P<0.05), while the expression levels of CAT, SOD and GPX genes significantly decreased (P<0.05). (3) The structures of hepatopancreas and intestine in the R25 group were not significantly different from those in the R0 group. With the increase of replacement ratio, the vacuolation of hepatopancreas epithelial cells in the juvenile Procambarus clarkii gradually increased, R cells atrophy by degrees, and the hepatopancreas tubules lumens were misshapened and had become enlarged. The intestinal cells fall off and the intestinal villi become significantly shorter. In summary, the appropriate content of rapeseed meal in the feed for juvenile Procambarus clarkii should not be more than 21.25%.
To elucidate the effects of rapeseed meal replacing fish meal on growth performance, feed utilization, digestive activity and antioxidant capacity of juvenile Procambarus clarkii, five isonitrogenous and isocaloric diets were formulated to feed juvenile Procambarus clarkii with the average initial body weight of (2.49±0.01) g 42d. The inclusion levels of rapeseed meal were 0, 21.25%, 42.50%, 63.75% and 85% by using rapeseed meal instead of fish meal in different proportions [0 (R0), 25% (R25), 50% (R0), 75% (R0) and 100% (R0)], respectively. The results showed that: (1) no significant differences in FBW, SGR, FE, and PER were observed among the R0, R25 and R50 groups (P>0.05), however, FBW, SGR, FE, and PER in R75 and R100 groups were significantly lower than those in R0 group (P<0.05). Compared with the R0 group, the crude protein and crude lipid contents of juvenile Procambarus clarkii in the R50, R75 and R100 groups were significantly reduced (P<0.05). The activities of hepatopancreatic trypsin, hepatopancreatic lipase and intestinal trypsin of juvenile Procambarus clarkii in the R75 and R100 groups were significantly lower than those in the R0 group (P<0.05), while there was no significant difference in amylase activity among all the groups (P>0.05). NPY and TRY genes expressions levels in hepatopancreas and intestine of R75 and R100 groups significantly decreased than those of R0 group (P<0.05), while MSNP gene expression level significantly increased (P<0.05). (2) Hepatopancreatic alkaline phosphatase (AKP), alanine aminotransferase (GPT), and aspartate aminotransferase (GOT) activities in the R100 group significantly increased compared with the R0 group (P<0.05). With the increase of rapeseed meal level, the activities of catalase (CAT), superoxide dismutase (SOD), glutathione peroxidase (GPX) and glutathione S-transferase (GST) in hepatopancreas showed a decreasing tendency, which in the R75 and R100 groups were significantly lower than those in the R0 group (P<0.05). The expression levels of AKP gene in hepatopancreas and intestine of the R50, R75 and R100 groups significantly increased compared with the R0 group (P<0.05), while the expression levels of CAT, SOD and GPX genes significantly decreased (P<0.05). (3) The structures of hepatopancreas and intestine in the R25 group were not significantly different from those in the R0 group. With the increase of replacement ratio, the vacuolation of hepatopancreas epithelial cells in the juvenile Procambarus clarkii gradually increased, R cells atrophy by degrees, and the hepatopancreas tubules lumens were misshapened and had become enlarged. The intestinal cells fall off and the intestinal villi become significantly shorter. In summary, the appropriate content of rapeseed meal in the feed for juvenile Procambarus clarkii should not be more than 21.25%.
,
Available online
, doi: 10.7541/2023.2022.0423
Abstract:
Trichodinids (Mobilida: Trichodinidae), best known as ectoparasites of fishes and mollusks in the aquaculture, are diverse and widely distributed mobilid ciliates. So far, approximately 400species representing 10 genera have been described around the world. Among them, Trichodinella species is almost one of the smallest groups in the family Trichodinidae. Trichodinella myakkae (Mueller, 1937) Šrámek-Hušek, 1953, regarded as the representative of Trichodinella species, was often found to infect different freshwater fishes and sometimes caused economic losses when those fish fingerlings or fries were heavily infested in the aquaculture. Currently, most studies about trichodinds were focused on the species description and identification, geographic distribution, histopathology, biodiversity, and molecular phylogeny. However, the morphology study has become the solid foundation to hold up the above related studies on trichodinids. In terms of morphological taxonomy, the adhesive disc is regarded as the most important structure for trichodinids. Therefore, based on the characteristics quantization of adhesive disc, intraspecific study of Trichodinella myakkae isolated from three different hosts (Hypophthalmichthys molitrix, Aristichthys nobilis and Pseudorasbora parva) were firstly carried out by using morphological and statistical ways in the present work. The research results showed that three populations of Trichodinella myakkae (from Hypophthalmichthys molitrix, Aristichthys nobilis and Pseudorasbora parva, respectively), the P values were 0.136 (P>0.05) for diameter of body diameter, 0.009 (P<0.01) for diameter of adhesive disc, 0.000 (P<0.01) for diameter of denticular ring and 0.000 (P<0.01) for denticle span, respectively. Meanwhile, the P value of ratio of denticular ring to body diameter was 0.000 (P<0.01). In addition, the result of correlation analysis displayed that the significant positive correlation (P<0.01) existed between the diameter of body and adhesive disc, denticular ring diameter and denticle span, and no significant correlation (P>0.05) existed between width of border membrane and the other structures in the adhesive disc. All the above results indicated that significant differences existed in diameters of adhesive disc and denticular ring, denticle span, and the ratio of diameter of denticular ring to body diameter except the body diameter for the three populations. And among them, the population of Hypophthalmichthys molitrix was the largest population. The correlation analysis indicated that body diameter was primarily affected by adhesive disc, and vice versa. The diameter of denticular ring was primarily affected by denticle span, and vice versa. The denticle number was primarily affected by the diameter of adhesive disc. The width of border membrane wasn’t affected by the related structures in the adhesive disc. In conclusion, it was indicated that the significantly differential adhesive disc structures above could be used for the species identification in the taxonomy of trichodinds based on the present research results.
Trichodinids (Mobilida: Trichodinidae), best known as ectoparasites of fishes and mollusks in the aquaculture, are diverse and widely distributed mobilid ciliates. So far, approximately 400species representing 10 genera have been described around the world. Among them, Trichodinella species is almost one of the smallest groups in the family Trichodinidae. Trichodinella myakkae (Mueller, 1937) Šrámek-Hušek, 1953, regarded as the representative of Trichodinella species, was often found to infect different freshwater fishes and sometimes caused economic losses when those fish fingerlings or fries were heavily infested in the aquaculture. Currently, most studies about trichodinds were focused on the species description and identification, geographic distribution, histopathology, biodiversity, and molecular phylogeny. However, the morphology study has become the solid foundation to hold up the above related studies on trichodinids. In terms of morphological taxonomy, the adhesive disc is regarded as the most important structure for trichodinids. Therefore, based on the characteristics quantization of adhesive disc, intraspecific study of Trichodinella myakkae isolated from three different hosts (Hypophthalmichthys molitrix, Aristichthys nobilis and Pseudorasbora parva) were firstly carried out by using morphological and statistical ways in the present work. The research results showed that three populations of Trichodinella myakkae (from Hypophthalmichthys molitrix, Aristichthys nobilis and Pseudorasbora parva, respectively), the P values were 0.136 (P>0.05) for diameter of body diameter, 0.009 (P<0.01) for diameter of adhesive disc, 0.000 (P<0.01) for diameter of denticular ring and 0.000 (P<0.01) for denticle span, respectively. Meanwhile, the P value of ratio of denticular ring to body diameter was 0.000 (P<0.01). In addition, the result of correlation analysis displayed that the significant positive correlation (P<0.01) existed between the diameter of body and adhesive disc, denticular ring diameter and denticle span, and no significant correlation (P>0.05) existed between width of border membrane and the other structures in the adhesive disc. All the above results indicated that significant differences existed in diameters of adhesive disc and denticular ring, denticle span, and the ratio of diameter of denticular ring to body diameter except the body diameter for the three populations. And among them, the population of Hypophthalmichthys molitrix was the largest population. The correlation analysis indicated that body diameter was primarily affected by adhesive disc, and vice versa. The diameter of denticular ring was primarily affected by denticle span, and vice versa. The denticle number was primarily affected by the diameter of adhesive disc. The width of border membrane wasn’t affected by the related structures in the adhesive disc. In conclusion, it was indicated that the significantly differential adhesive disc structures above could be used for the species identification in the taxonomy of trichodinds based on the present research results.
ESTABLISHMENT OF QPCR DETECTION ASSAY AND PHYLOGENETIC ANALYSIS BASED ON NOCARDIA SERIOLAE SECA GENE
,
Available online
, doi: 10.7541/2023.2022.0380
Abstract:
Nocardia seriolae is one of the most common pathogenic bacteria in aquaculture animals, and the nocardiosis caused by it has brought huge economic losses to the global aquaculture industry. In order to perform diagnosis of N. seriolae infection quickly and early, a TaqMan qPCR detection method for N. seriolae was established. The Primers and probes were designed with the housekeeping gene SecA of N. seriolae, and the reaction conditions were optimized, and standard curves was developed. Then the established qPCR method was tested for sensitivity, reproducibility and specificity, and applied for the detection of clinical diseased fish samples. The assay of qPCR showed high linearity in the range of 9.85×1010—9.85×100 copies with a sensitivity of up to 9.85 copies under the optimal primers concentration (0.3 μmol/L), the optimal probe concentration (0.1 μmol/L), and the optimal annealing extension temperature 60℃. The results of the repeatability experiment show that the coefficient of variation between groups and within groups is less than 1%. The specificity showed that there was no amplification curve for 13 pathogens such as S. agalactiae, C. freundii and A. veronii. The test results of the 42 diseased M. salmoides samples showed that the positive rate of qPCR was 14.24% higher than that of normal PCR, and the content of nocardia in the nodules was significantly higher than that in the non-nodal site of tissues, with a maximum difference of 1000-fold. The results of SecA gene analysis show that SecA gene is highly conserved in passage and within species, and has certain discreteness among species, so it is a good target gene for Nocardia species identification. The qPCR method established in this study has high sensitivity, strong specificity and good repeatability, and can be used in early diagnosis and quantitative detection of N. seriolae, and provides an effective tool for early diagnosis and treatment of nocardiosis.
Nocardia seriolae is one of the most common pathogenic bacteria in aquaculture animals, and the nocardiosis caused by it has brought huge economic losses to the global aquaculture industry. In order to perform diagnosis of N. seriolae infection quickly and early, a TaqMan qPCR detection method for N. seriolae was established. The Primers and probes were designed with the housekeeping gene SecA of N. seriolae, and the reaction conditions were optimized, and standard curves was developed. Then the established qPCR method was tested for sensitivity, reproducibility and specificity, and applied for the detection of clinical diseased fish samples. The assay of qPCR showed high linearity in the range of 9.85×1010—9.85×100 copies with a sensitivity of up to 9.85 copies under the optimal primers concentration (0.3 μmol/L), the optimal probe concentration (0.1 μmol/L), and the optimal annealing extension temperature 60℃. The results of the repeatability experiment show that the coefficient of variation between groups and within groups is less than 1%. The specificity showed that there was no amplification curve for 13 pathogens such as S. agalactiae, C. freundii and A. veronii. The test results of the 42 diseased M. salmoides samples showed that the positive rate of qPCR was 14.24% higher than that of normal PCR, and the content of nocardia in the nodules was significantly higher than that in the non-nodal site of tissues, with a maximum difference of 1000-fold. The results of SecA gene analysis show that SecA gene is highly conserved in passage and within species, and has certain discreteness among species, so it is a good target gene for Nocardia species identification. The qPCR method established in this study has high sensitivity, strong specificity and good repeatability, and can be used in early diagnosis and quantitative detection of N. seriolae, and provides an effective tool for early diagnosis and treatment of nocardiosis.
,
Available online
, doi: 10.7541/2023.2022.0370
Abstract:
In order to examine the composition, structure and diversity of fish assemblages in Xiliang Lake after fishing ban and identify key environmental factors affecting fish diversity, the investigation of fish assemblages and environmental factors was conducted in Xiliang Lake in November 2020 and April 2021, with 15sample sites distributed in West-Xiliang Lake (XLH1-8) and East-Xiliang Lake (XLH9-15). The results showed that autumn was positively correlated with total nitrogen, chlorophyll a and chemical oxygen demand index, and West-Xiliang Lake was positively correlated with total phosphorus and turbidity. The results showed that a total of 31 fish species were collected belonging to 6 orders, 8 families, and 26 generas, among which the Cypriniformes (24species) accounted for 77.4%. Toxabramis swinhonis, Hemiculter leucisculus, Carassius auratus, and Cultrichthys erythropterus were the dominant species, and Toxabramis swinhonis was the most dominant species. The results of Nonmetric Multidimensional Scaling indicated the significant seasonal and spatial differences in fish community structure in Xiliang Lake (P<0.05). Shannon-Wiener index, Simpson index and Pielou index of East-Xiliang Lake were significantly higher than that in West-Xiliang Lake in autumn (P<0.05), and Margalef index was significantly higher than that in West-Xiliang Lake (P<0.05); Functional richness index of East-Xiliang Lake was significantly higher than that in West-Xiliang Lake in autumn (P<0.05), and functional dispersion index was significantly higher than that in West-Xiliang Lake (P<0.05). Pearson correlation analysis exhibited that Shannon-Wiener index, Simpson index, Pielou index and Margalef index were significantly and positively correlated with functional richness index (r=0.66, r=0.61, r=0.50, r=0.83) and functional dispersion index (r=0.93, r=0.89, r=0.89, r=0.70) (P<0.05). This result indicated that higher taxonomical diversity may contribute more functional space in fish assemblages. The results of the Redundancy Analysis indicated that total phosphorus were the key environmental factors driving fish species and functional diversity. This study provides a scientific basis for the recovery of fish resources and ecosystem restoration of lakes in the Yangtze River basin after the fishing ban, and provides a reference for future lake ecological protection policies.
In order to examine the composition, structure and diversity of fish assemblages in Xiliang Lake after fishing ban and identify key environmental factors affecting fish diversity, the investigation of fish assemblages and environmental factors was conducted in Xiliang Lake in November 2020 and April 2021, with 15sample sites distributed in West-Xiliang Lake (XLH1-8) and East-Xiliang Lake (XLH9-15). The results showed that autumn was positively correlated with total nitrogen, chlorophyll a and chemical oxygen demand index, and West-Xiliang Lake was positively correlated with total phosphorus and turbidity. The results showed that a total of 31 fish species were collected belonging to 6 orders, 8 families, and 26 generas, among which the Cypriniformes (24species) accounted for 77.4%. Toxabramis swinhonis, Hemiculter leucisculus, Carassius auratus, and Cultrichthys erythropterus were the dominant species, and Toxabramis swinhonis was the most dominant species. The results of Nonmetric Multidimensional Scaling indicated the significant seasonal and spatial differences in fish community structure in Xiliang Lake (P<0.05). Shannon-Wiener index, Simpson index and Pielou index of East-Xiliang Lake were significantly higher than that in West-Xiliang Lake in autumn (P<0.05), and Margalef index was significantly higher than that in West-Xiliang Lake (P<0.05); Functional richness index of East-Xiliang Lake was significantly higher than that in West-Xiliang Lake in autumn (P<0.05), and functional dispersion index was significantly higher than that in West-Xiliang Lake (P<0.05). Pearson correlation analysis exhibited that Shannon-Wiener index, Simpson index, Pielou index and Margalef index were significantly and positively correlated with functional richness index (r=0.66, r=0.61, r=0.50, r=0.83) and functional dispersion index (r=0.93, r=0.89, r=0.89, r=0.70) (P<0.05). This result indicated that higher taxonomical diversity may contribute more functional space in fish assemblages. The results of the Redundancy Analysis indicated that total phosphorus were the key environmental factors driving fish species and functional diversity. This study provides a scientific basis for the recovery of fish resources and ecosystem restoration of lakes in the Yangtze River basin after the fishing ban, and provides a reference for future lake ecological protection policies.
,
Available online
, doi: 10.7541/2023.2022.0465
Abstract:
Hox genes, as a family of transcription factors, play a central role in the specification of regional identities along the anterior-posterior body axis, skeletal development, and limb morphogenesis in vertebrates. Previous analyses of Hox genes revealed an unexpected diversity in gene number, genomic organization, and expression patterns in different vertebrate groups. However, the Hox genes have not been systematically analyzed in terms of sequence and evolutionary features in turtles. In this study, we for the first time performed Hox gene identification, sequence characterization and evolutionary analyses in turtles with the publicly available chromosomal-level genome sequences and RNA-seq data. We found that the Hox gene clusters in turtles are highly conserved. Turtles possess the same Hox inventory (39 genes, lost HoxC3) as birds, crocodiles, and placental mammals. The HoxB9-HoxB13 intergenic region in soft-shell turtles is about 10 kb shorter than that in hard-shell turtles, which resulted from the deletion of the non-repetitive sequences. There are hard-shell/soft-shell turtle specific nucleotide substitutions, insertions, and deletions located in the coding regions of tens of Hox genes. However, these sequence mutations are not in functional domains, nor do they lead to changes in protein spatial structure. The Hox genes related to thoracic skeletal development have been undergone rapid evolution and positive selection in the ancestor of soft-shell turtles. The Hox gene expression is tissue- and stage- specific, and mainly expressed in the apical ectoderm ridge, carapace ridge and gonad during the embryonic stages in turtles. We speculate that the phenotypic differences between soft-shell and hard-shell turtles might be related to non-coding regulatory elements located in the HoxB9-HoxB13 intergenic region, and the HoxB5 and HoxC6, which are positively selected in the ancestors of soft-shell turtles. This study provides a target for the analyses of multi-omics, gene expression and regulatory mechanism of Hox genes across different embryonic stages in turtles, also provides a reference for further clarifying the evolutionary innovation in turtles.
,
Available online
, doi: 10.7541/2023.2022.0422
Abstract:
In aquaculture, avoiding duplicate individual biomass estimation is an important prerequisite for achieving accurate fish biomass estimation, the key of which is to perform individual fish identification, while few relevant studies have been reported. In this paper, a lightweight convolutional neural network-based identification method for individual fish identity was proposed, which can achieve high accuracy identification of individual Takifugu rubripes without loss. Firstly, SOLOv2 model was used for foreground segmentation, and combined with the characteristics of the body size of Takifugu rubripes, the dataset generation and filtering were completed by the method of calculating the center of mass and Different Hash Algorithms; subsequently, the effectiveness of mainstream deep learning image classification backbone networks and different loss functions in Takifugu rubripes identity recognition are tested separately from multiple dimensions; following that, an optimal combination method for the lossless identification of individual identity of Takifugu rubripes was established based on MobileNet v2 backbone network coupled with Softmax Loss function. The results showed that the accuracy of the proposed method can reach 90.2%, which is better than other related mainstream methods (accuracy 73.6%—89.3%), and related research results will provide technical support for non-destructive identification of individual fish identity and accurate biomass estimation in recirculating water culture.
In aquaculture, avoiding duplicate individual biomass estimation is an important prerequisite for achieving accurate fish biomass estimation, the key of which is to perform individual fish identification, while few relevant studies have been reported. In this paper, a lightweight convolutional neural network-based identification method for individual fish identity was proposed, which can achieve high accuracy identification of individual Takifugu rubripes without loss. Firstly, SOLOv2 model was used for foreground segmentation, and combined with the characteristics of the body size of Takifugu rubripes, the dataset generation and filtering were completed by the method of calculating the center of mass and Different Hash Algorithms; subsequently, the effectiveness of mainstream deep learning image classification backbone networks and different loss functions in Takifugu rubripes identity recognition are tested separately from multiple dimensions; following that, an optimal combination method for the lossless identification of individual identity of Takifugu rubripes was established based on MobileNet v2 backbone network coupled with Softmax Loss function. The results showed that the accuracy of the proposed method can reach 90.2%, which is better than other related mainstream methods (accuracy 73.6%—89.3%), and related research results will provide technical support for non-destructive identification of individual fish identity and accurate biomass estimation in recirculating water culture.
,
Available online
, doi: 10.7541/2023.2022.0488
Abstract:
The current study was aimed to test if step-vacuum coating with fish stearin oil can elevate the water-stability of high-fat feed for largemouth bass. A batch of uncoated pellet was obtained from a commercial extrusion line, based on the current practical feed formulation of largemouth bass. Four groups of high-fat experimental feed were prepared by direct vacuum coating or step-coating with fish stearin oil and winterized fish oil to the uncoated pellet from the same batch, and named as winterized fish oil direct-coating (WOD) group, homogenized fish oils direct-coating (HOD) group, “1/2” fish stearin oil top-dressing (“1/2” SOT) group and “1/3” fish stearin oil top-dressing (“1/3” SOT) group. The parameters on water stability of feed were measured after soaking in water for 10, 20, 40, 60, 90, and 180 min, respectively, under the conditions of water temperature at 26℃ with slight oscillation. The results showed that the loss rates of dry matter (DM), crude protein (CP), and crude fat (CF) of each feed increased gradually with soaking time, and the average loss rates of DM, CP, and CF were 22.34%, 10.26% and 4.60%, respectively, after soaking for 180min. Soaking within 60 min, the WOD group performed the worst, the loss rates of CF and DM were significantly higher than that of other groups, and the “1/2” SOT group performed the best, the loss rates of CF and DM were significantly lower than that of other groups, but no significant difference was found in the loss rate of CP among all groups (P>0.05). After soaking for 90 min, the CF loss of both “1/2” and “1/3” SOT groups were significantly lower than that of WOD and HOD groups, however, no significant difference was found between the two SOT groups. The DM loss of “1/2” SOT group was significantly lower than that of WOD group, but there was no significant difference among WOD, HOD, and “1/3” SOT groups. The loss of CP in WOD group was significantly higher than that of other groups. After soaking for 180 min, the CF loss in “1/2” SOT group was significantly lower than that of other groups, and the loss of DM and CP in WOD group were significantly higher than that of other groups. Based on the comparative analysis furtherly, the results indicated that by increasing the saturation of oil for coating through blending the more saturated fish stearin oil with winterized fish oil, adopting the step-vacuum coating process to top-dress the fish stearin oil to feed pellet, or increasing the proportion of fish stearin oil for top-dressing was helpful to elevate the water stability of high-fat feed for largemouth bass. And each mean could effectively reduce the loss of CF and DM in the feed, but not the loss of CP.
The current study was aimed to test if step-vacuum coating with fish stearin oil can elevate the water-stability of high-fat feed for largemouth bass. A batch of uncoated pellet was obtained from a commercial extrusion line, based on the current practical feed formulation of largemouth bass. Four groups of high-fat experimental feed were prepared by direct vacuum coating or step-coating with fish stearin oil and winterized fish oil to the uncoated pellet from the same batch, and named as winterized fish oil direct-coating (WOD) group, homogenized fish oils direct-coating (HOD) group, “1/2” fish stearin oil top-dressing (“1/2” SOT) group and “1/3” fish stearin oil top-dressing (“1/3” SOT) group. The parameters on water stability of feed were measured after soaking in water for 10, 20, 40, 60, 90, and 180 min, respectively, under the conditions of water temperature at 26℃ with slight oscillation. The results showed that the loss rates of dry matter (DM), crude protein (CP), and crude fat (CF) of each feed increased gradually with soaking time, and the average loss rates of DM, CP, and CF were 22.34%, 10.26% and 4.60%, respectively, after soaking for 180min. Soaking within 60 min, the WOD group performed the worst, the loss rates of CF and DM were significantly higher than that of other groups, and the “1/2” SOT group performed the best, the loss rates of CF and DM were significantly lower than that of other groups, but no significant difference was found in the loss rate of CP among all groups (P>0.05). After soaking for 90 min, the CF loss of both “1/2” and “1/3” SOT groups were significantly lower than that of WOD and HOD groups, however, no significant difference was found between the two SOT groups. The DM loss of “1/2” SOT group was significantly lower than that of WOD group, but there was no significant difference among WOD, HOD, and “1/3” SOT groups. The loss of CP in WOD group was significantly higher than that of other groups. After soaking for 180 min, the CF loss in “1/2” SOT group was significantly lower than that of other groups, and the loss of DM and CP in WOD group were significantly higher than that of other groups. Based on the comparative analysis furtherly, the results indicated that by increasing the saturation of oil for coating through blending the more saturated fish stearin oil with winterized fish oil, adopting the step-vacuum coating process to top-dress the fish stearin oil to feed pellet, or increasing the proportion of fish stearin oil for top-dressing was helpful to elevate the water stability of high-fat feed for largemouth bass. And each mean could effectively reduce the loss of CF and DM in the feed, but not the loss of CP.
,
Available online
, doi: 10.7541/2023.2022.0345
Abstract:
The Yangtze finless porpoise (Neophocaena asiaeorientalis asiaeorientalis; YFP) is now critically endangered, calling for prompt and effective actions to strengthen research and conservation. The Poyang Lake is the most critical habitat of the YFP, holding almost half of the whole wild population of this species. And thus, this population is vital for the conservation of this critically endangered species. In this study, to evaluate the genetic diversity of the porpoise population living in the Poyang Lake and to predict its development in the future, both blood samples from live YFPs (124 individuals) and tissue samples from 42stranded YFPs have been analyzed, using 10 microsatellite genetic markers. Results indicated that the Poyang Lake porpoise population has a moderate level of genetic diversity, with an average allele number of 5.80, an average observed heterozygosity (Ho) of 0.653, and an expected heterozygosity (He) of 0.664. Meanwhile, when samples from stranded porpoises were excluded, the mean number of alleles decreased to 5.50; three unique and rare alleles at three microsatellite loci were found exclusively among stranded porpoises, indicating that abnormal deaths caused by anthropogenic reasons might lead to genetic diversity loss of this population in the Poyang Lake. Besides, the software BottleSim V2.6 was applied to simulate the developing process of genetic diversity in this population. Simulations results showed that genetic diversity would decline quickly if kept its current effective population size (Ne=62) and sex ratio (0.87﹕1); while an effective population size of more than 200 individuals or a census population size of more than 1000 individuals is necessary, to realize the long-term goal of preserving more than 90% genetic diversity in 100 years. Results obtained in this study are significant for the genetic conservation of the population living in the Poyang Lake, and the whole species as well.
The Yangtze finless porpoise (Neophocaena asiaeorientalis asiaeorientalis; YFP) is now critically endangered, calling for prompt and effective actions to strengthen research and conservation. The Poyang Lake is the most critical habitat of the YFP, holding almost half of the whole wild population of this species. And thus, this population is vital for the conservation of this critically endangered species. In this study, to evaluate the genetic diversity of the porpoise population living in the Poyang Lake and to predict its development in the future, both blood samples from live YFPs (124 individuals) and tissue samples from 42stranded YFPs have been analyzed, using 10 microsatellite genetic markers. Results indicated that the Poyang Lake porpoise population has a moderate level of genetic diversity, with an average allele number of 5.80, an average observed heterozygosity (Ho) of 0.653, and an expected heterozygosity (He) of 0.664. Meanwhile, when samples from stranded porpoises were excluded, the mean number of alleles decreased to 5.50; three unique and rare alleles at three microsatellite loci were found exclusively among stranded porpoises, indicating that abnormal deaths caused by anthropogenic reasons might lead to genetic diversity loss of this population in the Poyang Lake. Besides, the software BottleSim V2.6 was applied to simulate the developing process of genetic diversity in this population. Simulations results showed that genetic diversity would decline quickly if kept its current effective population size (Ne=62) and sex ratio (0.87﹕1); while an effective population size of more than 200 individuals or a census population size of more than 1000 individuals is necessary, to realize the long-term goal of preserving more than 90% genetic diversity in 100 years. Results obtained in this study are significant for the genetic conservation of the population living in the Poyang Lake, and the whole species as well.
,
Available online
, doi: 10.7541/2023.2022.0344
Abstract:
In order to provide the basis data for further study of carbon and nitrogen utilization in integrated culture pond ecosystem, the growth characteristics, morphology and body composition changes of Hongkong oysters during off-site fattening were study. Hongkong oysters Crassostrea hongkongensis (2-year-old) with an initial weight of 68.00 g were obtained from Maowei Sea, Qinzhou, Guangxi, and were fattened on floating rafts for 44 days in a fish-shrimp polyculture pond in Huguang Town, Zhanjiang. The oyster samples were collected during fattening regularly, and the morphological indicators, growth indicators, gross composition of soft tissue, carbon and nitrogen stable isotope values (δ13C and δ15N) of oyster samples were determined, and the correlation of these indicators were analyzed. The results showed that, after 44 days of fattening, the shell height, soft tissue quality, meat yield and fat content of 2-year-old oysters were significantly increased (P<0.05), the protein and ash contents were significantly decreased (P<0.05), while the shell length, shell width, body mass and moisture content did no showed significant difference (P>0.05). The δ15N, δ13C of the soft tissue and shell δ13C values of oysters all decreased significantly (P<0.05), and the δ15N and δ13C values of the soft tissue were significantly different from the initial samples after 16 days of fattening (P<0.05), which indicating that oysters could quickly utilize the abundant food sources of fattening pond, and obtained rapid grow of soft tissues During the fattening process, the meat yield of oyster was significantly positively correlated with the mass of soft body (P<0.05), extremely significantly negatively correlated with shell δ13C, δ15N, δ13C, N% and C% of soft body (P<0.01), and had a extremely significant negative correlation with shell length, shell width, shell height and body mass (P<0.01). However, there was no significant correlation between the meat yield of oyster and the shell length, shell width, shell height and body mass (P>0.05). During the fattening process, C% of oyster shell was positively significant correlated with N% and C% of soft body (P<0.05), and extremely significant positive correlated with δ15N of soft body (P<0.01); while C% of soft body tissue was extremely significant negative correlated with meat yield (P<0.01), significantly positive correlated with shell C% and δ13C of soft body (P<0.05), extremely significant positive correlated with the soft body δ15N and the soft body N% (P<0.01). These correlations indicated that monitoring changes in these indicators can better determine whether fattening oysters are adapted to the fattening environment and have access to sufficient food for rapid growth. The rapid growth of oysters during the fattening process resulted in a significant decrease in the carbon content of oysters, which must be taken into account when calculating the carbon sequestration benefits of oysters. In addition, the results of this study show that the ash content and carbon and nitrogen stable isotope characteristics of Hongkong oyster are easily affected by short-term off-site fattening, this influence must be considered when using inorganic elements and stable isotopes traceability technology for geographical origin traceability of Hongkong oyster.
In order to provide the basis data for further study of carbon and nitrogen utilization in integrated culture pond ecosystem, the growth characteristics, morphology and body composition changes of Hongkong oysters during off-site fattening were study. Hongkong oysters Crassostrea hongkongensis (2-year-old) with an initial weight of 68.00 g were obtained from Maowei Sea, Qinzhou, Guangxi, and were fattened on floating rafts for 44 days in a fish-shrimp polyculture pond in Huguang Town, Zhanjiang. The oyster samples were collected during fattening regularly, and the morphological indicators, growth indicators, gross composition of soft tissue, carbon and nitrogen stable isotope values (δ13C and δ15N) of oyster samples were determined, and the correlation of these indicators were analyzed. The results showed that, after 44 days of fattening, the shell height, soft tissue quality, meat yield and fat content of 2-year-old oysters were significantly increased (P<0.05), the protein and ash contents were significantly decreased (P<0.05), while the shell length, shell width, body mass and moisture content did no showed significant difference (P>0.05). The δ15N, δ13C of the soft tissue and shell δ13C values of oysters all decreased significantly (P<0.05), and the δ15N and δ13C values of the soft tissue were significantly different from the initial samples after 16 days of fattening (P<0.05), which indicating that oysters could quickly utilize the abundant food sources of fattening pond, and obtained rapid grow of soft tissues During the fattening process, the meat yield of oyster was significantly positively correlated with the mass of soft body (P<0.05), extremely significantly negatively correlated with shell δ13C, δ15N, δ13C, N% and C% of soft body (P<0.01), and had a extremely significant negative correlation with shell length, shell width, shell height and body mass (P<0.01). However, there was no significant correlation between the meat yield of oyster and the shell length, shell width, shell height and body mass (P>0.05). During the fattening process, C% of oyster shell was positively significant correlated with N% and C% of soft body (P<0.05), and extremely significant positive correlated with δ15N of soft body (P<0.01); while C% of soft body tissue was extremely significant negative correlated with meat yield (P<0.01), significantly positive correlated with shell C% and δ13C of soft body (P<0.05), extremely significant positive correlated with the soft body δ15N and the soft body N% (P<0.01). These correlations indicated that monitoring changes in these indicators can better determine whether fattening oysters are adapted to the fattening environment and have access to sufficient food for rapid growth. The rapid growth of oysters during the fattening process resulted in a significant decrease in the carbon content of oysters, which must be taken into account when calculating the carbon sequestration benefits of oysters. In addition, the results of this study show that the ash content and carbon and nitrogen stable isotope characteristics of Hongkong oyster are easily affected by short-term off-site fattening, this influence must be considered when using inorganic elements and stable isotopes traceability technology for geographical origin traceability of Hongkong oyster.
,
Available online
, doi: 10.7541/2023.2022.0309
Abstract:
Diaptomidae is one of the most common seen freshwater copepod fauna, the taxonomic study of this taxon is the basic information for the theoretical study of systemic zoology. Five species of genus Mongolodiaptomus (Copepoda, Calanoida, Diaptomidae) were reported in China before. This research reported a new species of Mongolodiaptomus from Hainan Island, which is the first record of Mongolodiaptomus mekongensis Sanoamuang & Watiroyram, 2018 in China. Through scanning electronic and light microscopy, the morphological characteristics are described and illustrated in detail. In addition, 18S rDNA gene sequences were also obtained for the first time to investigate phylogenetic position of this species. Morphological characteristics of female species are described in detail as follows: posterolateral wings of fifth pedigerous segment were asymmetrical and right wing somewhat was larger than left. Left proximal part of genital somite broadly expanded and provided with laterally directed spine; Right proximal region of genital somite produced into posterolaterally directed, triangular process, tipped with variablespine, exceeded the middle of the genital somite. Morphological characteristics of male species are described in detail as follows: Right antennule transformed and geniculated, with 22segments and the antepenultimate with comb-like process; Intercoxal plate of right fifth leg produced into spine-like lobes on distal margin; The principal lateral spine on second exopodite of right fifth leg is obviously bent; The right caudal ramus has two ventral chitinous prominences, one strong spiniform process on prominence proximally and one semi-circular ridges located at the end. The molecular phylogenetic analysis showed that M. mekongensis is closed related with the genus Eudiaptomus and Neodiaptomus. This study provides detailed morphological characteristics and molecular data for M. mekongensis, laying the foundation for future research on this species and genus Mongolodiaptomus.
Diaptomidae is one of the most common seen freshwater copepod fauna, the taxonomic study of this taxon is the basic information for the theoretical study of systemic zoology. Five species of genus Mongolodiaptomus (Copepoda, Calanoida, Diaptomidae) were reported in China before. This research reported a new species of Mongolodiaptomus from Hainan Island, which is the first record of Mongolodiaptomus mekongensis Sanoamuang & Watiroyram, 2018 in China. Through scanning electronic and light microscopy, the morphological characteristics are described and illustrated in detail. In addition, 18S rDNA gene sequences were also obtained for the first time to investigate phylogenetic position of this species. Morphological characteristics of female species are described in detail as follows: posterolateral wings of fifth pedigerous segment were asymmetrical and right wing somewhat was larger than left. Left proximal part of genital somite broadly expanded and provided with laterally directed spine; Right proximal region of genital somite produced into posterolaterally directed, triangular process, tipped with variablespine, exceeded the middle of the genital somite. Morphological characteristics of male species are described in detail as follows: Right antennule transformed and geniculated, with 22segments and the antepenultimate with comb-like process; Intercoxal plate of right fifth leg produced into spine-like lobes on distal margin; The principal lateral spine on second exopodite of right fifth leg is obviously bent; The right caudal ramus has two ventral chitinous prominences, one strong spiniform process on prominence proximally and one semi-circular ridges located at the end. The molecular phylogenetic analysis showed that M. mekongensis is closed related with the genus Eudiaptomus and Neodiaptomus. This study provides detailed morphological characteristics and molecular data for M. mekongensis, laying the foundation for future research on this species and genus Mongolodiaptomus.
,
Available online
, doi: 10.7541/2023.2022.0214
Abstract:
In order to explore the community characteristics of culturable filamentous fungi in Nam Co Lake in spring, the composition and abundance of filamentous fungi were determined based on the isolation and purification of filamentous fungi, combined with morphological characterization and ITS sequence analysis. At the same time, water environmental factors were determined to analyze correlations between ecological differentiation of dominant species of filamentous fungi and environmental factors in Nam Co Lake. The results showed that a total of 921 filamentous fungi strains were isolated from Nam Co Lake. These strains were identified as 62 species in 20 genera. Fungus resources are abundant, among which, the dominant species (Y>0.02) include: Penicillium commune, Penicillium vinaceum, Penicillium polonicum, Penicillium goetzii, Penicillium griseoroseum, Mucor hiemalis, Mucor racemosus, Pleosporales sp.2 and Penicillium crustosum. The niche indices of the dominant species showed that the sum of ecological response rates of dominant species is negative, and low overlap species accounted for a large proportion (56.94%). Overall, there was a positive correlation among the dominant species, but it did not reach a significant level (χ2>3.841), indicating that the community was in a stage of decline. With weak competition and loose relationships and great differences in resource utilization or ecological adaptability among dominant species. Moreover, the dominant species have not reached a relative dynamic balance, and their succession has not reached the top stage. The correlation between environmental factors and dominant species showed that salinity, conductivity, chemical oxygen demand, turbidity and ammonium nitrogen are the main factors affecting the distribution of dominant species of filamentous fungi in Nam Co Lake. These studies provided basic data for correctly understanding the population characteristics of culturable filamentous fungi in plateau lakes and laid a foundation for the development and utilization of culturable filamentous fungi.
In order to explore the community characteristics of culturable filamentous fungi in Nam Co Lake in spring, the composition and abundance of filamentous fungi were determined based on the isolation and purification of filamentous fungi, combined with morphological characterization and ITS sequence analysis. At the same time, water environmental factors were determined to analyze correlations between ecological differentiation of dominant species of filamentous fungi and environmental factors in Nam Co Lake. The results showed that a total of 921 filamentous fungi strains were isolated from Nam Co Lake. These strains were identified as 62 species in 20 genera. Fungus resources are abundant, among which, the dominant species (Y>0.02) include: Penicillium commune, Penicillium vinaceum, Penicillium polonicum, Penicillium goetzii, Penicillium griseoroseum, Mucor hiemalis, Mucor racemosus, Pleosporales sp.2 and Penicillium crustosum. The niche indices of the dominant species showed that the sum of ecological response rates of dominant species is negative, and low overlap species accounted for a large proportion (56.94%). Overall, there was a positive correlation among the dominant species, but it did not reach a significant level (χ2>3.841), indicating that the community was in a stage of decline. With weak competition and loose relationships and great differences in resource utilization or ecological adaptability among dominant species. Moreover, the dominant species have not reached a relative dynamic balance, and their succession has not reached the top stage. The correlation between environmental factors and dominant species showed that salinity, conductivity, chemical oxygen demand, turbidity and ammonium nitrogen are the main factors affecting the distribution of dominant species of filamentous fungi in Nam Co Lake. These studies provided basic data for correctly understanding the population characteristics of culturable filamentous fungi in plateau lakes and laid a foundation for the development and utilization of culturable filamentous fungi.
,
Available online
, doi: 10.7541/2023.2022.0077
Abstract:
Although dragonfly larvae can be good bioindictors in fresh water environment assessments, their identification based on morphological characteristics is still a tough work, especially at species level. In the present study, 116 larvae of two Chinese widespread damselfly, Ceriagrion fallax Ris and Ceriagrion auranticum Fraser, were identified depending on sequence data of the mitochondrial genes Cytochrome Oxidase I (COI) and nuclear ribosomal genes ITS. The stability of two important morphological characters, caudal gills and mandibles, was discussed. For molecular analysis, LCO1490d (TTTCTACWAACCAYAAAGATATTGG) and HCO2198d (TAAACTTCWGGRTGTCCAAARAATCA) were used as COI primers, and Vrain2F (CTTTGTACACACCGCCCGTCGCT) and Vrain2R (TTTCACTCGCCGTTACTAAGGGAATC) as ITS primers. The reaction systems were 31.0 μL: DNA template 3.0 μL, upstream and downstream primers 2.0 μL each, Mix 15.0 μL (Jiangsu ComWin Biotech Co., Ltd's 2×Es Taq Master Mix), ddH2O 9.0 μL. Take 5.0 μL PCR amplification products and detect them by electrophoresis using 1.5% agarose gel. The amplification products with detected by electrophoresis, and then sent to Chongqing Tsingke Xingye Biotechnology Co to sequence. Neighbor-Joining (NJ) trees and genetic distance method were using for the molecular identification of larvae, with the help of identified adults’ sequences as conference. Relative large size of larval specimens, C. fallax (n=110) and C. auranticum (n=6), were dissected and photographed using LY-WN-OPLENC ultra-clear microphotographic system. Detailed comparative morphological examination was conducted focusing on two typical morphological features, caudal gill and mandibles. Our result showed that: (1) the presence or absence, numbers, and color of the black spots on the caudal gill were unstable, which have nothing to do with populations and sex; (2) characters of mandibles were also variable even within the same population. The discovery of the instability of the two typical diagnostic morphological characters indicates that characters of caudal gills and mandibles, at least, in these two species should be used with caution latterly in taxonomy. Our result also suggests that the similar instability may exist in other diagnostic morphological characteristics in other odonate species. The idea and methodology of this study can be instructive to future morphological studies on insect taxonomy.
Although dragonfly larvae can be good bioindictors in fresh water environment assessments, their identification based on morphological characteristics is still a tough work, especially at species level. In the present study, 116 larvae of two Chinese widespread damselfly, Ceriagrion fallax Ris and Ceriagrion auranticum Fraser, were identified depending on sequence data of the mitochondrial genes Cytochrome Oxidase I (COI) and nuclear ribosomal genes ITS. The stability of two important morphological characters, caudal gills and mandibles, was discussed. For molecular analysis, LCO1490d (TTTCTACWAACCAYAAAGATATTGG) and HCO2198d (TAAACTTCWGGRTGTCCAAARAATCA) were used as COI primers, and Vrain2F (CTTTGTACACACCGCCCGTCGCT) and Vrain2R (TTTCACTCGCCGTTACTAAGGGAATC) as ITS primers. The reaction systems were 31.0 μL: DNA template 3.0 μL, upstream and downstream primers 2.0 μL each, Mix 15.0 μL (Jiangsu ComWin Biotech Co., Ltd's 2×Es Taq Master Mix), ddH2O 9.0 μL. Take 5.0 μL PCR amplification products and detect them by electrophoresis using 1.5% agarose gel. The amplification products with detected by electrophoresis, and then sent to Chongqing Tsingke Xingye Biotechnology Co to sequence. Neighbor-Joining (NJ) trees and genetic distance method were using for the molecular identification of larvae, with the help of identified adults’ sequences as conference. Relative large size of larval specimens, C. fallax (n=110) and C. auranticum (n=6), were dissected and photographed using LY-WN-OPLENC ultra-clear microphotographic system. Detailed comparative morphological examination was conducted focusing on two typical morphological features, caudal gill and mandibles. Our result showed that: (1) the presence or absence, numbers, and color of the black spots on the caudal gill were unstable, which have nothing to do with populations and sex; (2) characters of mandibles were also variable even within the same population. The discovery of the instability of the two typical diagnostic morphological characters indicates that characters of caudal gills and mandibles, at least, in these two species should be used with caution latterly in taxonomy. Our result also suggests that the similar instability may exist in other diagnostic morphological characteristics in other odonate species. The idea and methodology of this study can be instructive to future morphological studies on insect taxonomy.
,
Available online
, doi: 10.7541/2023.2022.0193
Abstract:
The hypoxia and thermal tolerances of fish are important physiological characteristics that determine their distribution, habitat change, and adaptability to climate change. While in the nature, fish are always in the process of swimming or recovery of post-exercise, whether the hypoxia and thermal tolerances change during swimming or immediately after exhaustive recovery process is unknown for fish. Thus, to study the effects of exhaustion exercise stress on fish hypoxia and thermal tolerances, we investigated three cyprinid fish species (i.e. Carassius auratus, Spinibarbus sinensis and Cyprinus carpio) living in different habitats as study cases. Hypoxia and the thermal tolerance indicators of the three fish species were measured after exhaustion exercise, respectively, to determine whether exhaustion exercise stress would affect the stress resistance of fish. In the present study, we found that body weight only affected significantly on minimal critical temperature (CTmin), and the indicators of hypoxia and thermal tolerances were different significantly between species. Moreover, exhaustion exercise stress led to a significant increase in critical oxygen tension (Pcrit) of common carp and a significant increase in critical metabolic rate (CMR) of all the three species as well, but a significant decrease in point of oxygen tension for loss of equilibrium (LOE) of qingbo. Meanwhile, it also resulted in a significant decrease in maximal critical temperature (CTmax) of goldfish and qingbo. However, there was no significant effect on the species and other related measured parameters besides the fish species and their corresponding experimental parameters mentioned above. It could be said based on the results that changes in the hypoxia and thermal tolerances of fish living in different habitats are different after exhaustion exercise stress, and that fish species vary in physiological mechanisms responding to other environmental stressors following exhaustion exercise stress, which may be related to difference in their energy metabolism patterns.
The hypoxia and thermal tolerances of fish are important physiological characteristics that determine their distribution, habitat change, and adaptability to climate change. While in the nature, fish are always in the process of swimming or recovery of post-exercise, whether the hypoxia and thermal tolerances change during swimming or immediately after exhaustive recovery process is unknown for fish. Thus, to study the effects of exhaustion exercise stress on fish hypoxia and thermal tolerances, we investigated three cyprinid fish species (i.e. Carassius auratus, Spinibarbus sinensis and Cyprinus carpio) living in different habitats as study cases. Hypoxia and the thermal tolerance indicators of the three fish species were measured after exhaustion exercise, respectively, to determine whether exhaustion exercise stress would affect the stress resistance of fish. In the present study, we found that body weight only affected significantly on minimal critical temperature (CTmin), and the indicators of hypoxia and thermal tolerances were different significantly between species. Moreover, exhaustion exercise stress led to a significant increase in critical oxygen tension (Pcrit) of common carp and a significant increase in critical metabolic rate (CMR) of all the three species as well, but a significant decrease in point of oxygen tension for loss of equilibrium (LOE) of qingbo. Meanwhile, it also resulted in a significant decrease in maximal critical temperature (CTmax) of goldfish and qingbo. However, there was no significant effect on the species and other related measured parameters besides the fish species and their corresponding experimental parameters mentioned above. It could be said based on the results that changes in the hypoxia and thermal tolerances of fish living in different habitats are different after exhaustion exercise stress, and that fish species vary in physiological mechanisms responding to other environmental stressors following exhaustion exercise stress, which may be related to difference in their energy metabolism patterns.
,
Available online
, doi: 10.7541/2022.2021.033
Abstract:
Changfeng silver carp (Hypophthalmichthys molitrix) (CF) is a new variety obtained by artificially selective breeding in China. Genetic monitoring the germplasm resources of Changfeng silver carp play an important role in maintaining its excellent traits. 18 microsatellite markers were used to analyze the genetic diversity and genetic structure in Changfeng silver carp (CF) populations. The results showed that the genetic diversity of silver carp (L) was higher than that of CF. The average number of alleles (Na) from CF1 to CF3 of CF offspring decreased from 5.7222 to 5.0556, and the average effective allele (Ne) were from 3.2551 to 3.1461. The average observed heterozygosity (Ho), the average expected heterozygosity (He), and the polymorphic information content (PIC) ranged from 0.6975 to 0.5407, 0.6422 to 0.6235, and 0.5784 to 0.5609, respectively. The Fst among the progeny of L and CF ranged from 0.0160 to 0.0315, indicating that the population of L has been genetically differentiated with low degree of differentiation. These results showed that the genetic structure of CF1 to CF3 exhibit slightly declining genetic diversity after three successive generations, whereas the genetic diversity was still abundant. Our study provides a basis for maintaining the genetic diversity of Changfeng silver carp.
Changfeng silver carp (Hypophthalmichthys molitrix) (CF) is a new variety obtained by artificially selective breeding in China. Genetic monitoring the germplasm resources of Changfeng silver carp play an important role in maintaining its excellent traits. 18 microsatellite markers were used to analyze the genetic diversity and genetic structure in Changfeng silver carp (CF) populations. The results showed that the genetic diversity of silver carp (L) was higher than that of CF. The average number of alleles (Na) from CF1 to CF3 of CF offspring decreased from 5.7222 to 5.0556, and the average effective allele (Ne) were from 3.2551 to 3.1461. The average observed heterozygosity (Ho), the average expected heterozygosity (He), and the polymorphic information content (PIC) ranged from 0.6975 to 0.5407, 0.6422 to 0.6235, and 0.5784 to 0.5609, respectively. The Fst among the progeny of L and CF ranged from 0.0160 to 0.0315, indicating that the population of L has been genetically differentiated with low degree of differentiation. These results showed that the genetic structure of CF1 to CF3 exhibit slightly declining genetic diversity after three successive generations, whereas the genetic diversity was still abundant. Our study provides a basis for maintaining the genetic diversity of Changfeng silver carp.
Display Method: |
2023, 47(6): 859 -865
doi: 10.7541/2023.2022.0179
Abstract:
VP39 is a protein encoded by S9 gene of type Ⅲ grass carp reovirus (GCRV-Ⅲ). In order to study the biological function of VP39 protein in the process of GCRV infection of grass carp cells, the sequence of VP39 gene was cloned and the prokaryotic expression vector PET32A-VP39 was constructed. The fusion protein VP39-HIS was obtained by using prokaryotic expression method. Mouse anti-VP39 polyclonal antibody was prepared by immunizing mice with VP39 solution protein, and the antibody was evaluated by Western Blot. The polyclonal antibody was used to investigate the expression dynamics of VP39 protein in GCRV infected cells. The results of SDS-PAGE showed that the fusion protein of vp39-his was well soluble in PBS and the protein size was about 39 kDa. Western Blot analysis showed that the prepared VP39 polyclonal antibody could recognize both the prokaryotic expression of VP39-HIS fusion protein and the expression of VP39 protein after GCRV infection with CIK cells at the dilution ratio of 1﹕10000, showing good titer and specificity. In the process of virus infection, the expression of VP39 was low in the early stage and high in the middle and late stage. Two peptides were screened by phage display technology for specific binding to VP39 protein, and further bioinformatics analysis also found that 7 genes in grass carp genome had homology with the peptide, indicating that these genes may interact with VP39. In this study, mouse anti-VP39 polyclonal antibody was prepared, which provided a new immunological method for GCRV-Ⅲ detection. The screening of binding peptides also laid a foundation for the study of the biological function of VP39 in the process of GCRV infection.
VP39 is a protein encoded by S9 gene of type Ⅲ grass carp reovirus (GCRV-Ⅲ). In order to study the biological function of VP39 protein in the process of GCRV infection of grass carp cells, the sequence of VP39 gene was cloned and the prokaryotic expression vector PET32A-VP39 was constructed. The fusion protein VP39-HIS was obtained by using prokaryotic expression method. Mouse anti-VP39 polyclonal antibody was prepared by immunizing mice with VP39 solution protein, and the antibody was evaluated by Western Blot. The polyclonal antibody was used to investigate the expression dynamics of VP39 protein in GCRV infected cells. The results of SDS-PAGE showed that the fusion protein of vp39-his was well soluble in PBS and the protein size was about 39 kDa. Western Blot analysis showed that the prepared VP39 polyclonal antibody could recognize both the prokaryotic expression of VP39-HIS fusion protein and the expression of VP39 protein after GCRV infection with CIK cells at the dilution ratio of 1﹕10000, showing good titer and specificity. In the process of virus infection, the expression of VP39 was low in the early stage and high in the middle and late stage. Two peptides were screened by phage display technology for specific binding to VP39 protein, and further bioinformatics analysis also found that 7 genes in grass carp genome had homology with the peptide, indicating that these genes may interact with VP39. In this study, mouse anti-VP39 polyclonal antibody was prepared, which provided a new immunological method for GCRV-Ⅲ detection. The screening of binding peptides also laid a foundation for the study of the biological function of VP39 in the process of GCRV infection.
2023, 47(6): 866 -873
doi: 10.7541/2023.2022.0226
Abstract:
Cyprinus carpio and Cyprinus carpio kio are important aquaculture varieties in China. Highly pathogenic and infectious of Cyprinid herpesvirus 3 (CyHV-3, KHV) has caused great losses in the culture of Cyprinus carpio and Cyprinus carpio kio. Therefore, the rapid and convenient detection technology is desperately needed to be used for non-laboratory and fast detection. Recombinase polymerase amplification (RPA) is such an Isothermal amplification technology which can amplify DNA within 30min under low reaction temperature. Then we combined RPA with lateral flow dipstick (LFD) and established a rapid and sensitive method which are suitable for field clinical detection of KHV. In this study, primers and probe sequences were designed according to the conserved fragment of SphI-5 gene of KHV. The experimental results show that the RPA technique can detect target fragment by agarose gel electrophoresis within 30min at the optimal temperature of 38℃ and the RPA results can be visualized in only 5min in combination with the LFD and the entire RPA-LFD assay takes 50min which are a lot faster than PCR method. The method established in this experiment for the detection of KHV by RPA-LFD is so simple and sensitivity that can be useful for rapid diagnosis in aquaculture with limited resources.
Cyprinus carpio and Cyprinus carpio kio are important aquaculture varieties in China. Highly pathogenic and infectious of Cyprinid herpesvirus 3 (CyHV-3, KHV) has caused great losses in the culture of Cyprinus carpio and Cyprinus carpio kio. Therefore, the rapid and convenient detection technology is desperately needed to be used for non-laboratory and fast detection. Recombinase polymerase amplification (RPA) is such an Isothermal amplification technology which can amplify DNA within 30min under low reaction temperature. Then we combined RPA with lateral flow dipstick (LFD) and established a rapid and sensitive method which are suitable for field clinical detection of KHV. In this study, primers and probe sequences were designed according to the conserved fragment of SphI-5 gene of KHV. The experimental results show that the RPA technique can detect target fragment by agarose gel electrophoresis within 30min at the optimal temperature of 38℃ and the RPA results can be visualized in only 5min in combination with the LFD and the entire RPA-LFD assay takes 50min which are a lot faster than PCR method. The method established in this experiment for the detection of KHV by RPA-LFD is so simple and sensitivity that can be useful for rapid diagnosis in aquaculture with limited resources.
2023, 47(6): 874 -882
doi: 10.7541/2023.2022.0395
Abstract:
Intelectin is a novel glycan-binding lectin in the innate immune response of fish, which can bind bacterial surface carbohydrates to agglutinate bacteria. To study the role of intelectin in the innate immunity of Onychostoma macrolepis during bacterial infection, the Onychostoma macrolepis intelectin (OmITLN) was identified in liver transcriptome database and cloned. RT-qPCR was used to analyze the expression of OmITLN in different tissues and after Aeromonas hydrophila infection. OmITLN recombinant protein was successfully obtained by prokaryotic expression and the binding ability of OmITLN to different bacteria was detected by ELISA and fluorescent labeling. The result showed that the sequence was 960 bp in full length, containing 945 bp open reading frame and encoding 315 amino acids. Protein functional domain analysis showed that OmITLN encoded an N-terminal fibrinogen associated domain (FReD) and a C-terminal Intelectin-specific domain. The homology comparison and the phylogenetic tree showed that the OmITLN protein had a higher homology with the other Cyprinidae, such as Ctenopharyngodon idella, Hypophthalmichthys nobilis, Megalobrama amblycephala and Carassius auratus. The qRT-PCR results indicated that OmITLN was expressed in the all examined tissues including liver, muscle, spleen, gonad, intestine, brain and gill in Onychostoma macrolepis, and it was expressed at the highest level in liver and spleen. Compared with the control group, OmITLN was significantly up-regulated and then down-regulated after stimulation with Aeromonas hydrophila. In the liver, the expression of OmITLN reached its maximum at 12 hours post-infection (hpi) and was gradually down-regulated over time. In spleen, OmITLN was reached the highest value at 6hpi and then gradually returned to the initial level after 24hpi. OmITLN recombinant protein was successfully obtained and authenticated by SDS-PAGE and Western Blotting. OmITLN can agglutinated all tested bacteria, including three gram-positive bacteria (Escherichia coli, Vibrio parahaemolyticus and Aeromonas hydrophila) and three gram-negative bacteria (Streptococcus agalactiae, Bacillus cereus and Staphylococcus aureus) with Ca2+. OmITLN showed the best binding activity to D-lactose, followed by xylose, D-galactose and sucrose, with the lowest expression in D-glucose, but showed no binding activity to mycose, D-fructose and D-maltose. The binding activity of OmITLN to PGN which is gram-positive bacteria recognition structure was higher than LPS which is gram-negative bacteria recognition structure. As an important pattern recognition receptor, OmITLN is involved in the immune defense of Onychostoma macrolepis against bacteria.
Intelectin is a novel glycan-binding lectin in the innate immune response of fish, which can bind bacterial surface carbohydrates to agglutinate bacteria. To study the role of intelectin in the innate immunity of Onychostoma macrolepis during bacterial infection, the Onychostoma macrolepis intelectin (OmITLN) was identified in liver transcriptome database and cloned. RT-qPCR was used to analyze the expression of OmITLN in different tissues and after Aeromonas hydrophila infection. OmITLN recombinant protein was successfully obtained by prokaryotic expression and the binding ability of OmITLN to different bacteria was detected by ELISA and fluorescent labeling. The result showed that the sequence was 960 bp in full length, containing 945 bp open reading frame and encoding 315 amino acids. Protein functional domain analysis showed that OmITLN encoded an N-terminal fibrinogen associated domain (FReD) and a C-terminal Intelectin-specific domain. The homology comparison and the phylogenetic tree showed that the OmITLN protein had a higher homology with the other Cyprinidae, such as Ctenopharyngodon idella, Hypophthalmichthys nobilis, Megalobrama amblycephala and Carassius auratus. The qRT-PCR results indicated that OmITLN was expressed in the all examined tissues including liver, muscle, spleen, gonad, intestine, brain and gill in Onychostoma macrolepis, and it was expressed at the highest level in liver and spleen. Compared with the control group, OmITLN was significantly up-regulated and then down-regulated after stimulation with Aeromonas hydrophila. In the liver, the expression of OmITLN reached its maximum at 12 hours post-infection (hpi) and was gradually down-regulated over time. In spleen, OmITLN was reached the highest value at 6hpi and then gradually returned to the initial level after 24hpi. OmITLN recombinant protein was successfully obtained and authenticated by SDS-PAGE and Western Blotting. OmITLN can agglutinated all tested bacteria, including three gram-positive bacteria (Escherichia coli, Vibrio parahaemolyticus and Aeromonas hydrophila) and three gram-negative bacteria (Streptococcus agalactiae, Bacillus cereus and Staphylococcus aureus) with Ca2+. OmITLN showed the best binding activity to D-lactose, followed by xylose, D-galactose and sucrose, with the lowest expression in D-glucose, but showed no binding activity to mycose, D-fructose and D-maltose. The binding activity of OmITLN to PGN which is gram-positive bacteria recognition structure was higher than LPS which is gram-negative bacteria recognition structure. As an important pattern recognition receptor, OmITLN is involved in the immune defense of Onychostoma macrolepis against bacteria.
2023, 47(6): 883 -894
doi: 10.7541/2023.2022.0335
Abstract:
To identify the causative agent causing the death of adult Macrobrachium rosenbergii occurred in a cultured farm of Gaoyou city, Jiangsu Province, a dominant strain named WSQ-1 was isolated from the hepatopantras of dying M. rosenbergii and identified as Aeromonas veronii based on morphological observation, physiology characteristics, biochemical identification and sequencing of 16S rRNA and gyrB gene. The symptoms of M. rosenbergii artificially infected with the strain WSQ-1 were similar with those of natural infected M. rosenbergii, showing weakened vitality, decreased appetite and white muscle. The LD50 to M. rosenbergii was 2.51×106 CFU/mL at 72h post infection. Histopathological observation showed that the pathological damage of hepatopancreas tissue was gradually aggravated with the increase of concentration or the duration of infection: the connective tissue space was enlarged and a small amount of inflammatory cells were accumulated in the early stage or low concentration, and then the lumen of hepatic tubule was deformed, hepatocytes were vacuolized, and some tissues were necrotic. In the late stage or high concentration, large area necrosis of hepatic tubule and connective tissue led to irreversible damage. The amplification result of virulence gene showed that the WSQ-1 carried 7 virulence genes including Acsv, AexT, Act, Aer, GcaT, Acg and OmpAI, which further indicated that the WSQ-1 had high virulence. Drug susceptibility test showed that 18 kinds of drugs such as cefoperazone had the most inhibitive effects on the strain. At the same time, it showed resistance to 11 kinds of drugs such as clarithromycin, completely resistant to 4 kinds of drugs such as penicillin G, only moderately sensitive to kanamycin. The results of this study can provide some reference for the identification of the pathogen of the bacterial disease of M. rosenbergii and the prevention and control of the disease caused by A. veronii.
To identify the causative agent causing the death of adult Macrobrachium rosenbergii occurred in a cultured farm of Gaoyou city, Jiangsu Province, a dominant strain named WSQ-1 was isolated from the hepatopantras of dying M. rosenbergii and identified as Aeromonas veronii based on morphological observation, physiology characteristics, biochemical identification and sequencing of 16S rRNA and gyrB gene. The symptoms of M. rosenbergii artificially infected with the strain WSQ-1 were similar with those of natural infected M. rosenbergii, showing weakened vitality, decreased appetite and white muscle. The LD50 to M. rosenbergii was 2.51×106 CFU/mL at 72h post infection. Histopathological observation showed that the pathological damage of hepatopancreas tissue was gradually aggravated with the increase of concentration or the duration of infection: the connective tissue space was enlarged and a small amount of inflammatory cells were accumulated in the early stage or low concentration, and then the lumen of hepatic tubule was deformed, hepatocytes were vacuolized, and some tissues were necrotic. In the late stage or high concentration, large area necrosis of hepatic tubule and connective tissue led to irreversible damage. The amplification result of virulence gene showed that the WSQ-1 carried 7 virulence genes including Acsv, AexT, Act, Aer, GcaT, Acg and OmpAI, which further indicated that the WSQ-1 had high virulence. Drug susceptibility test showed that 18 kinds of drugs such as cefoperazone had the most inhibitive effects on the strain. At the same time, it showed resistance to 11 kinds of drugs such as clarithromycin, completely resistant to 4 kinds of drugs such as penicillin G, only moderately sensitive to kanamycin. The results of this study can provide some reference for the identification of the pathogen of the bacterial disease of M. rosenbergii and the prevention and control of the disease caused by A. veronii.
2023, 47(6): 895 -902
doi: 10.7541/2023.2022.0461
Abstract:
Edwardsiella piscicida, belonging to the family Enterobacteriaceae, is a Gram-negative intracellular pathogen. It causes hemorrhagic septicemia in more than 20 important species of farmed fish, especially flounder (Paralichthys olivaceus) and turbot (Scophthalmus maximus), leading to huge economic losses. In dissecting the host-pathogen interaction, antibodies against virulent proteins of E. piscicida are often required. It always takes a long time to prepare antibodies in mice or rabbits, and the polyclonal or polypeptide antibodies obtained are often not specific, especially when applied in eukaryotic cells. To resolve this problem, the λ Red recombination method established in E. coli and Salmonella was optimized to introduce epitope tagging to chromosomal genes in E. piscicida, by using linear DNA fragments for homologous recombination with genomic DNA. Plasmid (pKD3/pKD4, pSU312/pSU313, pSU314/pSU315, or pSUB7) was used as the template, primers are composed of gene specific sequence plus FRT sequence. The DNA fragment obtained by PCR was introduced into E. piscicida transformed with pKD46. With the supplementation of L-arabinose, pKD46 expresses three recombinant proteins (Exo, Beta, Gam) of λ phage, under which the DNA fragment introduced recombine homologically with E. piscicida genome, resulting in target gene deletion or a commercial tag insertion. To eliminate the antibiotic gene introduced in this process, pKD46 expressing Flp recombinase (pKD46-flp) was constructed. By homologous recombination, the antibiotic gene between two FRT sites and one FRT site are eliminated. By culturing at 37℃, the pKD46-flp introduced is cured, obtaining an epitope tagging of chromosomal gene of E. piscicida. A commercial monoclonal antibody against the tag (HA, FLAG, or His) could then be used to monitor the expression or translocation of virulent proteins from E. piscicida. The method established in this study facilitates the dissection on host-pathogen interaction, and will shed light on the genetic operation on other aquatic bacterial pathogens.
Edwardsiella piscicida, belonging to the family Enterobacteriaceae, is a Gram-negative intracellular pathogen. It causes hemorrhagic septicemia in more than 20 important species of farmed fish, especially flounder (Paralichthys olivaceus) and turbot (Scophthalmus maximus), leading to huge economic losses. In dissecting the host-pathogen interaction, antibodies against virulent proteins of E. piscicida are often required. It always takes a long time to prepare antibodies in mice or rabbits, and the polyclonal or polypeptide antibodies obtained are often not specific, especially when applied in eukaryotic cells. To resolve this problem, the λ Red recombination method established in E. coli and Salmonella was optimized to introduce epitope tagging to chromosomal genes in E. piscicida, by using linear DNA fragments for homologous recombination with genomic DNA. Plasmid (pKD3/pKD4, pSU312/pSU313, pSU314/pSU315, or pSUB7) was used as the template, primers are composed of gene specific sequence plus FRT sequence. The DNA fragment obtained by PCR was introduced into E. piscicida transformed with pKD46. With the supplementation of L-arabinose, pKD46 expresses three recombinant proteins (Exo, Beta, Gam) of λ phage, under which the DNA fragment introduced recombine homologically with E. piscicida genome, resulting in target gene deletion or a commercial tag insertion. To eliminate the antibiotic gene introduced in this process, pKD46 expressing Flp recombinase (pKD46-flp) was constructed. By homologous recombination, the antibiotic gene between two FRT sites and one FRT site are eliminated. By culturing at 37℃, the pKD46-flp introduced is cured, obtaining an epitope tagging of chromosomal gene of E. piscicida. A commercial monoclonal antibody against the tag (HA, FLAG, or His) could then be used to monitor the expression or translocation of virulent proteins from E. piscicida. The method established in this study facilitates the dissection on host-pathogen interaction, and will shed light on the genetic operation on other aquatic bacterial pathogens.
2023, 47(6): 903 -909
doi: 10.7541/2023.2022.0144
Abstract:
This paper studies the community ecology of intestinal helminths in Gymnocypris waddellii from Yamdrok Lake, Tibet Autonomous Region, China, and the interactions among the parasite community, environmental conditions of the Tibet Plateau, and unique hosts. In July 2020, 180 samples [total length: 22.20—49.20 cm; average length: (36.76±4.18) cm; weight: 77.3—896.7 g; average weight: (425.92±148.27) g], including 120 females and 60 males, were dissected for the analysis of community structure, interspecific relationship and other aspects of community ecology. Intestinal helminths in the samples consist of 5 species: Neoechinorhynchus sp., Parabreviscolex niepini, Allocreadium sp., Contracaecum eudyptulae and Streptocara sp., if ranked by the prevalence of infection from the highest to the lowest (or Parabreviscolex niepini, Neoechinorhynchus sp., Streptocara sp., Allocreadium sp. and Contracaecum eudyptulae, if ranked by the mean abundance of infection from the highest to the lowest). The Margalef index of species richness is 0.59, the Shannon-Wiener index of species diversity is 1.26, the Pielou index of species evenness is 0.83, and the Berger- Parker index of species dominance is 0.50. Parabreviscolex niepini is the dominant species. Positive correlations are found between 4 groups of species: Neoechinorhynchus sp. and Allocreadium sp.; Contracaecum eudyptulae and Neoechinorhynchus sp.; Contracaecum eudyptulae and Allocreadium sp.; Contracaecum eudyptulae and Streptocara sp., if ranked by the degree of correlation from the highest to the lowest. No interspecific association is observed between other species of parasitic worms. The number of infected hosts is over 50% of the sample size. The number of hosts infected with one parasite species is the highest, followed by the number of hosts infected with 2 parasite species. Hosts infected with 3 or 4 parasite species are less common, and there are no hosts infected with 5 parasite species. In comparison with the same parasite species in the same hosts from the adjacent Chugutso Lake, which was once connected with Yamdrok Lake in the south of Tibet Autonomous Region, intestinal helminth communities in hosts from Yamdrok Lake feature higher values of prevalence and mean abundance of infection, and different dominant species. Interspecific compatibility, a measure of interspecific association, is used to describe the coexistence or competitive exclusion between two intestinal helminth communities in the hosts from Yamdrok Lake. It’s found that the interspecific compatibility between Nceoechinorhynchus sp. and Allocreadium sp. is the highest but unstable, and it changes with the water environment and species composition in the communities. The variation in the number of hosts infected with more than one parasite species indicates that the difficulty in achieving coexistence increases when interspecific interaction grows with the increase of the number of species in a sub-community.
This paper studies the community ecology of intestinal helminths in Gymnocypris waddellii from Yamdrok Lake, Tibet Autonomous Region, China, and the interactions among the parasite community, environmental conditions of the Tibet Plateau, and unique hosts. In July 2020, 180 samples [total length: 22.20—49.20 cm; average length: (36.76±4.18) cm; weight: 77.3—896.7 g; average weight: (425.92±148.27) g], including 120 females and 60 males, were dissected for the analysis of community structure, interspecific relationship and other aspects of community ecology. Intestinal helminths in the samples consist of 5 species: Neoechinorhynchus sp., Parabreviscolex niepini, Allocreadium sp., Contracaecum eudyptulae and Streptocara sp., if ranked by the prevalence of infection from the highest to the lowest (or Parabreviscolex niepini, Neoechinorhynchus sp., Streptocara sp., Allocreadium sp. and Contracaecum eudyptulae, if ranked by the mean abundance of infection from the highest to the lowest). The Margalef index of species richness is 0.59, the Shannon-Wiener index of species diversity is 1.26, the Pielou index of species evenness is 0.83, and the Berger- Parker index of species dominance is 0.50. Parabreviscolex niepini is the dominant species. Positive correlations are found between 4 groups of species: Neoechinorhynchus sp. and Allocreadium sp.; Contracaecum eudyptulae and Neoechinorhynchus sp.; Contracaecum eudyptulae and Allocreadium sp.; Contracaecum eudyptulae and Streptocara sp., if ranked by the degree of correlation from the highest to the lowest. No interspecific association is observed between other species of parasitic worms. The number of infected hosts is over 50% of the sample size. The number of hosts infected with one parasite species is the highest, followed by the number of hosts infected with 2 parasite species. Hosts infected with 3 or 4 parasite species are less common, and there are no hosts infected with 5 parasite species. In comparison with the same parasite species in the same hosts from the adjacent Chugutso Lake, which was once connected with Yamdrok Lake in the south of Tibet Autonomous Region, intestinal helminth communities in hosts from Yamdrok Lake feature higher values of prevalence and mean abundance of infection, and different dominant species. Interspecific compatibility, a measure of interspecific association, is used to describe the coexistence or competitive exclusion between two intestinal helminth communities in the hosts from Yamdrok Lake. It’s found that the interspecific compatibility between Nceoechinorhynchus sp. and Allocreadium sp. is the highest but unstable, and it changes with the water environment and species composition in the communities. The variation in the number of hosts infected with more than one parasite species indicates that the difficulty in achieving coexistence increases when interspecific interaction grows with the increase of the number of species in a sub-community.
2023, 47(6): 910 -916
doi: 10.7541/2023.2022.0049
Abstract:
In order to improve the reproductive efficiency of pink heelsplitter, Potamilus alatus, and explore the influence of parasitism on nutritive index of freshwater drum, Aplodinotus grunniens, this experiment measured the effect of parasitism of different scales through comparing the amount of glochidium falling from freshwater drum, and analyzed changes of serum biochemical indices of the host, and content of amino acid and fatty acid under stress of parasitism. Results indicated that the amount of glochidium falling from the hosts in group of big freshwater drum is significantly greater than that in group of small freshwater drum (P<0.05), while the average amount of juvenile mollusk falling from the hosts in each kilogram in group of small freshwater drum is much bigger than that in group of big freshwater drum (P<0.05); creatinine in muscles significantly increases under stress of parasitism (P<0.05), and glutamic-pyruvic transaminase, glutamic oxalacetic transaminase and lactic dehydrogenase greatly drop (P<0.05), while blood glucose, total protein, albumin, triglyceride, total cholesterol, high-density lipoprotein and low density lipoprotein barely change comparing with those in the control group (P>0.05); ash content in the experimental group barely differs from that in the control group (P>0.05), and water content and crude fat in muscle in the experimental group are significantly higher than those in the control group (P<0.05), while content of crude protein in experimental group is obviously lower than that in the control group (P<0.05); content of aspartic acid, alanine, glutamic acid, tyrosine, glycine and arginine in the experimental group are greatly lower than those in the control group (P<0.05), and content of non-essential amino acid is notably lower than that in the control group (P<0.05), while the content of other amino acids in two groups are barely different (P>0.05); the content of lauric acid (C12:0) and arachidonic acid (C20:1) in the experimental group are remarkably higher than those in the control group (P<0.05), while there is no other significant difference (P>0.05). Results indicated that small size host fish is more suitable for practical production and parasitism had little influence on the nutritive index of freshwater drum.
In order to improve the reproductive efficiency of pink heelsplitter, Potamilus alatus, and explore the influence of parasitism on nutritive index of freshwater drum, Aplodinotus grunniens, this experiment measured the effect of parasitism of different scales through comparing the amount of glochidium falling from freshwater drum, and analyzed changes of serum biochemical indices of the host, and content of amino acid and fatty acid under stress of parasitism. Results indicated that the amount of glochidium falling from the hosts in group of big freshwater drum is significantly greater than that in group of small freshwater drum (P<0.05), while the average amount of juvenile mollusk falling from the hosts in each kilogram in group of small freshwater drum is much bigger than that in group of big freshwater drum (P<0.05); creatinine in muscles significantly increases under stress of parasitism (P<0.05), and glutamic-pyruvic transaminase, glutamic oxalacetic transaminase and lactic dehydrogenase greatly drop (P<0.05), while blood glucose, total protein, albumin, triglyceride, total cholesterol, high-density lipoprotein and low density lipoprotein barely change comparing with those in the control group (P>0.05); ash content in the experimental group barely differs from that in the control group (P>0.05), and water content and crude fat in muscle in the experimental group are significantly higher than those in the control group (P<0.05), while content of crude protein in experimental group is obviously lower than that in the control group (P<0.05); content of aspartic acid, alanine, glutamic acid, tyrosine, glycine and arginine in the experimental group are greatly lower than those in the control group (P<0.05), and content of non-essential amino acid is notably lower than that in the control group (P<0.05), while the content of other amino acids in two groups are barely different (P>0.05); the content of lauric acid (C12:0) and arachidonic acid (C20:1) in the experimental group are remarkably higher than those in the control group (P<0.05), while there is no other significant difference (P>0.05). Results indicated that small size host fish is more suitable for practical production and parasitism had little influence on the nutritive index of freshwater drum.
2023, 47(6): 917 -923
doi: 10.7541/2023.2022.0099
Abstract:
Coilia nasus is an anadromous fish, and the parasitic nematodes are a confirmation of its habitat history. In order to understand the relationship between the migration time of C. nasus and its nematodes, the infection and community structure of nematodes in C. nasus were investigated from April to July 2018 in Anqing section of the Yangtze River. The results showed that the infection rate of C. nasus was 96.0%, the average intensity was (8.06±7.26), and the average abundance was (7.74±7.29). A total of 7 species were identified by ITS molecular markers, including 2 species of Anisakis, 4 species of Hysterothylacium and 1 species of Raphidascaris. All of them are marine parasites and can be used as evidence that C. nasus has seawater life. Anisakis pegreffii (84.5%) had the highest infection rate, followed by Hysterophylaxium aduncum (31.0%). The average intensity and abundance were also high. The average intensity were (6.40±6.08) and (2.81±2.49), and the average abundance were (5.41±6.05) and (0.87±1.90), respectively. The average intensity and abundance of A. pegreffii showed an upward trend in the early stage of migration, and decreased slightly but not significantly in late June (P>0.05), while the H. aduncum showed a downward trend. The community structure of C. nasus nematode varied at different migration times. The richness, mean richness and the Brillouin index showed a downward trend, but the dominant species has always been A. pegreffii, and the number in the intestinal and pyloric caecum accounts for 46.13% and 30.02% respectively. The study will provide a reference for the later development of impact of nematode parasitism and population supplement, and also provide a new method for using parasite markers to study the migratory ecology of C. nasus.
Coilia nasus is an anadromous fish, and the parasitic nematodes are a confirmation of its habitat history. In order to understand the relationship between the migration time of C. nasus and its nematodes, the infection and community structure of nematodes in C. nasus were investigated from April to July 2018 in Anqing section of the Yangtze River. The results showed that the infection rate of C. nasus was 96.0%, the average intensity was (8.06±7.26), and the average abundance was (7.74±7.29). A total of 7 species were identified by ITS molecular markers, including 2 species of Anisakis, 4 species of Hysterothylacium and 1 species of Raphidascaris. All of them are marine parasites and can be used as evidence that C. nasus has seawater life. Anisakis pegreffii (84.5%) had the highest infection rate, followed by Hysterophylaxium aduncum (31.0%). The average intensity and abundance were also high. The average intensity were (6.40±6.08) and (2.81±2.49), and the average abundance were (5.41±6.05) and (0.87±1.90), respectively. The average intensity and abundance of A. pegreffii showed an upward trend in the early stage of migration, and decreased slightly but not significantly in late June (P>0.05), while the H. aduncum showed a downward trend. The community structure of C. nasus nematode varied at different migration times. The richness, mean richness and the Brillouin index showed a downward trend, but the dominant species has always been A. pegreffii, and the number in the intestinal and pyloric caecum accounts for 46.13% and 30.02% respectively. The study will provide a reference for the later development of impact of nematode parasitism and population supplement, and also provide a new method for using parasite markers to study the migratory ecology of C. nasus.
2023, 47(6): 924 -930
doi: 10.7541/2023.2022.0143
Abstract:
In this paper, the population dynamics of the parasite Diplostomum spathaceum is studied to understand infections in the hosts Gymnocypris selincuoensis from Siling Lake, including seasonal and group differences in infections and reasons for changes in the population size, identify the parasite’s preferences for male/female hosts, left/right eyes of hosts, or specific parts of hosts’ eyes, and discuss their life history strategies. The samples were collected in different seasons in two years (2020 and 2021), with their total length, weight and sex and the number of metacercariae living on them being recorded. The prevalence and mean abundance of infection of different groups and in different seasons were calculated. To find out whether the parasite exhibits preferences for the hosts, a non-parametric test was conducted for independent groups to identify any significant difference in the size of parasite population on male/female hosts, left/right eyes of hosts and different parts of hosts’ eyes. A total of 165 samples [total length: 28.7—49.5 cm; average length: (37.9±4.0) cm; weight: 196.9—827.2 g; average weight: (473.3±127.9) g], including 82 female samples and 83 male samples, were dissected, with 515 parasites being found. The maximum number of parasites observed is 32 worms per fish. In terms of seasonal difference, the prevalence and mean abundance of infection peak in the summer of 2020 and drop in the following autumn and spring. In the summer of 2021, the prevalence of infection is on the decline, while the mean abundance of infection is on the rise. Similar prevalence and mean abundance of infection are observed in the autumn in both 2020 and 2021. To find out group difference, the samples were divided into 5 groups by their total length (TL) at the interval of 5 cm. The minimum values of the prevalence and mean abundance of infection are found in the group of which TL is between 25 cm (inclusive) and 30 cm. Groups of which TL is between 30 cm (inclusive) and 35 cm, between 35 cm (inclusive) and 40 cm, and between 40 cm (inclusive) and 45 cm have similar prevalence and mean abundance of infection. The maximum values of the prevalence and mean abundance of infection are observed in the group of which TL is between 45 cm (inclusive) and 50 cm. The parasite does not exhibit preferences for male/female hosts or left/right eyes of hosts, but they significantly prefers the crystalline lens to the vitreous body. Changes in the size of parasite population are closely related to the seasonal changes, water temperature, bird migration, and snails. The size of parasite population grows with the increase in the total length and eye volume of hosts and frequency of parasite exposure. The reason why the group with TL between 45 cm (inclusive) and 50 cm has higher values of prevalence and mean abundance may lie in the fact that they have a higher risk of parasite exposure because they are larger in size, which enables the hosts to survive from severer infection caused by a larger number of parasites. The preferences exhibited by the parasite in selecting hosts and position of eyes are part of adaptative life history strategies for better transmission and reproduction.
In this paper, the population dynamics of the parasite Diplostomum spathaceum is studied to understand infections in the hosts Gymnocypris selincuoensis from Siling Lake, including seasonal and group differences in infections and reasons for changes in the population size, identify the parasite’s preferences for male/female hosts, left/right eyes of hosts, or specific parts of hosts’ eyes, and discuss their life history strategies. The samples were collected in different seasons in two years (2020 and 2021), with their total length, weight and sex and the number of metacercariae living on them being recorded. The prevalence and mean abundance of infection of different groups and in different seasons were calculated. To find out whether the parasite exhibits preferences for the hosts, a non-parametric test was conducted for independent groups to identify any significant difference in the size of parasite population on male/female hosts, left/right eyes of hosts and different parts of hosts’ eyes. A total of 165 samples [total length: 28.7—49.5 cm; average length: (37.9±4.0) cm; weight: 196.9—827.2 g; average weight: (473.3±127.9) g], including 82 female samples and 83 male samples, were dissected, with 515 parasites being found. The maximum number of parasites observed is 32 worms per fish. In terms of seasonal difference, the prevalence and mean abundance of infection peak in the summer of 2020 and drop in the following autumn and spring. In the summer of 2021, the prevalence of infection is on the decline, while the mean abundance of infection is on the rise. Similar prevalence and mean abundance of infection are observed in the autumn in both 2020 and 2021. To find out group difference, the samples were divided into 5 groups by their total length (TL) at the interval of 5 cm. The minimum values of the prevalence and mean abundance of infection are found in the group of which TL is between 25 cm (inclusive) and 30 cm. Groups of which TL is between 30 cm (inclusive) and 35 cm, between 35 cm (inclusive) and 40 cm, and between 40 cm (inclusive) and 45 cm have similar prevalence and mean abundance of infection. The maximum values of the prevalence and mean abundance of infection are observed in the group of which TL is between 45 cm (inclusive) and 50 cm. The parasite does not exhibit preferences for male/female hosts or left/right eyes of hosts, but they significantly prefers the crystalline lens to the vitreous body. Changes in the size of parasite population are closely related to the seasonal changes, water temperature, bird migration, and snails. The size of parasite population grows with the increase in the total length and eye volume of hosts and frequency of parasite exposure. The reason why the group with TL between 45 cm (inclusive) and 50 cm has higher values of prevalence and mean abundance may lie in the fact that they have a higher risk of parasite exposure because they are larger in size, which enables the hosts to survive from severer infection caused by a larger number of parasites. The preferences exhibited by the parasite in selecting hosts and position of eyes are part of adaptative life history strategies for better transmission and reproduction.
2023, 47(6): 931 -939
doi: 10.7541/2023.2022.0106
Abstract:
In order to investigate the effects of underwater noise on behavior (swimming rate, feeding rate, spatial distribution) and gut microorganisms of sturgeon, hybridized sturgeon were exposed to noise [(145±5) dB, 400 Hz] for 0, 48h, 7d, 7d, and 14d, followed by 48h of recovery in an environment without stressful noise. The results showed that the swimming and feeding rates of hybrid sturgeon were significantly reduced and the spatial distribution was changed after noise stimulation. At the beginning of the noise stimulation, the hybrid sturgeon gathered on the side away from the noise source, but gradually approached the noise source after 3min. The microbial composition was significantly different from the other groups at 7d of noise stress. There was no significant effect of noise on the abundance of gut microorganisms in hybrid sturgeon. Differences in the dominant populations of gut microorganisms existed in each group at different time periods and the dominant populations changed over time. The results of the above microbiological analysis showed that “cell signaling processes” “carbohydrate transport” and “amino acid transport and metabolic functions” were significantly lower than those of the other groups at 48h and 7d of noise stress as predicted by COG. The results showed that noise had significant effects on the feeding rate, swimming rate, and spatial distribution of hybrid sturgeon, changing the composition and proportion of its gut microorganisms and affecting various vital life pathways, such as amino acid metabolism. This experiment simulated the mixed noise of various underwater noise sources and explored their effects on the behavior and gut microorganisms of hybrid sturgeon for the first time, which can provide basic information for the in-depth exploration of healthy ecological breeding and physiological response mechanisms to adversity of hybrid sturgeon.
In order to investigate the effects of underwater noise on behavior (swimming rate, feeding rate, spatial distribution) and gut microorganisms of sturgeon, hybridized sturgeon were exposed to noise [(145±5) dB, 400 Hz] for 0, 48h, 7d, 7d, and 14d, followed by 48h of recovery in an environment without stressful noise. The results showed that the swimming and feeding rates of hybrid sturgeon were significantly reduced and the spatial distribution was changed after noise stimulation. At the beginning of the noise stimulation, the hybrid sturgeon gathered on the side away from the noise source, but gradually approached the noise source after 3min. The microbial composition was significantly different from the other groups at 7d of noise stress. There was no significant effect of noise on the abundance of gut microorganisms in hybrid sturgeon. Differences in the dominant populations of gut microorganisms existed in each group at different time periods and the dominant populations changed over time. The results of the above microbiological analysis showed that “cell signaling processes” “carbohydrate transport” and “amino acid transport and metabolic functions” were significantly lower than those of the other groups at 48h and 7d of noise stress as predicted by COG. The results showed that noise had significant effects on the feeding rate, swimming rate, and spatial distribution of hybrid sturgeon, changing the composition and proportion of its gut microorganisms and affecting various vital life pathways, such as amino acid metabolism. This experiment simulated the mixed noise of various underwater noise sources and explored their effects on the behavior and gut microorganisms of hybrid sturgeon for the first time, which can provide basic information for the in-depth exploration of healthy ecological breeding and physiological response mechanisms to adversity of hybrid sturgeon.
2023, 47(6): 940 -949
doi: 10.7541/2023.2022.0276
Abstract:
The tiger puffer, Takifugu rubripes, which distribute in the East China sea, Yellow sea and Bohai sea, is an important fish species in aquaculture and stock enhancement in China. Due to the higher fishing pressure, catches of wild tiger puffer decreased significantly in the late 1980s. Aquaculture-based fisheries enhancement involves the release of cultured organisms to enhance, conserve, or restore fisheries. To restore the stock of tiger puffer, China, Korea and Japan began to release this species. High mortalities in stock enhancement have been found in many species after release due to predation and starvation. Swimming ability directly affects the capacity of finding food, escaping from predators, maintaining position, schooling and migration in released fish. In this study, we investigated the effects of body mass and starvation on the swimming ability of juvenile tiger puffer. The critical swimming speed (Ucrit, cm/s), preferred swimming speed (Upref, cm/s), percentage of accumulated time (Pt, %) under six flow velocities (2—36 cm/s), average flow velocity of preferred zone (Vmean, cm/s) and total swimming distance (D1h, m) of juvenile tiger puffer was determined under different body masses (0.22—3.31 g) and starvation days (1d, 3d, 6d and 9d). Body mass and starvation significantly affected the Ucrit, Pt, Vmean and D1h of juvenile tiger puffer. The Ucrit, Upref, Vmean and D1h increased from 10.17 cm/s, 2—5 cm/s, 3.79 cm/s and 139.06 m to 17.13 cm/s, 13—26 cm/s, 16.51 cm/s and 580.03 m, respectively, as the body mass increased, whereas the relative Ucrit (Ucrit’, body length/s, BL/s) decreased from 5.83 to 3.56 BL/s. The relationship between body mass and Ucrit, Ucrit’, Pt, Vmean and D1h can be described by the quadratic model. The Ucrit, Ucrit’, Upref, Vmean and D1h decreased from 16.47 cm/s, 3.38 BL/s, 13—26 cm/s, 15.45 cm/s and 566.18 m to 10.03 cm/s, 1.98 BL/s, 2 cm/s, 2.83 cm/s and 119.74 m, respectively, as the starvation day increased. The relationship between starvation day and Ucrit, Ucrit’, Pt, Vmean and D1h can be described by the quadratic model. The Ucrit increased as the body mass increased, which might be due to the increase in muscle mass and efficiency, available energy stores and metabolic capacity with size. Compared to larger conspecifics, the cardiorespiratory system of small fish is more efficient because they have relatively larger respiratory and circulatory organs. The maximum metabolic rate (MMR) decreased as the body mass increased in fish, which might lead to the decrease in Ucrit’. The stronger the swimming ability of the released fish, the higher the survival rate. As the swimming ability of juvenile tiger puffer increased with the body mass, we suggested that the release size should above 5 cm. In order to prevent the released tiger puffer from being flushed away by the current or swimming against the current constantly, the current velocity of the releasing area should below 20 cm/s. The swimming ability of juvenile tiger puffer decreased with the starvation days, which might be due to the decrease in muscle enzyme activity, metabolic capacity and available energy for swimming under starvation. The reduction in the swimming ability might weaken the predation and anti-predation capacity of the released tiger puffer. Results can be of value in understanding ecological processes and improving the stock enhancement of tiger puffer.
The tiger puffer, Takifugu rubripes, which distribute in the East China sea, Yellow sea and Bohai sea, is an important fish species in aquaculture and stock enhancement in China. Due to the higher fishing pressure, catches of wild tiger puffer decreased significantly in the late 1980s. Aquaculture-based fisheries enhancement involves the release of cultured organisms to enhance, conserve, or restore fisheries. To restore the stock of tiger puffer, China, Korea and Japan began to release this species. High mortalities in stock enhancement have been found in many species after release due to predation and starvation. Swimming ability directly affects the capacity of finding food, escaping from predators, maintaining position, schooling and migration in released fish. In this study, we investigated the effects of body mass and starvation on the swimming ability of juvenile tiger puffer. The critical swimming speed (Ucrit, cm/s), preferred swimming speed (Upref, cm/s), percentage of accumulated time (Pt, %) under six flow velocities (2—36 cm/s), average flow velocity of preferred zone (Vmean, cm/s) and total swimming distance (D1h, m) of juvenile tiger puffer was determined under different body masses (0.22—3.31 g) and starvation days (1d, 3d, 6d and 9d). Body mass and starvation significantly affected the Ucrit, Pt, Vmean and D1h of juvenile tiger puffer. The Ucrit, Upref, Vmean and D1h increased from 10.17 cm/s, 2—5 cm/s, 3.79 cm/s and 139.06 m to 17.13 cm/s, 13—26 cm/s, 16.51 cm/s and 580.03 m, respectively, as the body mass increased, whereas the relative Ucrit (Ucrit’, body length/s, BL/s) decreased from 5.83 to 3.56 BL/s. The relationship between body mass and Ucrit, Ucrit’, Pt, Vmean and D1h can be described by the quadratic model. The Ucrit, Ucrit’, Upref, Vmean and D1h decreased from 16.47 cm/s, 3.38 BL/s, 13—26 cm/s, 15.45 cm/s and 566.18 m to 10.03 cm/s, 1.98 BL/s, 2 cm/s, 2.83 cm/s and 119.74 m, respectively, as the starvation day increased. The relationship between starvation day and Ucrit, Ucrit’, Pt, Vmean and D1h can be described by the quadratic model. The Ucrit increased as the body mass increased, which might be due to the increase in muscle mass and efficiency, available energy stores and metabolic capacity with size. Compared to larger conspecifics, the cardiorespiratory system of small fish is more efficient because they have relatively larger respiratory and circulatory organs. The maximum metabolic rate (MMR) decreased as the body mass increased in fish, which might lead to the decrease in Ucrit’. The stronger the swimming ability of the released fish, the higher the survival rate. As the swimming ability of juvenile tiger puffer increased with the body mass, we suggested that the release size should above 5 cm. In order to prevent the released tiger puffer from being flushed away by the current or swimming against the current constantly, the current velocity of the releasing area should below 20 cm/s. The swimming ability of juvenile tiger puffer decreased with the starvation days, which might be due to the decrease in muscle enzyme activity, metabolic capacity and available energy for swimming under starvation. The reduction in the swimming ability might weaken the predation and anti-predation capacity of the released tiger puffer. Results can be of value in understanding ecological processes and improving the stock enhancement of tiger puffer.
2023, 47(6): 950 -957
doi: 10.7541/2023.2022.0307
Abstract:
To investigate the effects of fasting for 1—2 weeks on swimming performance, thermal tolerance and spontaneous activity juvenile Chinese sucker (Myxocyprinus asiaticus), the body mass and body length of 108 fish with (3.26±0.64) g and (5.32±0.32) cm were randomly divided into 3 groups, i.e., control group, 1 week and 2 weeks fasting group. Then, relevant parameters of swimming ability, thermal tolerance and spontaneous activity of these fishes were measured after different fasting times. Fasting for 1—2 weeks has no effects on the rest metabolic rate and critical swimming speed of M. asiaticus. Maximum metabolic rate, metabolic scope, cost of transport, head height/head length and body height/body length significantly increased in 1 week and 2 weeks fasting groups compared to that in control group (P<0.05). Fasting for 1—2 weeks has no effects on the critical thermal minimum and lethal thermal minimum of M. asiaticus. Critical and lethal thermal maximum significantly increased in 1 week and 2 weeks fasting groups compared to that in control group (P<0.05). Fasting for 1—2 weeks has no effects on the total movement distance, average movement speed and percent time spent moving of M. asiaticus. Our results suggested that aerobic swimming capacity and spontaneous activity of M. asiaticus was not affected by fasting for 1—2 weeks, which may be beneficial for maintaining their daily foraging activities. Moreover, fasting for 1—2 weeks has no significant impact on the low-temperature tolerance, but this stress can improve the high-temperature tolerance of M. asiaticus.
To investigate the effects of fasting for 1—2 weeks on swimming performance, thermal tolerance and spontaneous activity juvenile Chinese sucker (Myxocyprinus asiaticus), the body mass and body length of 108 fish with (3.26±0.64) g and (5.32±0.32) cm were randomly divided into 3 groups, i.e., control group, 1 week and 2 weeks fasting group. Then, relevant parameters of swimming ability, thermal tolerance and spontaneous activity of these fishes were measured after different fasting times. Fasting for 1—2 weeks has no effects on the rest metabolic rate and critical swimming speed of M. asiaticus. Maximum metabolic rate, metabolic scope, cost of transport, head height/head length and body height/body length significantly increased in 1 week and 2 weeks fasting groups compared to that in control group (P<0.05). Fasting for 1—2 weeks has no effects on the critical thermal minimum and lethal thermal minimum of M. asiaticus. Critical and lethal thermal maximum significantly increased in 1 week and 2 weeks fasting groups compared to that in control group (P<0.05). Fasting for 1—2 weeks has no effects on the total movement distance, average movement speed and percent time spent moving of M. asiaticus. Our results suggested that aerobic swimming capacity and spontaneous activity of M. asiaticus was not affected by fasting for 1—2 weeks, which may be beneficial for maintaining their daily foraging activities. Moreover, fasting for 1—2 weeks has no significant impact on the low-temperature tolerance, but this stress can improve the high-temperature tolerance of M. asiaticus.
2023, 47(6): 958 -972
doi: 10.7541/2023.2022.0339
Abstract:
In order to investigate the effects of nutritional status and metabolic range on group behavior of fish, juvenile crucian carp (Carassius auratus) was conducted as the animal model, and its feeding metabolism (specific dynamics, SDA) and metabolic rates (Standard Metabolic Rate, SMR; Maximum Metabolic Rate, MMR) was determined to calculate metabolic scope (AS=MMR–SMR) at (25.4±0.2)℃. Based on the combination of nutritional state and AS, five ‘nutritional state plus AS’ treatments were determined for their individual spatial position within a group, feeding intake, individual characteristics (e.g., individual swimming speed and acceleration), and group characteristics (e.g., synchronization of speed, inter-individual distance, nearest neighbour distance, and group polarization). Our results showed that nutritional status, starvation, aerobic scope, feeding and digestion had no effect on individual spatial position within a group. Starvation and digestion did not affect the group cohesiveness of juvenile crucian carp, but starvation reduced the group coordination of this species only during digestion, i.e., difference in individual food acquisition ability led to a different digestion strategy among group-mates, resulting in a lower synchronization of speed and eventually a decrease in group coordination. In the control group, the space in the front of the group confers the ecological advantage of individuals to obtain more food items, but starvation eliminated this ecological advantage in the front of the group. The feeding intake and feeding level of the control group were negatively correlated with the predicted remaining AS, and which of the starvation group were not correlated with the predicted remaining AS. Our results suggested that both the nutritional status and aerobic scope had no effect on the individual spatial position within schooling in gold fish. Occupying the spatial position at the front of the school can confer to the ecological benefits (e.g., more food resources), but starvation eliminates the heterogeneity of ecological benefits of individual spatial position distribution within the school. Starvation and digestion have no effect on group cohesion of the goldfish, but the phenomenon that starvation reduces the group coordination only appeared during the digestion stage. Individual difference in ability to obtain food within the group may lead to different digestive strategies among group-mates, resulting in more disordered swimming align of individuals, and finally leads to the decline of group coordination.
In order to investigate the effects of nutritional status and metabolic range on group behavior of fish, juvenile crucian carp (Carassius auratus) was conducted as the animal model, and its feeding metabolism (specific dynamics, SDA) and metabolic rates (Standard Metabolic Rate, SMR; Maximum Metabolic Rate, MMR) was determined to calculate metabolic scope (AS=MMR–SMR) at (25.4±0.2)℃. Based on the combination of nutritional state and AS, five ‘nutritional state plus AS’ treatments were determined for their individual spatial position within a group, feeding intake, individual characteristics (e.g., individual swimming speed and acceleration), and group characteristics (e.g., synchronization of speed, inter-individual distance, nearest neighbour distance, and group polarization). Our results showed that nutritional status, starvation, aerobic scope, feeding and digestion had no effect on individual spatial position within a group. Starvation and digestion did not affect the group cohesiveness of juvenile crucian carp, but starvation reduced the group coordination of this species only during digestion, i.e., difference in individual food acquisition ability led to a different digestion strategy among group-mates, resulting in a lower synchronization of speed and eventually a decrease in group coordination. In the control group, the space in the front of the group confers the ecological advantage of individuals to obtain more food items, but starvation eliminated this ecological advantage in the front of the group. The feeding intake and feeding level of the control group were negatively correlated with the predicted remaining AS, and which of the starvation group were not correlated with the predicted remaining AS. Our results suggested that both the nutritional status and aerobic scope had no effect on the individual spatial position within schooling in gold fish. Occupying the spatial position at the front of the school can confer to the ecological benefits (e.g., more food resources), but starvation eliminates the heterogeneity of ecological benefits of individual spatial position distribution within the school. Starvation and digestion have no effect on group cohesion of the goldfish, but the phenomenon that starvation reduces the group coordination only appeared during the digestion stage. Individual difference in ability to obtain food within the group may lead to different digestive strategies among group-mates, resulting in more disordered swimming align of individuals, and finally leads to the decline of group coordination.
2023, 47(6): 973 -981
doi: 10.7541/2023.2022.0363
Abstract:
In order to investigate the growth and behavior of juvenile black rockfish (Sebastes schlegelii) under different flow velocities, four treatment groups were set up. The average water flows velocity of the four treatments was maintained at 0, 0.5, 1.5, and 2.5 BL/s, expressed as C, L, M, and H, respectively. The experiment lasted for 43d and eight behavior indicators were analyzed. The results showed the following: (1) The final body lengths in M and L were significantly higher than those in the other two treatment groups (P<0.05); the final weight, specific growth rate and weight gain rate were significantly higher in treatment M than those in treatment C and H (P<0.05); the feed conversion ratio was significantly lower in treatment L than that in treatment H (P<0.05). (2) After 30d of the experiment, the accumulated residence time of the outer-circle area was significantly lower in both the M and H treatment groups compared with C and L treatment groups (P<0.05); the accumulated residence time in the middle-circle area was significantly higher in M and L treatment groups (P<0.05); the accumulated residence time of inner-circle area in treatment H was significantly higher than that in other treatment groups (P<0.05); the maximum accelerations of M were significantly higher than those of C and L treatment (P<0.05), after 36d of the experiment, the average velocity of the M treatment was significantly higher than that in the other treatment groups (P<0.05). In conclusion, moderate swimming training significantly improved the growth performance of juvenile black rockfish, and the optimal flow velocity occurred at 1.5 BL/s under the present experimental conditions. Flow velocity significantly influenced the behavioral characteristics of juvenile black rockfish. Behavioral characteristics, such as regional preference and activity status, could be used to assess the respond of juvenile black rockfish to various water flow velocities.
In order to investigate the growth and behavior of juvenile black rockfish (Sebastes schlegelii) under different flow velocities, four treatment groups were set up. The average water flows velocity of the four treatments was maintained at 0, 0.5, 1.5, and 2.5 BL/s, expressed as C, L, M, and H, respectively. The experiment lasted for 43d and eight behavior indicators were analyzed. The results showed the following: (1) The final body lengths in M and L were significantly higher than those in the other two treatment groups (P<0.05); the final weight, specific growth rate and weight gain rate were significantly higher in treatment M than those in treatment C and H (P<0.05); the feed conversion ratio was significantly lower in treatment L than that in treatment H (P<0.05). (2) After 30d of the experiment, the accumulated residence time of the outer-circle area was significantly lower in both the M and H treatment groups compared with C and L treatment groups (P<0.05); the accumulated residence time in the middle-circle area was significantly higher in M and L treatment groups (P<0.05); the accumulated residence time of inner-circle area in treatment H was significantly higher than that in other treatment groups (P<0.05); the maximum accelerations of M were significantly higher than those of C and L treatment (P<0.05), after 36d of the experiment, the average velocity of the M treatment was significantly higher than that in the other treatment groups (P<0.05). In conclusion, moderate swimming training significantly improved the growth performance of juvenile black rockfish, and the optimal flow velocity occurred at 1.5 BL/s under the present experimental conditions. Flow velocity significantly influenced the behavioral characteristics of juvenile black rockfish. Behavioral characteristics, such as regional preference and activity status, could be used to assess the respond of juvenile black rockfish to various water flow velocities.
2023, 47(6): 982 -988
doi: 10.7541/2023.2022.0285
Abstract:
Rice-crayfih-eel co-culture is a high benefit comprehensive culture model that integrating rice planting, crayfish and eel cultivation. However, study on the predatory relationship between eel and crayfish is lacking, which is one of the key issues related to the establishment of this model. This study explored the potential food organisms and food composition of eel in rice-crayfish fields and its predation selection for crayfish by investigating the resources of macroorganisms and benthos and analyzing the gastrointestinal contents of eel in rice crayfish fields. The results showed that the natural bait for rice field eels was abundant in the paddy field environment, a total of 16 genera of basic bait organisms were found. Crayfish was the most preferred prey for eel, followed by caridina, earthworms and aquatic oligochaetes. The percentage of crayfish in the food mass of rice field eels was the highest from April to August, with a maximum of 93.90% in August, and a minimum of (76.85±20.66)% in April. When crayfish was the only food, the average daily predation of each large-size eel (≥200 g) was (1.63±0.065) g; when crayfish, caridina and earthworms were used as food, the rice field eels mainly fed on crayfish and did not feed on earthworms with the selection indices were 0.066, –0.266 and –1.000, respectively, When the live crayfish and feed (fresh surimi and crayfish artificial compound) were used as food, the rice field eels were mainly fed on feed but not on crayfish with the selection indices were –0.846 and 0.591, respectively. The results of this study provide a theoretical basis for the establishment of rice-crayfish-eel co-culture model and reasonable stocking of eel under this model.
Rice-crayfih-eel co-culture is a high benefit comprehensive culture model that integrating rice planting, crayfish and eel cultivation. However, study on the predatory relationship between eel and crayfish is lacking, which is one of the key issues related to the establishment of this model. This study explored the potential food organisms and food composition of eel in rice-crayfish fields and its predation selection for crayfish by investigating the resources of macroorganisms and benthos and analyzing the gastrointestinal contents of eel in rice crayfish fields. The results showed that the natural bait for rice field eels was abundant in the paddy field environment, a total of 16 genera of basic bait organisms were found. Crayfish was the most preferred prey for eel, followed by caridina, earthworms and aquatic oligochaetes. The percentage of crayfish in the food mass of rice field eels was the highest from April to August, with a maximum of 93.90% in August, and a minimum of (76.85±20.66)% in April. When crayfish was the only food, the average daily predation of each large-size eel (≥200 g) was (1.63±0.065) g; when crayfish, caridina and earthworms were used as food, the rice field eels mainly fed on crayfish and did not feed on earthworms with the selection indices were 0.066, –0.266 and –1.000, respectively, When the live crayfish and feed (fresh surimi and crayfish artificial compound) were used as food, the rice field eels were mainly fed on feed but not on crayfish with the selection indices were –0.846 and 0.591, respectively. The results of this study provide a theoretical basis for the establishment of rice-crayfish-eel co-culture model and reasonable stocking of eel under this model.
2023, 47(6): 989 -996
doi: 10.7541/2023.2022.0378
Abstract:
Fish are constantly under a dilemma to balance the behaviors of foraging and predator avoidance in their natural habitats. The present study aimed to investigate the balance between sheltering and foraging activities of fish shoal with different percentages of starved individuals, as well as their response to a simulated predation risk. The Chindongo demasoni, a group living cichlid fish species was selected as an experimental model, and a six-arm radius maze equipped with both shelters and food items was used as an observation arena. The fission-fusion dynamics of fish shoals composed of 8 members with different percentages of starved individuals (8F0S, 7F0S, 4F4S, 1F7S and 0F8S, F represents regularly fed member and S represents starved member) were videoed and analyzed. The main results are as follows (1) Regularly fed fish shoal (i.e., 8F0S) showed higher distribution density in the shelter arm compared to other regions of the maze. However, with the increase of starved member, the distribution density showed a linear increase tendency in the food arm, and there had been no significant difference between in shelter- and food-arms in 0F8S. (2) The grouping frequency in shelter arm decreased with the increased number of starved member, however, none of the variables about fission-fusion dynamics in food arm increased with the increased starved member. (3) Simulated predation risk elicited profound increase in grouping in the shelter arm no matter what the shoal composition is. These results suggested that (1) High priority of behavior strategy in C. demasoni is avoiding predation risk when explored in a novel environment. (2) Shoaling behavior of C. demasoni might be decided by majority of group members rather than minority individuals.
Fish are constantly under a dilemma to balance the behaviors of foraging and predator avoidance in their natural habitats. The present study aimed to investigate the balance between sheltering and foraging activities of fish shoal with different percentages of starved individuals, as well as their response to a simulated predation risk. The Chindongo demasoni, a group living cichlid fish species was selected as an experimental model, and a six-arm radius maze equipped with both shelters and food items was used as an observation arena. The fission-fusion dynamics of fish shoals composed of 8 members with different percentages of starved individuals (8F0S, 7F0S, 4F4S, 1F7S and 0F8S, F represents regularly fed member and S represents starved member) were videoed and analyzed. The main results are as follows (1) Regularly fed fish shoal (i.e., 8F0S) showed higher distribution density in the shelter arm compared to other regions of the maze. However, with the increase of starved member, the distribution density showed a linear increase tendency in the food arm, and there had been no significant difference between in shelter- and food-arms in 0F8S. (2) The grouping frequency in shelter arm decreased with the increased number of starved member, however, none of the variables about fission-fusion dynamics in food arm increased with the increased starved member. (3) Simulated predation risk elicited profound increase in grouping in the shelter arm no matter what the shoal composition is. These results suggested that (1) High priority of behavior strategy in C. demasoni is avoiding predation risk when explored in a novel environment. (2) Shoaling behavior of C. demasoni might be decided by majority of group members rather than minority individuals.
2023, 47(6): 997 -1006
doi: 10.7541/2023.2022.0303
Abstract:
White-leg shrimp (Litopenaeus vannamei) as an important aquatic economic species in the world, behavioral acoustics research will help to improve the level of aquaculture. In the present study, two sizes of the white-leg shrimp (4—6 cm TL and 10—11 cm TL) from the nursery of Shanghai Ocean University were investigated. The experiment was conducted in 2 glass tanks (4 cm×28 cm×30 cm) which were shaded. In addition, there were two controllable underwater lights of 10W in each tank. One underwater camera and one hydrophone were fixed in each tank. The hydrophone was 20 cm away from the top and connected to an SM4 recorder. Prior to the experiment, the controlled underwater light and the underwater camera (turned on before placing the water) are placed in the desired location. For each measurement, individual white-leg shrimp was used and acclimated for 40—60min under the dark prior to measuring. Sounds were recorded for 10 minutes after the lights were switched on (a timer controlled the time). Meanwhile, the behaviors of the white-leg shrimp were captured by the underwater camera. The results showed that the main peak frequency of the acoustic signals was about 250 Hz, and the secondary peak appeared near 425 Hz produced by the small white-leg shrimp during fast swimming. The primary peak frequency of acoustic signals was 70 Hz, and the secondary peak was 15 Hz produced by the large shrimp. Further, the center frequency and frequency range of the acoustic signals of the tail flick was significantly different from that of the fasting swimming. We also collected a signal of tail flick from the white leg shrimp in the shrimp pond. The energy range of the signal was 0.5—6 kHz. The energy frequency range was 1—4 kHz, and the maximum concentrated energy frequency was about 2 kHz. Different from the laboratory’s results, the main peak frequency of the signal was about 1.8 kHz, and there was a main secondary peak of about 250 Hz. In comparison to the laboratory data, the pond background noise and the sound produced by the white-leg shrimp during fast swimming were low-frequency signals. The frequency of the signal by tail-flick of the white-leg shrimp was higher than the background noise. The signal duration in the pond and laboratory was about 0.01s, and the frequency distribution of the energy was concentrated at 2—3 kHz. In summary, we studied the fast swimming sound production by two size white-leg shrimp. In the future, the tail flick sounds produced by shrimps of different conditions need further study, which is essential to utilizing sound information for monitoring shrimp health.
2023, 47(6): 1007 -1024
doi: 10.7541/2023.2022.0454
Abstract:
Egg quality is a complex biological characteristic, which determines the reproductive capacity of females. Fish egg quality refers to the fertilizing ability of eggs and the ability to support the normal development of embryos and larvae. It is directly related to the formation of fertilized eggs, the early development of embryos, and the survival and development of larvae and juvenile fish. It is the key-link that determines the success of fish breeding and breeding efficiency. It is an important prerequisite for the development of aquaculture industry to evaluate egg quality objectively and accurately, to improve egg quality and to obtain a large number of mature eggs with high quality. In theory, fish egg quality is determined by all deposited maternal materials and their spatial and temporal distribution patterns in the egg. In this paper, the research status of fish oogenesis, maturation and the evaluation criteria of egg quality are summarized. In addition, the regulation of egg quality by maternal factors based on zebrafish model is highlighted. Finally, the key scientific questions involved in fish oocyte quality that need to be studied and solved are proposed, i.e., the main biological events that determine and are affected by egg quality, including oogonia-to-oocyte transition, oocyte-to-egg transition, egg-to-embryo transition, embryo-to-larval transition, and larval-to-juvenile transition.
Egg quality is a complex biological characteristic, which determines the reproductive capacity of females. Fish egg quality refers to the fertilizing ability of eggs and the ability to support the normal development of embryos and larvae. It is directly related to the formation of fertilized eggs, the early development of embryos, and the survival and development of larvae and juvenile fish. It is the key-link that determines the success of fish breeding and breeding efficiency. It is an important prerequisite for the development of aquaculture industry to evaluate egg quality objectively and accurately, to improve egg quality and to obtain a large number of mature eggs with high quality. In theory, fish egg quality is determined by all deposited maternal materials and their spatial and temporal distribution patterns in the egg. In this paper, the research status of fish oogenesis, maturation and the evaluation criteria of egg quality are summarized. In addition, the regulation of egg quality by maternal factors based on zebrafish model is highlighted. Finally, the key scientific questions involved in fish oocyte quality that need to be studied and solved are proposed, i.e., the main biological events that determine and are affected by egg quality, including oogonia-to-oocyte transition, oocyte-to-egg transition, egg-to-embryo transition, embryo-to-larval transition, and larval-to-juvenile transition.
